ID: 1091811880

View in Genome Browser
Species Human (GRCh38)
Location 12:3406198-3406220
Sequence ATGGAGCAGCTGGGATTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811868_1091811880 26 Left 1091811868 12:3406149-3406171 CCTTTTGAAGCAATGGCTTGAGC 0: 1
1: 35
2: 319
3: 676
4: 1224
Right 1091811880 12:3406198-3406220 ATGGAGCAGCTGGGATTCAGGGG 0: 1
1: 0
2: 3
3: 39
4: 343
1091811874_1091811880 -9 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811880 12:3406198-3406220 ATGGAGCAGCTGGGATTCAGGGG 0: 1
1: 0
2: 3
3: 39
4: 343
1091811872_1091811880 -7 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811880 12:3406198-3406220 ATGGAGCAGCTGGGATTCAGGGG 0: 1
1: 0
2: 3
3: 39
4: 343
1091811873_1091811880 -8 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811880 12:3406198-3406220 ATGGAGCAGCTGGGATTCAGGGG 0: 1
1: 0
2: 3
3: 39
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811880 Original CRISPR ATGGAGCAGCTGGGATTCAG GGG Intronic
900172961 1:1279156-1279178 ATGGAGGAACTGGGGTTCCGTGG + Intergenic
900942750 1:5811590-5811612 ATGAAGCAGCTGCGATTCTCTGG - Intergenic
901096777 1:6687663-6687685 ATGGCGGAGCTGGGAATAAGAGG - Intronic
901447835 1:9319051-9319073 CTGGAGCAGCTGGGATTACAGGG - Intronic
901865992 1:12107039-12107061 ATTGGGCAGCTGGGGTCCAGGGG - Intronic
902450499 1:16493896-16493918 ATGGAGCAGCGGGCACCCAGAGG - Intergenic
902531725 1:17094824-17094846 CTGGGGCTGCTGGGTTTCAGAGG + Intronic
902690089 1:18105737-18105759 AGGGAGCAGGTGGGATTCCAGGG - Intergenic
902700849 1:18170905-18170927 ATGGAGCAGGTGGACTTAAGAGG + Intronic
902841187 1:19074951-19074973 ATGCGGCAGCTGTGACTCAGGGG - Intronic
903326014 1:22568947-22568969 GTGGCACAACTGGGATTCAGAGG + Intronic
904415325 1:30357907-30357929 ATGAAGAAGCTGGGGCTCAGAGG + Intergenic
904587806 1:31589490-31589512 ATGGAGTTGCTGTGGTTCAGAGG - Intergenic
904587985 1:31590673-31590695 ATGGAGTTGCTGTGGTTCAGAGG + Intergenic
906727737 1:48056007-48056029 AGGGAGGAGCTGGGATCCAGGGG - Intergenic
907288188 1:53395639-53395661 ATGAAGCAGCTTGGCCTCAGGGG - Intergenic
907532228 1:55111865-55111887 ATGTAGAAGCCGGGATACAGGGG + Intronic
907649118 1:56276775-56276797 ATGCAGTAGCTGGGAGTTAGAGG - Intergenic
908403418 1:63791550-63791572 GTGGAGCAGCTGAGGTTCAAGGG - Intronic
909235956 1:73152846-73152868 CTGAAGCCGCTGGGACTCAGGGG + Intergenic
911309460 1:96275548-96275570 CTGGAGCAGCTGGGATGCAGCGG - Intergenic
913076199 1:115342491-115342513 ATGGAGGGGCTGAGAGTCAGAGG - Intergenic
913184681 1:116359232-116359254 ATGAGGAAGCTGAGATTCAGAGG - Intergenic
913270910 1:117092689-117092711 CAGGAGCAGCTGGGAGTCAAGGG - Intronic
915117775 1:153611205-153611227 CTGGAGTGGCTGGGATCCAGGGG - Intronic
915657361 1:157372461-157372483 AGGGAGCAAGTGTGATTCAGGGG - Intergenic
915671631 1:157493952-157493974 AGGGAGCAAGTGTGATTCAGGGG + Intergenic
915685206 1:157625513-157625535 ACGGACCAGCTGGGAAACAGGGG + Intergenic
915972299 1:160363296-160363318 CTGGAGGAGCTGGGAAGCAGTGG - Intergenic
917452610 1:175159569-175159591 ATGGCACAGGTGGGATGCAGAGG - Exonic
919053560 1:192541119-192541141 ATGCTGTAGCTGGGAGTCAGTGG - Intergenic
919175134 1:194010317-194010339 CTGGAGCAGGTGGGACACAGGGG - Intergenic
920434682 1:205940180-205940202 CTGGAGCAGAGGGGATGCAGGGG + Intronic
920665842 1:207962636-207962658 ATGGGGCAGCTGGGATGTAGGGG + Intergenic
921584380 1:216930332-216930354 ATGGATCACCTGGTATTCATGGG - Intronic
921685308 1:218082984-218083006 ATGGGGCTGGTGGGAGTCAGTGG - Intergenic
