ID: 1091811879

View in Genome Browser
Species Human (GRCh38)
Location 12:3406197-3406219
Sequence GATGGAGCAGCTGGGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2850
Summary {0: 1, 1: 12, 2: 266, 3: 799, 4: 1772}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811872_1091811879 -8 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811879 12:3406197-3406219 GATGGAGCAGCTGGGATTCAGGG 0: 1
1: 12
2: 266
3: 799
4: 1772
1091811874_1091811879 -10 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811879 12:3406197-3406219 GATGGAGCAGCTGGGATTCAGGG 0: 1
1: 12
2: 266
3: 799
4: 1772
1091811868_1091811879 25 Left 1091811868 12:3406149-3406171 CCTTTTGAAGCAATGGCTTGAGC 0: 1
1: 35
2: 319
3: 676
4: 1224
Right 1091811879 12:3406197-3406219 GATGGAGCAGCTGGGATTCAGGG 0: 1
1: 12
2: 266
3: 799
4: 1772
1091811873_1091811879 -9 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811879 12:3406197-3406219 GATGGAGCAGCTGGGATTCAGGG 0: 1
1: 12
2: 266
3: 799
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811879 Original CRISPR GATGGAGCAGCTGGGATTCA GGG Intronic
Too many off-targets to display for this crispr