ID: 1091811881

View in Genome Browser
Species Human (GRCh38)
Location 12:3406204-3406226
Sequence CAGCTGGGATTCAGGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811874_1091811881 -3 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811881 12:3406204-3406226 CAGCTGGGATTCAGGGGACAAGG 0: 1
1: 0
2: 2
3: 58
4: 370
1091811873_1091811881 -2 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811881 12:3406204-3406226 CAGCTGGGATTCAGGGGACAAGG 0: 1
1: 0
2: 2
3: 58
4: 370
1091811872_1091811881 -1 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811881 12:3406204-3406226 CAGCTGGGATTCAGGGGACAAGG 0: 1
1: 0
2: 2
3: 58
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811881 Original CRISPR CAGCTGGGATTCAGGGGACA AGG Intronic
900354730 1:2254934-2254956 CAGGTGGCTTTTAGGGGACATGG + Intronic
900659022 1:3773705-3773727 CAGCTGGGGTCCAGGAGCCAGGG - Intronic
901405072 1:9039949-9039971 CGGCTGGGACTCTGTGGACAGGG - Exonic
901451219 1:9338031-9338053 CAGCTGGGGTGCAGGGAAGAGGG + Intronic
902837682 1:19057719-19057741 CGGCTGAGTTTCAGGAGACAGGG - Intergenic
902841185 1:19074945-19074967 CAGCTGTGACTCAGGGGGAATGG - Intronic
903389540 1:22954127-22954149 CACCTGGGATGCAGGGGAGCAGG - Intronic
904000247 1:27334904-27334926 CAGCTGGGAGCCAGGGGTCTGGG - Intronic
904710475 1:32426288-32426310 CACCTGGAGTTCTGGGGACAGGG + Intergenic
905284145 1:36868316-36868338 CAGAAGGGATTCAGGGGAGCTGG + Intronic
905548351 1:38817605-38817627 GAGGTGGGACTCAGGGGACTGGG - Intergenic
905889641 1:41511079-41511101 CCGATGGGAATCAAGGGACATGG + Exonic
906668527 1:47638530-47638552 CTGCAGGGATTCAGGGGAGCTGG + Intergenic
906707373 1:47904536-47904558 AAGCAGGGATTCACAGGACAAGG + Intronic
906707447 1:47905128-47905150 AAGCAGGGATTCACAGGACAAGG + Intronic
907310176 1:53534613-53534635 CAGCTGGCTTTCAGGCCACAGGG - Intronic
907544375 1:55246729-55246751 CAGCTGGAACCCAGAGGACAAGG + Intergenic
907832627 1:58079403-58079425 CAGCTAAGGTTCATGGGACAGGG + Intronic
907873924 1:58467263-58467285 CAGCTGGGGTCCAGGCCACAGGG - Intronic
908820123 1:68077671-68077693 CAACTGGGAGTCTGGGAACATGG - Intergenic
909805161 1:79865371-79865393 TAGCTGGGATTCCAGGGGCATGG + Intergenic
912391788 1:109307911-109307933 CAGCTGGGACTCTGGGCAAATGG + Intergenic
912695891 1:111842062-111842084 CAGCTGGGAAGCAGGGCACCTGG + Intronic
913426891 1:118741917-118741939 CAGCTGGTATCCAGGGGAAATGG - Intergenic
915129305 1:153686059-153686081 CAGCTGGAATTCCCAGGACATGG + Intronic
915143125 1:153779070-153779092 AAACTGGGAGTCAGGGGTCAGGG - Intronic
915544967 1:156591939-156591961 CCGCTGGGACTCAGAGGTCATGG + Exonic
917515213 1:175701465-175701487 CAGCTGGGGTTGAGGAGCCAAGG - Intronic
917520071 1:175740901-175740923 CAGCTGGGATTTCTGGGGCATGG + Intronic
917743340 1:177983277-177983299 GGGCTGGGAGTCAGGGGACCTGG - Intronic
918734170 1:188037807-188037829 CAGCTGGAATGCAGGGCACAAGG - Intergenic
919183363 1:194114351-194114373 CAGGTGGAATTCTGGGGACAGGG + Intergenic
919409479 1:197226505-197226527 CAGATGGGTGGCAGGGGACAGGG - Intergenic
919776204 1:201195531-201195553 CAGCAGGGCTTTAGGGGACAGGG - Intronic
919782052 1:201227304-201227326 CAGCCGGGAGTCAGGAGACCAGG + Intronic
919868627 1:201803153-201803175 CAGGTGGAATGCAGGGTACATGG + Intronic