921763507 1:218943543-218943565 AGGGAGCAGGTGGGATGGAGTGG + Intergenic
922209297 1:223475273-223475295 ATGGAGAAGGTGGCATTGAGTGG + Intergenic
922613800 1:226948849-226948871 ATGGAAGAGCTGGGAATCAAGGG + Intronic
923324585 1:232870062-232870084 ATGGTCAAGCTGGAATTCAGGGG + Intergenic
924443460 1:244105608-244105630 ATGAAGCAGGAGGGATTCAAAGG - Intergenic
1063215951 10:3925590-3925612 CTGGAGAGGCTGGGATTCACCGG + Intergenic
1063776265 10:9268406-9268428 ATGCAGCAGCAGGGAGTCAGGGG - Intergenic
1064246053 10:13668540-13668562 CAGGAGCAGCTGGCATTCTGCGG - Intronic
1067344927 10:45430178-45430200 TTGGAGCAGCCTGGAGTCAGGGG + Intronic
1068051137 10:51950740-51950762 ATGGAGCAGCTGCCCTTCACTGG + Intronic
1070534146 10:77362491-77362513 ATGGAGCAGTTGAGGCTCAGAGG - Intronic
1070660296 10:78300805-78300827 AGGGAGCAGCTGAGCTTCAGGGG + Intergenic
1071056787 10:81520614-81520636 CTGGAGCAGCTGGGCCTCAGAGG - Intergenic
1071914089 10:90271114-90271136 ATAGAACAGCTGAGATTTAGGGG - Intergenic
1072799550 10:98383740-98383762 ATGGAGCACTTGGAATTCAGGGG + Exonic
1073087890 10:100906546-100906568 CTGGAGCAGCTGGGATTACAGGG + Intergenic
1075558309 10:123449240-123449262 ACAGAGCTGCTGGGGTTCAGAGG + Intergenic
1075675320 10:124292035-124292057 ATGAAGCAGCTGAGGCTCAGAGG - Intergenic
1076726209 10:132414585-132414607 GTGGAGCTGCTGCGATTCCGGGG + Intronic
1076978620 11:193503-193525 TTGGAGCAGCTAAGATTAAGGGG + Intronic
1076994071 11:289796-289818 ATGGAGCTGCTGGGCCTGAGCGG - Exonic
1077151677 11:1075625-1075647 AGGGAGCAGCGGGGAATGAGGGG - Intergenic
1077549207 11:3192576-3192598 AAGGAGCAGATGGGTTTCTGTGG - Intergenic
1077718331 11:4603052-4603074 ATGGAGAAACTGGAATTAAGAGG + Intronic
1078016165 11:7616988-7617010 AGGGAGCAGGTGGCACTCAGTGG - Intronic
1078389326 11:10922692-10922714 AAGGAGGAGCTGTTATTCAGGGG + Intergenic
1078431283 11:11290535-11290557 AGGGAGCTGCCGGGAGTCAGGGG - Intronic
1078470065 11:11579473-11579495 ATGGAGCTGCTCGGATTAGGTGG + Intronic
1078898455 11:15619311-15619333 ATGGTGCAGATAGGATTCAAAGG + Intergenic
1079380764 11:19935055-19935077 ATGAGGCACATGGGATTCAGGGG + Intronic
1080572463 11:33568613-33568635 ATGGTGCATCTGCTATTCAGAGG - Intronic
1081135237 11:39432196-39432218 ATGGTGCAGCTGGGTTGCAGAGG + Intergenic
1081647889 11:44802574-44802596 ATGGAGCAGATGGGAGTGGGGGG + Intronic
1081935084 11:46898748-46898770 ATGGAGGAACTGGGATTCTGGGG - Intronic
1083290505 11:61687280-61687302 ATGGAGGAGGTGGGATTGTGTGG - Intronic
1083878733 11:65538011-65538033 CTGGAGCAGCTGGGAAGCTGAGG + Exonic
1083888041 11:65582210-65582232 GTGGAGCACCTGGTATTGAGGGG + Exonic
1085217861 11:74848233-74848255 TTGGAGCAGATGGGAGGCAGTGG + Exonic
1085408584 11:76278385-76278407 ATGGGGCAGCTGGGACAGAGAGG - Intergenic
1085729680 11:78986110-78986132 ATGGAGAAGCAGGGATGCTGGGG + Intronic
1085852031 11:80132057-80132079 TTGGAGTAGATGGGATTCAAAGG - Intergenic
1086482724 11:87260032-87260054 TGAGAGCAGCTGAGATTCAGAGG - Intronic
1089812971 11:121146900-121146922 AAGGAGCAACTGAGACTCAGAGG + Intronic
1090275067 11:125413303-125413325 AAGGAGCAGCTCTGATTCAGTGG + Intronic
1091771895 12:3157491-3157513 ATGGAGAAACTGAGATTCAGAGG - Intronic
1091811880 12:3406198-3406220 ATGGAGCAGCTGGGATTCAGGGG + Intronic
1092022856 12:5216579-5216601 ATGGTGCGGGTGGGATCCAGGGG + Intergenic
1092287905 12:7140332-7140354 GTGGAGAATCTGGCATTCAGAGG + Intronic
1092352002 12:7763216-7763238 CTGGAGTAGCTGGGATTACGGGG + Intergenic
1092487280 12:8914126-8914148 CTGGAGCTGCTGGGAATAAGGGG - Intronic
