ID: 1091811878

View in Genome Browser
Species Human (GRCh38)
Location 12:3406196-3406218
Sequence GGATGGAGCAGCTGGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2062
Summary {0: 1, 1: 4, 2: 156, 3: 563, 4: 1338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811868_1091811878 24 Left 1091811868 12:3406149-3406171 CCTTTTGAAGCAATGGCTTGAGC 0: 1
1: 35
2: 319
3: 676
4: 1224
Right 1091811878 12:3406196-3406218 GGATGGAGCAGCTGGGATTCAGG 0: 1
1: 4
2: 156
3: 563
4: 1338
1091811873_1091811878 -10 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811878 12:3406196-3406218 GGATGGAGCAGCTGGGATTCAGG 0: 1
1: 4
2: 156
3: 563
4: 1338
1091811872_1091811878 -9 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811878 12:3406196-3406218 GGATGGAGCAGCTGGGATTCAGG 0: 1
1: 4
2: 156
3: 563
4: 1338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811878 Original CRISPR GGATGGAGCAGCTGGGATTC AGG Intronic
Too many off-targets to display for this crispr