920301360 1:204991103-204991125 CAACTGGCATTCAGGGTTCACGG - Intronic
920494915 1:206447809-206447831 GGGCTGGGACTCAGGGGCCAGGG - Intronic
921088570 1:211820033-211820055 CAGCTGTGATTGGAGGGACATGG - Intronic
921416795 1:214898041-214898063 CAGCTGGGACTACGGGCACACGG - Intergenic
921632989 1:217456563-217456585 GAGGTGAGATGCAGGGGACAAGG + Intronic
922741192 1:228015263-228015285 GAGCTGGGATTCCAGGGAAAGGG + Intronic
923089825 1:230731525-230731547 CAGCTGGAAGGCAGAGGACAAGG - Intergenic
924445155 1:244122981-244123003 CAGCTAGATTTCAGGGGAAATGG + Intergenic
924700945 1:246451506-246451528 CACAGGGGATTCAGGGGGCAGGG + Intronic
1064070406 10:12224020-12224042 CTTCTGGGACTCAGGGGAAAGGG - Intronic
1065824778 10:29560810-29560832 TAGGTGAAATTCAGGGGACATGG + Intronic
1066064125 10:31750108-31750130 CGGCTGGGCTTCAGGGGAGAGGG + Intergenic
1066496465 10:35947246-35947268 CTTCTGGGTTGCAGGGGACAAGG + Intergenic
1067689486 10:48492382-48492404 CAGCTGGGTGTCAGGGGTGAAGG + Intronic
1070035779 10:72722374-72722396 CAGCTGAGGTTAAGGGGAAAAGG - Intronic
1071130511 10:82387440-82387462 CAGCTGGAAGACAGGGGAAATGG - Intronic
1072010200 10:91296581-91296603 TAGCTGGCAGTCATGGGACAGGG - Intergenic
1074096509 10:110318116-110318138 CAACTGGAAGACAGGGGACAGGG + Intergenic
1074219713 10:111424568-111424590 CAGCTGGAAGTGAGGGGCCATGG - Intergenic
1075089409 10:119435063-119435085 CAGCTGGGACTCAGGGCACTGGG + Intronic
1075902610 10:126055194-126055216 CAGCTGGGATTTGGGGGCCGTGG - Intronic
1076979495 11:197135-197157 CAGCTGGGAGCCAGGAGTCAGGG - Intronic
1077252082 11:1565193-1565215 CAGCTGGCCTACACGGGACAGGG - Intronic
1077849970 11:6066807-6066829 CAGCTGGACTTCAGGGTCCAGGG - Intergenic
1078291370 11:10013373-10013395 AAGCTGGGATGTAGGGGAGAGGG + Intronic
1078358401 11:10649629-10649651 CAGCAGGAATTCAGGGGAGCCGG - Intronic
1080007272 11:27423293-27423315 CAGCTGGTCTTCAGGGTATATGG - Intronic
1080840233 11:35977221-35977243 CAACTGGAATTCAGATGACATGG - Intronic
1081150706 11:39627293-39627315 CAGCTGGAAAGCAGGGCACATGG + Intergenic
1081631425 11:44692590-44692612 CAGCTGGGAGTCACGGGTGATGG + Intergenic
1081643105 11:44771019-44771041 CACCTGGGGTTCAGGGGTGAGGG + Intronic
1082984421 11:59155776-59155798 TTGCTGGGGTTCAGGGGAGAGGG - Intergenic
1083032696 11:59608240-59608262 CAGCTGGGAATCAGGAGTCCAGG - Intronic
1083419290 11:62544351-62544373 CAGCAGCGATTCAGGGGTCCTGG - Intronic
1083910198 11:65703615-65703637 CAGCTGGCATGCAGGGAGCATGG - Intergenic
1084083978 11:66846303-66846325 CAGCTGTGAGTGAGGGGACAAGG + Exonic
1084152901 11:67299510-67299532 CACCTGGGGAGCAGGGGACACGG - Exonic
1084214088 11:67638392-67638414 TGGCTGGGAGTCAGGGGACAAGG + Intronic
1084695922 11:70755587-70755609 CAGTGGAGATTCTGGGGACAAGG + Intronic
1084946177 11:72639786-72639808 CAGCTGGGGTTGGGGGGGCATGG + Intronic
1085198976 11:74690047-74690069 CAGCTGGAAGCCAGGGGTCAAGG + Intergenic
1085296675 11:75435324-75435346 CAGCTGGGCCTCAGGAGACAGGG + Exonic
1085402027 11:76241211-76241233 CAGCTGGGATGGGGAGGACAGGG - Intergenic
1085619987 11:78030709-78030731 CAGCTGGGACTCAGATGAAAGGG + Intronic
1086166630 11:83787197-83787219 CAGATGAGATTCTGGGGACATGG + Intronic
1087196199 11:95306351-95306373 AAGCTGAGATTGAAGGGACAGGG + Intergenic
1087950890 11:104219266-104219288 CAGCTGGGAGCCAGTGGACTTGG - Intergenic