1093836145 12:23831375-23831397 ATGGTACAGGTGGGATTAAGTGG + Intronic
1094355135 12:29569510-29569532 GTGGAGCAGCTGGGAGGGAGAGG + Intronic
1095076600 12:37936138-37936160 ATGGAGCAGCTTGGAAACACTGG - Intergenic
1095590592 12:43898962-43898984 ATGGAGCAGCTGTCCGTCAGTGG + Intronic
1095944693 12:47747173-47747195 CGGGAGCAGCTGAGATTCAGGGG - Intronic
1096193488 12:49634510-49634532 ATGAAGCAGGTGGGAGTCATGGG - Intronic
1097668852 12:62512989-62513011 CTGGAGTGGCTGGGATGCAGGGG + Intronic
1098184604 12:67882988-67883010 AAGGAGCAGCTGTGATGGAGTGG + Intergenic
1099607905 12:84828703-84828725 GTGAAGCAGCTGGGACACAGGGG - Intergenic
1099932628 12:89091535-89091557 CTGAAGCAGCTGGAATGCAGGGG - Intergenic
1101938863 12:109083988-109084010 ATGGGGAAGCTGGGGTGCAGAGG - Intronic
1102351257 12:112193960-112193982 ATGGGGCTGCTTGGATCCAGGGG + Intronic
1103418252 12:120759310-120759332 ATGAAGCAGCTCGGACTCAGGGG + Intergenic
1103779940 12:123391765-123391787 ATGGAGCTGCTGGCAGCCAGAGG - Intronic
1105781190 13:23706304-23706326 GTGGAGCTGCTGGGCTTGAGTGG + Intergenic
1106924613 13:34600867-34600889 AAGGACCAGCAGGGAGTCAGTGG + Intergenic
1107092264 13:36494573-36494595 ATGAAGCACCAGGGATACAGAGG + Intergenic
1107378805 13:39833497-39833519 TTGAAGAAGCTGGCATTCAGAGG - Intergenic
1110973622 13:81800766-81800788 ATGCAGCATCTGGAAATCAGAGG + Intergenic
1118302098 14:64625258-64625280 GTGGGGGAGCTGGGATTTAGGGG - Intergenic
1119617144 14:76106300-76106322 ATGGCAGAGCTGAGATTCAGAGG - Intergenic
1119636561 14:76278094-76278116 TTGGAGCAGGGGGGAGTCAGAGG + Intergenic
1120023685 14:79557907-79557929 AGGGAGCAGCTGGGTTTGAGAGG - Intronic
1120455662 14:84727047-84727069 ATGGAGCAGCTTGTTTTCAGGGG - Intergenic
1125034394 15:35107073-35107095 ATGGACCATCTGAGATTCATGGG - Intergenic
1125686990 15:41569342-41569364 CTGGAGCAGCTGGGCTTAACAGG - Intronic
1127396239 15:58546019-58546041 ATGGGGCCTCTGGAATTCAGCGG + Intronic
1127551549 15:60043610-60043632 AAGGAGCTGCTGGGATTCCTGGG + Intronic
1127963051 15:63904244-63904266 ATGATACAGCTGAGATTCAGCGG - Intergenic
1128148177 15:65344358-65344380 AGGGAGGGGCTGGGGTTCAGGGG - Intronic
1128245036 15:66127350-66127372 AAGGATCAGCTGGGAGGCAGAGG - Intronic
1128389826 15:67175327-67175349 ATGGGGCAGCTTGGAGTGAGAGG + Intronic
1129254904 15:74328744-74328766 ATGCAGCAGGTGGGAGGCAGTGG + Intronic
1129394696 15:75237509-75237531 ATGGAGCAGCTGGGAAGCCACGG - Intergenic
1129782991 15:78286789-78286811 AGGGGGCAGGTGGGATACAGTGG + Intronic
1130900833 15:88205868-88205890 AGGGAGCATGAGGGATTCAGGGG - Intronic
1131387134 15:92017269-92017291 TTGGAGGAGCTGGGATTGGGGGG + Intronic
1132718888 16:1306331-1306353 ATGGAGCAGGTGGGGGTGAGGGG - Intergenic
1133187904 16:4113863-4113885 ATGGAGCAGCTGGGAGTGGCCGG - Exonic
1133273633 16:4624216-4624238 ATGAGGAAGCTGGGATCCAGGGG - Intronic
1133504609 16:6399155-6399177 CTGAAGCAGCTGGGATGCAGGGG + Intronic
1133815194 16:9192021-9192043 AGTGAGGAGCTGGGATGCAGAGG + Intergenic
1134071755 16:11264611-11264633 ATGAAGAAGCTGAGACTCAGAGG - Intronic
1136172326 16:28496535-28496557 AGGGAGCAGCAGGGATCCAGTGG + Exonic
1139178448 16:64717205-64717227 AGGGAGCAGTTGGGTTTAAGTGG + Intergenic
1139466243 16:67155570-67155592 ATCGTGCAGCTGCGATTCTGCGG - Exonic
1139673861 16:68509764-68509786 ATGGAGACCATGGGATTCAGGGG - Intergenic
1140031445 16:71342380-71342402 GTGGAGTTGCTGGGATTTAGGGG - Intergenic
1140057793 16:71540672-71540694 AGGCTGGAGCTGGGATTCAGTGG + Intronic
1140247827 16:73267368-73267390 ATGGAACAGCTAGGTTTCAGCGG + Intergenic
