ID: 1091811872

View in Genome Browser
Species Human (GRCh38)
Location 12:3406182-3406204
Sequence GCTCCATCCTTGGCTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3134
Summary {0: 2, 1: 12, 2: 344, 3: 1029, 4: 1747}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811872_1091811882 5 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811882 12:3406210-3406232 GGATTCAGGGGACAAGGTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 229
1091811872_1091811888 24 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811888 12:3406229-3406251 CTGGGGCTACACACAGCAGGGGG 0: 1
1: 2
2: 39
3: 156
4: 624
1091811872_1091811887 23 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811887 12:3406228-3406250 TCTGGGGCTACACACAGCAGGGG 0: 1
1: 2
2: 15
3: 88
4: 521
1091811872_1091811880 -7 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811880 12:3406198-3406220 ATGGAGCAGCTGGGATTCAGGGG 0: 1
1: 0
2: 3
3: 39
4: 343
1091811872_1091811883 6 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811883 12:3406211-3406233 GATTCAGGGGACAAGGTTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 144
1091811872_1091811884 7 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811884 12:3406212-3406234 ATTCAGGGGACAAGGTTCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 198
1091811872_1091811885 21 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811885 12:3406226-3406248 GTTCTGGGGCTACACACAGCAGG 0: 1
1: 0
2: 12
3: 62
4: 318
1091811872_1091811881 -1 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811881 12:3406204-3406226 CAGCTGGGATTCAGGGGACAAGG 0: 1
1: 0
2: 2
3: 58
4: 370
1091811872_1091811878 -9 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811878 12:3406196-3406218 GGATGGAGCAGCTGGGATTCAGG 0: 1
1: 4
2: 156
3: 563
4: 1338
1091811872_1091811879 -8 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811879 12:3406197-3406219 GATGGAGCAGCTGGGATTCAGGG 0: 1
1: 12
2: 266
3: 799
4: 1772
1091811872_1091811886 22 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811886 12:3406227-3406249 TTCTGGGGCTACACACAGCAGGG 0: 1
1: 0
2: 12
3: 68
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811872 Original CRISPR GCTCCATCCTTGGCTAAAAG GGG (reversed) Intronic
Too many off-targets to display for this crispr