1089337441 11:117734834-117734856 GGGCTGGGATTCAGAGGATAAGG + Intronic
1090353815 11:126125650-126125672 CTGCAGGGATTCAGGAGACCCGG - Intergenic
1090513667 11:127401681-127401703 CATCTGTGATTCAGGTGAAAAGG + Intergenic
1091132683 11:133159746-133159768 CAGCTGGGCTTTGGGAGACAGGG - Intronic
1091811881 12:3406204-3406226 CAGCTGGGATTCAGGGGACAAGG + Intronic
1092083456 12:5736768-5736790 CAAGTTGGCTTCAGGGGACAGGG - Intronic
1092745215 12:11666679-11666701 CAGCTGGGATTCAGGGCATTAGG + Intronic
1093898822 12:24606688-24606710 CAGATGGGATTAAAGGTACAAGG + Intergenic
1095622635 12:44276479-44276501 CAGCTGGGGGTGAGGGGACTGGG + Intronic
1095646207 12:44550853-44550875 CAGCTGAGGTTAAGGGGAAAGGG + Intronic
1095944690 12:47747167-47747189 CAGCTGAGATTCAGGGGGGTTGG - Intronic
1095986941 12:48005069-48005091 CAGGTGGGAGTCTGGGGACCAGG - Intergenic
1096384339 12:51184914-51184936 CAGCTGAGTGTCAGGGGAGAGGG + Intergenic
1096837067 12:54357785-54357807 CAACTGAGCTTAAGGGGACAGGG + Intergenic
1098651565 12:72977195-72977217 CCCATGGGATTTAGGGGACAGGG - Intergenic
1098713655 12:73801258-73801280 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1099254499 12:80298787-80298809 CAGCTGCCATTCAGGGAGCATGG + Intronic
1101013763 12:100477898-100477920 TAGCTGGGCTTCAGGGGGCCAGG + Intronic
1101211709 12:102541503-102541525 CAGCTGGGACAAAGGGGATAAGG + Intergenic
1101777553 12:107807820-107807842 CTGCTGGGGTTCAGAGGATAGGG + Intergenic
1102420714 12:112800791-112800813 CAGTTGTGATCCTGGGGACATGG + Intronic
1102472300 12:113166114-113166136 TACCTGTGATTCAGGGGCCAGGG - Intronic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1103014030 12:117480274-117480296 CAGCTGGCATTTTGGGGCCAGGG + Intronic
1104351999 12:128052993-128053015 CAGCAGGGAGCCAGGGGCCATGG - Intergenic
1109091495 13:58052104-58052126 CAGTTGGGATGCAGGGAGCAGGG - Intergenic
1112429311 13:99336574-99336596 CACCTGGTATTCAGCAGACATGG - Intronic
1113610637 13:111642477-111642499 CAGCAGAGATGCTGGGGACATGG - Intronic
1114683523 14:24506844-24506866 CAGGGAGGACTCAGGGGACAGGG + Intronic
1114954842 14:27805114-27805136 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1115932162 14:38508956-38508978 CAGCTAGGATGCAGGGCACCAGG + Intergenic
1116670051 14:47829160-47829182 CAGCTGAGATGCAGGGCACCAGG + Intergenic
1117230542 14:53712907-53712929 CTTCGGGGATTCAGGGGAAAGGG - Intergenic
1117304312 14:54459121-54459143 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1117469076 14:56024089-56024111 CAGCTGGGAGTCTGGGGCCAGGG - Intergenic
1117537382 14:56714972-56714994 GAGGTGGGATTGAGGTGACAGGG - Intronic
1117560381 14:56931980-56932002 CAGTTGGGATTCTTGGGTCAAGG - Intergenic
1118745486 14:68770198-68770220 AAGCTGGTGTTTAGGGGACATGG - Intergenic
1118983436 14:70733720-70733742 AAGATGGGAGTCAGGGGGCAGGG + Intronic
1119516046 14:75249220-75249242 CAGCTGGTATGCAGGAGAAAAGG + Intronic
1120806430 14:88756043-88756065 CAGATTGGATGCAGGGGACAAGG + Intronic
1121724242 14:96134927-96134949 TAGCTGGGATTATAGGGACATGG + Intergenic
1121816374 14:96932091-96932113 GAGCTGGGATTCAGAGTGCACGG + Intergenic
1122107651 14:99470628-99470650 TGCCTGGGATTCAGGGTACAGGG - Intronic
1124211891 15:27770647-27770669 CATCTTGGATTCAGAGGCCACGG - Intronic