1140296704 16:73715979-73716001 ATGGAGCACCTGGAATGCAAAGG - Intergenic
1140629374 16:76833201-76833223 CTGGAGCCGCTGGGATTTTGCGG - Intergenic
1140631424 16:76857015-76857037 ATAGAGAAGCTGAGATTCAGAGG - Intergenic
1140830677 16:78747816-78747838 ATGGAGCAGCTTGGAGACAGAGG - Intronic
1141985171 16:87575233-87575255 CTGGAGAAGCTGGGAGGCAGTGG - Intergenic
1142220761 16:88853879-88853901 AAGGGGAAGCTGGGACTCAGGGG - Intronic
1142466051 17:137994-138016 TTGGAGCAGCTAAGATTAAGGGG + Intronic
1142881704 17:2886860-2886882 GTGGCACAGCTGGGATTCTGAGG - Intronic
1143061850 17:4208530-4208552 AGGGACCAGCTGCGACTCAGTGG - Intronic
1143151982 17:4812898-4812920 GAGGAGAAGCTGGGAGTCAGTGG + Intronic
1144580059 17:16453623-16453645 ATTGAGCAGCTGCGATGCATTGG + Intronic
1144851352 17:18245652-18245674 TTGGAGCACCTGGGAATCAAGGG + Exonic
1146007182 17:29168054-29168076 ATGGTGATGTTGGGATTCAGTGG + Intronic
1146614615 17:34345275-34345297 ATTGAGCAGCTGGAGTGCAGTGG + Intergenic
1146689558 17:34863847-34863869 AGGGAAAAGCTGAGATTCAGGGG - Intergenic
1147834733 17:43321991-43322013 CTGGAGCAGCTGGGATTACAGGG - Intergenic
1149369461 17:55978605-55978627 CTGGAGCAACTAGGATGCAGGGG + Intergenic
1149902343 17:60492043-60492065 GTAGAGCAGCTGGGACACAGGGG - Intronic
1150466941 17:65401970-65401992 AAGGAGGTGCTGGGACTCAGCGG - Intergenic
1151572705 17:74935249-74935271 ATGGAGCAGATGGCATTTGGGGG + Intergenic
1151776921 17:76210927-76210949 CTGGAGCAGCTGGGATTATAGGG + Intronic
1152232615 17:79121905-79121927 AAGGGGCAGCTGGGATTCTGGGG - Intronic
1153641789 18:7163929-7163951 ATGAAGCAGCTGTGGTTCAAGGG + Intergenic
1156453516 18:37279985-37280007 AGGGAGCATCTGGGGTTCTGTGG + Intronic
1156902334 18:42314754-42314776 ATAGACCAGCTGGGATACATGGG + Intergenic
1156986270 18:43354582-43354604 ATGGTGGAGTTGGGATTCACTGG - Intergenic
1157381950 18:47226495-47226517 AAGGAGAAGCTGGAATTGAGTGG - Intronic
1157579349 18:48764454-48764476 ATGCAGCCCCTGGGATACAGAGG - Intronic
1159794381 18:72823637-72823659 ATGGAGAATCAGGGAGTCAGGGG - Intronic
1160178187 18:76612826-76612848 ATGGAGCAGATGGCATTGAAGGG + Intergenic
1160927158 19:1552236-1552258 ATGGAGCAGCTCTGCTTCCGGGG - Intergenic
1161304509 19:3559491-3559513 GTGGAGCAGCAGAGAATCAGTGG - Intronic
1161400069 19:4063338-4063360 TTGGAGCATCTGGGCTGCAGTGG + Intronic
1162492031 19:10998473-10998495 AAGGAGTAGCTGGAATTCTGAGG - Intronic
1162731997 19:12723891-12723913 AAGGAGCAGTTGGGATTCCGAGG + Exonic
1163355527 19:16808044-16808066 AAGGAGCAGCTGGTGGTCAGCGG + Exonic
1165327457 19:35122664-35122686 ATGGAGCACCTAGGATGCACAGG - Intronic
1165354174 19:35293623-35293645 ATGGAGCAGCAGGGTGCCAGGGG + Intronic
1166088265 19:40491317-40491339 ATGGAGGAGCTGAGGCTCAGGGG + Intronic
1167021398 19:46879049-46879071 AAGTAGCAGCAGGGTTTCAGAGG - Intergenic
1167097964 19:47385397-47385419 ACGGAGGAGCTGGGCTGCAGCGG - Intergenic
1167370997 19:49081943-49081965 ATCGAACAGCAGGGATGCAGGGG - Intergenic
1167524051 19:49972747-49972769 ATTGAGATTCTGGGATTCAGCGG - Intergenic
1168063042 19:53904751-53904773 CTGGAGAAGCTGGGAGTCAGGGG - Intronic
1168353329 19:55688430-55688452 AGGGAACAACTGGAATTCAGAGG - Intronic
925763515 2:7209223-7209245 ATGGGCAAGCTTGGATTCAGAGG - Intergenic
926329111 2:11810329-11810351 ATGGAGGAGCAGGGTTTCAAAGG + Intronic
926723754 2:15981954-15981976 AGGGAGCAGGTGGGACCCAGGGG - Intergenic
927277823 2:21276513-21276535 ATGGAGCAGCCGGGTCTCAAAGG + Intergenic
927476608 2:23418734-23418756 ATGAAACAGCTGAGACTCAGAGG - Intronic
928709168 2:33985497-33985519 ATGAAGCAGCTTACATTCAGTGG + Intergenic
929437861 2:41941911-41941933 TTGGAGCAGCTGGGTTCTAGAGG - Intronic
931120638 2:59215244-59215266 ATGGAGTAGCTAGGATCTAGTGG + Intergenic
931926817 2:67082406-67082428 ATGTAGAAACTGAGATTCAGAGG - Intergenic
932816470 2:74865966-74865988 ATGAAGCAGCTGAGGCTCAGAGG + Intronic
933006689 2:77004327-77004349 CTAGAGCAGTTGGGATGCAGGGG - Intronic
933150037 2:78903232-78903254 CTTGACCTGCTGGGATTCAGTGG - Intergenic
933715606 2:85357688-85357710 ATGGAGGCTGTGGGATTCAGTGG + Intronic
937682434 2:124658253-124658275 ATGGCAAAGCTGGGAGTCAGAGG - Intronic
937908955 2:127066143-127066165 ATGGCACAGCTGGGACTCCGGGG - Intronic
937917901 2:127107879-127107901 GTGGAGCACCTGGGAGACAGAGG - Intergenic
938950877 2:136253618-136253640 TTGGAGCTGCTGGGAACCAGGGG + Intergenic
939660567 2:144883605-144883627 ATGGAGAGGCTTGGATACAGCGG + Intergenic
939767946 2:146276836-146276858 ATTGATCAACTAGGATTCAGAGG + Intergenic
940110110 2:150143455-150143477 ATGGGACAGCTGGGAAACAGGGG + Intergenic
941445192 2:165591608-165591630 CTGAAGCAGCTGGGACACAGGGG - Intronic
942688215 2:178556699-178556721 ATGGACTAGCTGGGAGTCTGAGG - Intronic
943530254 2:189070823-189070845 AGGGAGCAGATCAGATTCAGAGG + Intronic
944192596 2:197019557-197019579 GTGGAGGAGCTGGGTTTCAAAGG + Intronic
947118906 2:226797615-226797637 ATGGAGCGGCTGTGGTTGAGCGG + Exonic
947768630 2:232653674-232653696 ACTGAGCAGCTGGGATTGAAGGG + Intronic
948228915 2:236335400-236335422 ATTGAGGAGCTGTGCTTCAGCGG + Intronic
948231746 2:236354110-236354132 AGAGAGGAGCTGGGATGCAGGGG + Intronic
948938203 2:241182103-241182125 CGTGAGCAGGTGGGATTCAGAGG - Intronic
1169075199 20:2755871-2755893 GTGGAGCAGCTGGGCTACAGGGG + Intronic
1169284818 20:4299096-4299118 TTGGGGCAAATGGGATTCAGAGG + Intergenic
1169332914 20:4730601-4730623 ATGTAGAATCTGGGACTCAGCGG - Intergenic
1169377791 20:5080905-5080927 ATGGATCAGCAGGGGTCCAGGGG - Intronic
1169496067 20:6116602-6116624 CTGGAGTAGCTGGGATTAACAGG - Intronic
1172068662 20:32239890-32239912 ATGGAGAAGCTGGTGTTCAAAGG + Intergenic
1174089667 20:48037087-48037109 TGGGAGCAGCTGAGACTCAGGGG + Intergenic
1174107446 20:48172580-48172602 AGGGAGGAGCTGGGATCAAGGGG + Intergenic
1174288903 20:49493157-49493179 AAGGAGCAGCTGTGACTCAAGGG - Intergenic
1174785390 20:53427787-53427809 AGGATGCAGCTGGGATTCACTGG - Intronic
1176267860 20:64220137-64220159 TCTGAGCAGCTGGGACTCAGGGG + Intronic
1176304050 21:5114224-5114246 ATGGAGCAGCTGGGAGTGGTGGG + Intergenic
1178793586 21:35722753-35722775 ATGAAGCAGCTGGGTTTCAGAGG - Intronic
1178884121 21:36471935-36471957 TTGGAGCACCTGGGCTTCAAAGG - Intronic
1179059741 21:37968674-37968696 AAGGAGCAGCTAGGATTCCAAGG + Intronic
1179585549 21:42371822-42371844 ATGGAGCCCCTGGAATTCAGTGG + Intergenic
1180077184 21:45468816-45468838 CTGGAGCAGCTGGGATGGGGTGG + Intronic
1182254732 22:29030447-29030469 ATGTAGCAGCGAGAATTCAGCGG - Intronic
1183067326 22:35372134-35372156 CTGGAGCAGCTGGAACTCTGAGG - Intergenic
1183361222 22:37384454-37384476 ATGGGGGAGGTGGGATCCAGGGG - Intronic
1183746047 22:39692193-39692215 AGGGAGGAGCTGAGAGTCAGAGG - Intergenic
1184337031 22:43860068-43860090 ATGGAGAAACTGGGGTTCAAAGG - Intronic
1184454949 22:44604455-44604477 ATGCAGCAGCCGGGCTCCAGAGG + Intergenic
1185077753 22:48692266-48692288 ATGGGGCTGCTGAGAGTCAGGGG + Intronic
950796301 3:15513182-15513204 ATGCAGAAGTTGGGATCCAGCGG - Intronic
952700976 3:36327415-36327437 TGGGAGTAGTTGGGATTCAGGGG + Intergenic
953531271 3:43741611-43741633 AGGGAGCAGCATGGATTGAGGGG + Intergenic
954275026 3:49536334-49536356 ATGCAGCAGCTGTGTTTCAAGGG + Intergenic
954381560 3:50221633-50221655 CTGAACCAGCTGGGATCCAGTGG + Intergenic
954614269 3:51961502-51961524 ATGGAGAAGCTGAGGCTCAGAGG - Intronic
960094564 3:113676834-113676856 ATGAAGCATCTGAGATTCTGAGG - Intronic
960523765 3:118685336-118685358 AGGTAACAGCTGGAATTCAGGGG + Intergenic
961264725 3:125632633-125632655 ATGGAGGATGTGGGCTTCAGAGG - Intergenic
961683351 3:128613535-128613557 ATTGATGAGCTGGGATTCTGGGG - Intergenic
962731789 3:138290219-138290241 GTGGTGAAGCTGGGAGTCAGTGG + Intronic
962809538 3:138948976-138948998 AAGCAGCAGCAGGGATTCTGCGG - Intronic
962986351 3:140539761-140539783 ATGAGGAAACTGGGATTCAGAGG + Intronic
963498932 3:146100549-146100571 ATGCAGCAGGTGGGAATTAGGGG + Intronic
964341999 3:155717634-155717656 CCGGAGCAGCCGGGATGCAGGGG + Intronic
966722672 3:183079965-183079987 CTGGAGCAGCTGGGACTGAGGGG + Intronic
967277770 3:187793555-187793577 GTGGCACAGCTGGGACTCAGAGG - Intergenic
967848516 3:194063892-194063914 AAGGAGCAGTGGGGAGTCAGAGG - Intergenic
968267233 3:197371513-197371535 AAGCAGCAGCTGGGAGTCAGTGG - Intergenic
969159972 4:5248214-5248236 GTGGAGGAGCTGGAACTCAGAGG + Intronic
969241078 4:5898053-5898075 ATTGTGCATTTGGGATTCAGCGG + Intronic
969462179 4:7334611-7334633 CTGCAGCAACAGGGATTCAGAGG + Intronic
971278290 4:25218639-25218661 ATGAGGAAGCTGAGATTCAGAGG - Intronic
972099110 4:35390397-35390419 CTGGAGCAGCTGGGACTTACAGG - Intergenic
972151781 4:36100139-36100161 ATGGAGAAACTGGGATGTAGCGG - Intronic
974471730 4:62327640-62327662 AAGGAGCAGCAGGGTTTGAGAGG + Intergenic
978659623 4:111108941-111108963 ATGCACCAGCAGGGATTGAGTGG + Intergenic
979412556 4:120396333-120396355 CTGGAGCGGCTGGGACCCAGGGG + Intergenic
980838105 4:138222506-138222528 ATGCAGTTGCTTGGATTCAGTGG - Intronic
989839776 5:46048481-46048503 ATGGAGCAGTTTGGAAACAGTGG + Intergenic
990666908 5:58082851-58082873 ATGGTTCAGGTGAGATTCAGAGG + Intergenic
990934464 5:61132916-61132938 TTGGAGAAGGTGGGATTAAGAGG - Intronic
994619436 5:102145728-102145750 ATGTAGTAGCTGAGAGTCAGGGG - Intergenic
997566459 5:134890819-134890841 ATGCAGCAGCAGGGTTTGAGAGG - Intronic
997690966 5:135827287-135827309 GTGGAGGAGCAGGGATCCAGTGG - Intergenic
998031730 5:138876184-138876206 ATGGAGTAGGTGAGATTCTGAGG - Intronic
998560970 5:143171242-143171264 ATGGGGAAACTGGGTTTCAGGGG + Intronic
999056825 5:148587043-148587065 AGGGAGCAGTGGGGGTTCAGGGG - Intronic
999783422 5:154869567-154869589 CCTGAGTAGCTGGGATTCAGGGG + Intronic
1001252493 5:170157768-170157790 AGGGAGCAACTGTTATTCAGGGG - Intergenic
1002201178 5:177529330-177529352 AAGGAGCAGCTGGGCTTTGGTGG + Intronic
1002302162 5:178263286-178263308 ATGGAGCTGCTGGGCCTCCGGGG - Exonic
1002595025 5:180316517-180316539 ATGGGGCAGCTGGGCTTCTAGGG + Intronic
1003079946 6:3013898-3013920 AAGGAGCAGATGGGAATCTGTGG - Intronic
1004681361 6:17898202-17898224 ATTCAGCAGCAGGGATACAGAGG + Intronic
1005060888 6:21776138-21776160 GTGGAGCAGCAGGGGTACAGTGG - Intergenic
1005155803 6:22804780-22804802 GGGGAGAAGATGGGATTCAGAGG + Intergenic
1005637263 6:27764391-27764413 CTGGAGCAGCTGCGAGTCAATGG - Intergenic
1006019436 6:31109212-31109234 ATGGAGGAACTGAGATTTAGAGG - Intergenic
1006139909 6:31922141-31922163 ATGCTGCAGCTGGAAGTCAGTGG + Intronic
1006183665 6:32168542-32168564 ATGGTGCAGCAGGGCTGCAGGGG + Exonic
1007693047 6:43715110-43715132 AGAGAGCAGCTGGGCTGCAGGGG - Intergenic
1007777145 6:44230164-44230186 TGTGAGCAGCTGGGATTCAGAGG + Intronic
1008386831 6:50901483-50901505 CTTGAGTAGCTGGGATTCACAGG + Intergenic
1008940101 6:57037671-57037693 ATGGAGCAGATGGGGTGGAGCGG + Intergenic
1010711633 6:79181891-79181913 CTGGAGTAGCTGGGATTTACAGG + Intergenic
1010845499 6:80702327-80702349 CTGAAGCAGCTGGGATGCAGGGG - Intergenic
1011738289 6:90334082-90334104 CTGGAGCTGCTGGGACACAGGGG + Intergenic
1012169698 6:96002582-96002604 ATGGTGCAGCTTGGACTCACAGG - Intergenic
1012179900 6:96139787-96139809 CTGAAGCAGCTGAGATGCAGGGG + Intronic
1012610261 6:101209510-101209532 ATGGAGCAACTGGCACTCAGTGG - Intergenic
1013149027 6:107426196-107426218 CTGGAGCAGCTGGGATGCAGGGG - Intronic
1013342086 6:109224781-109224803 ATGGGGTAGCAGGGGTTCAGTGG - Intergenic
1016247100 6:141995270-141995292 ATGGACCACGTGGGATGCAGAGG + Intergenic
1019026569 6:168970471-168970493 GTGGTGCAGCTGGCATTCAAGGG + Intergenic
1019140148 6:169937731-169937753 CTGGAGCAGCAGGGACTCTGGGG + Intergenic
1019500207 7:1360824-1360846 TGGGAGCAGCGGGGATTCTGGGG + Intergenic
1020029590 7:4923570-4923592 ATGATGGAGCTGGGATTCAAAGG + Intronic
1020405797 7:7832811-7832833 AGAGTGCAGGTGGGATTCAGTGG + Intronic
1021659473 7:22905334-22905356 AGTGAGTAGCTGGGATTTAGAGG + Intergenic
1022548793 7:31216274-31216296 AAGCAGCAGCAGGGTTTCAGAGG - Intergenic
1023129191 7:36985795-36985817 ATGGAGGAGCGGGCATTCAAGGG - Intronic
1024006463 7:45228072-45228094 TTGGGGTAGCTGGCATTCAGAGG + Intergenic
1024620589 7:51154103-51154125 ATTCAGAAGCTTGGATTCAGAGG - Intronic
1026503245 7:70960513-70960535 TGGGAGGAGCTGGGATACAGAGG + Intergenic
1028874645 7:95807296-95807318 ATGGGGAAGCTGGGCTTCAGAGG + Intronic
1030092614 7:105871162-105871184 ATAGAGAAGCTTGGGTTCAGAGG + Intronic
1030734801 7:113034950-113034972 ATGGAGCAGCGGTGGTTCTGTGG + Intergenic
1031558223 7:123204872-123204894 TTGGATCAGCTGGGATTCTAGGG - Intergenic
1031908235 7:127485398-127485420 CTTCAGCAGCTGGAATTCAGTGG - Intergenic
1032053138 7:128662333-128662355 CTGGGGCAGCTGGGATGCAGTGG - Intergenic
1033151377 7:138917713-138917735 ATGGAGCCGCTGAGTTCCAGCGG + Exonic
1033351766 7:140567861-140567883 CGGGAGCAGCTGGGTGTCAGAGG + Intronic
1033358182 7:140617782-140617804 ATGAAGCCGCTGGGAATCTGTGG + Intronic
1034209321 7:149349120-149349142 CTGAAGCAGCTGGGACTCAGGGG + Intergenic
1035984161 8:4407206-4407228 ATAGAAGAGCTGGAATTCAGGGG - Intronic
1036398069 8:8385844-8385866 ATGCAGCAGCGGGGCTCCAGAGG - Intronic
1036943100 8:13069980-13070002 CTGGAGCAGCTGGGACTTATAGG + Intergenic
1037219650 8:16502281-16502303 CAGGGGCAGATGGGATTCAGAGG - Intronic
1039223107 8:35357274-35357296 AAGCAGCAGCTGTCATTCAGAGG - Intronic
1039788648 8:40856307-40856329 ATGGAGGAAGTGGAATTCAGGGG + Intronic
1039868506 8:41526787-41526809 ATGGAACAACTGGGGTTCTGGGG + Intergenic
1041800445 8:61792228-61792250 AGGGAGCAGATGGCATGCAGTGG + Intergenic
1042081102 8:65051975-65051997 ATAGAACTGCTGGGATTGAGTGG - Intergenic
1042525236 8:69757848-69757870 AGGGAGCTGCAGGGATTCAGGGG - Intronic
1043523601 8:81072902-81072924 TTTGAGCAGCTGTGATGCAGAGG - Intronic
1043610418 8:82055692-82055714 ATGCTGGAGGTGGGATTCAGCGG - Intergenic
1044587874 8:93884921-93884943 GAAGAGCAGCTGGGATTCAGTGG + Intronic
1044762828 8:95539877-95539899 TTTGTGCAGCTGGGAGTCAGTGG - Intergenic
1044896147 8:96893596-96893618 ATGAGGAAGCTGAGATTCAGAGG + Intronic
1045654170 8:104369712-104369734 ATGGAGCCACAGGGTTTCAGTGG + Intronic
1046146807 8:110171687-110171709 CTGGAGCAGCTGCAATGCAGGGG - Intergenic
1047193006 8:122695639-122695661 CTGGAGTAGCTGGGATTTACAGG + Intergenic
1047216503 8:122880340-122880362 ATGGTGGGGCTGGGACTCAGAGG + Intronic
1047773522 8:128049715-128049737 AGGGAGCAGCAGGGAGGCAGTGG - Intergenic
1048295675 8:133211882-133211904 AGGGCACAGATGGGATTCAGGGG + Intronic
1049207862 8:141371759-141371781 ATGGGGCAGCAGGGCCTCAGGGG + Intergenic
1049277137 8:141725510-141725532 ATACAGCACCTGGGATACAGTGG - Intergenic
1049324700 8:142015916-142015938 CTAGAGCAGCTGGGATGCACTGG - Intergenic
1049729751 8:144170241-144170263 ATGGAGTGGCTGGGGCTCAGAGG - Intronic
1050155980 9:2666840-2666862 TTGGAGCAGCTGGGTTGCAGGGG - Intergenic
1050723573 9:8619965-8619987 TCAGAGCAGCTGAGATTCAGAGG - Intronic
1051089478 9:13389263-13389285 ATGGAGCAGGGGGGATTGGGGGG + Intergenic
1051184759 9:14448525-14448547 ATGGAGAAGGTGCTATTCAGAGG + Intergenic
1052594098 9:30536756-30536778 GTGGGGCAACTGGGATGCAGGGG - Intergenic
1053004752 9:34597002-34597024 ATGGAGAAACTAGGAGTCAGGGG + Intergenic
1053428486 9:38026608-38026630 ATGGAGCACCTGGTGTTAAGCGG - Intronic
1055317329 9:75047257-75047279 ATTTTACAGCTGGGATTCAGGGG + Intergenic
1055658816 9:78480391-78480413 AAGCAGCAGCAGGGATTGAGAGG - Intergenic
1055912138 9:81364780-81364802 AGGGAACATCTGGGATTCAAGGG - Intergenic
1055916973 9:81413802-81413824 ATGGACAAGATGGGATGCAGAGG - Intergenic
1055917041 9:81414688-81414710 ATGGACAAGATGGGATGCAGAGG + Intergenic
1057791216 9:98126496-98126518 ATGGGGCAGCTGGGGTGGAGGGG - Intronic
1058233688 9:102462269-102462291 ATGGAAGATCTGGGATTCAAGGG - Intergenic
1059303910 9:113339277-113339299 ATGAAGAAACTGGGACTCAGAGG + Intronic
1060254444 9:122014760-122014782 ATGAGGAAGCTGAGATTCAGAGG - Intronic
1060766145 9:126296175-126296197 AGGGAGCAGGTGTGACTCAGGGG + Intergenic
1060830278 9:126709403-126709425 ATGTAGGAGCTGGGATTGGGAGG + Intergenic
1061940124 9:133879339-133879361 ACAGAGCAGCTGGGAAGCAGGGG + Intronic
1062287030 9:135777898-135777920 AGGGAGGAGCTGGGAGTGAGGGG - Intronic
1062287050 9:135777964-135777986 ATGGAGGAGCTGGGAGACAGAGG - Intronic
1062409160 9:136413614-136413636 CAGGGGCAGCTGGGAGTCAGGGG - Intronic
1062609638 9:137368229-137368251 ATGGGGCAGCAGGGACTCAAGGG + Intronic
1186101624 X:6163551-6163573 AAGGAGCAGGTGGGAGGCAGTGG - Intronic
1189295201 X:39912973-39912995 CTGGGGCAGCTGGGAGTCTGGGG + Intergenic
1189420264 X:40851050-40851072 ATGGAGCAGGCTGGATGCAGTGG + Intergenic
1191898986 X:66022121-66022143 CTGGAGCCGCTGGGAGTCACTGG - Exonic
1192103929 X:68294749-68294771 ATGGAGAAACTGAGATCCAGAGG - Intronic
1192589819 X:72350716-72350738 AAGAAGCAGCTGGAGTTCAGAGG + Intronic
1193996148 X:88367488-88367510 CTGGAGTGGCTGGGATACAGGGG + Intergenic
1194391994 X:93330371-93330393 CTTGAGTAGCTGGGATTCACAGG + Intergenic
1194435040 X:93859843-93859865 CTGGAGTAGCTGGGATGCAGAGG - Intergenic
1195087814 X:101429211-101429233 GTGGTGCAGCAGGGATTCAAAGG - Intronic
1195218976 X:102728484-102728506 ATGGAGCAGCTGGGTTTTCCAGG + Intronic
1195608383 X:106835331-106835353 CTGAAGCAGCTGGGATGCAGGGG + Intronic
1197120173 X:122881238-122881260 AGGGAAGATCTGGGATTCAGGGG - Intergenic
1198045133 X:132893913-132893935 ATGAAGCTCCTGGGATGCAGTGG - Intronic
1200009669 X:153111567-153111589 AAGCAGCAGCTGGAAGTCAGTGG - Intergenic
1200029931 X:153288355-153288377 AAGCAGCAGCTGGAAGTCAGTGG + Intergenic
1200257784 X:154593938-154593960 ATGTGGCAGCTGGGATTCTGTGG - Intergenic
1202346495 Y:23933806-23933828 ATGGGGAAGCTGGGATTTAATGG - Intergenic
1202524276 Y:25736287-25736309 ATGGGGAAGCTGGGATTTAATGG + Intergenic