1124955161 15:34355624-34355646 CACCTGGGCTTCAGGGGGCTGGG + Exonic
1127249259 15:57212852-57212874 AAACTGGGAGTCAGGAGACAGGG - Intronic
1128563305 15:68682774-68682796 ACTCTGGGATTCAGGGGACCTGG - Intronic
1129180740 15:73873340-73873362 GAGGTTGGATTCAGAGGACATGG - Intergenic
1129184742 15:73899260-73899282 CAGCTGTGAGCCAGGGGCCATGG - Intergenic
1129717788 15:77862192-77862214 CTGCTGTCATCCAGGGGACAGGG + Intergenic
1129783201 15:78288333-78288355 GAGCTGGGAGTCCGGGGAAAAGG + Exonic
1129878931 15:78994552-78994574 CCGCTGTGATGCAGGGGCCAAGG + Intronic
1130416886 15:83702531-83702553 CAGCTGGGACACAGGGCACCAGG - Intronic
1130460981 15:84158069-84158091 CTGCTGTCATCCAGGGGACAGGG - Intergenic
1130550733 15:84888691-84888713 CAGCTGGGGGTCGGGGGCCACGG - Intronic
1131181159 15:90241021-90241043 CAGAAGGGATTCAGTGGCCAAGG + Exonic
1132152257 15:99470804-99470826 CATCTGGGATTAGGGGGACAGGG - Intergenic
1132394110 15:101459658-101459680 TTGCTGGGATGGAGGGGACAGGG - Intronic
1132994222 16:2814708-2814730 CAGCTGAGGTTGAGGGGACTTGG + Intergenic
1132996791 16:2827680-2827702 CAGCTGGGGTTGGGGGGACTTGG - Intergenic
1133012837 16:2924508-2924530 CTGCTGGGCTGCAGGGTACAAGG + Intronic
1133467476 16:6041701-6041723 AGGCTTAGATTCAGGGGACAAGG + Intronic
1134476055 16:14574900-14574922 CAGCTGGGATGCAGGGCTCCTGG - Intronic
1135970293 16:27067259-27067281 CAGCGGGTACGCAGGGGACAAGG + Intergenic
1136670661 16:31854107-31854129 CAGCTGGGTTTAAGATGACAGGG - Intergenic
1136929558 16:34406970-34406992 CAGGTGGGACTCTGGGGAGAGGG - Intergenic
1136975016 16:35004834-35004856 CAGGTGGGACTCTGGGGAGAGGG + Intergenic
1137044299 16:35641750-35641772 CAGCTGAGATTTAGGGCACAGGG + Intergenic
1137546966 16:49411224-49411246 CAGCTGAGAGTCAGGGGACAGGG + Intergenic
1138222345 16:55263434-55263456 CAGCTGGTATCCAAGCGACAAGG + Intergenic
1139925935 16:70486543-70486565 CAGCTGGGATTTACGGGAATAGG + Intronic
1140204688 16:72924248-72924270 GAGCTGGGTTGCAGGGAACAAGG - Intronic
1140819602 16:78650774-78650796 CAGCTGAGATTTGTGGGACAGGG - Intronic
1141675267 16:85514272-85514294 CAGTTGAGATTCAGGGGAGAAGG + Intergenic
1142176946 16:88649838-88649860 CAGCTGGGAGCCAGGAGACCTGG - Intronic
1142700941 17:1660366-1660388 CAGGTGGAATTGAGGGGAGAGGG - Intronic
1142978163 17:3657272-3657294 CAGCTGGGCTTCAGGGTGCCAGG + Intronic
1143608609 17:8004691-8004713 GAACTGGGATTCTGGGGACTTGG - Intronic
1143621136 17:8080801-8080823 CAACTGGGATCCAGGGGGCGGGG + Exonic
1144851353 17:18245658-18245680 CACCTGGGAATCAAGGGTCAAGG + Exonic
1145015132 17:19391653-19391675 CAGCTGGAAGCCAGGGGCCATGG - Intergenic
1145103845 17:20098544-20098566 CACCTGAGAGGCAGGGGACAGGG - Intronic
1145284563 17:21495700-21495722 CAGCTGGGAGAAGGGGGACACGG - Intergenic
1146581462 17:34041768-34041790 TAGTTGGGATTCAGGAGACAGGG + Intronic
1147669161 17:42166839-42166861 CAACTGGGAGTCAGGAGACCAGG + Intronic
1148107941 17:45129335-45129357 TAGCTGGGACTCAGGAGACTGGG - Intronic
1148159977 17:45444215-45444237 CTGCTGGGTTTCTGGGGGCAGGG - Intronic
1148767226 17:50046460-50046482 CAGGTGGGATACAGGGGACATGG - Intergenic
1150391268 17:64791094-64791116 CTGCTGGGTTTCTGGGGGCAGGG - Intergenic
1151221072 17:72613578-72613600 CAGCTGGAATCCAGTGGCCAAGG + Intergenic
1152807258 17:82362026-82362048 CGGCAGGGATGAAGGGGACAAGG - Exonic
1153136884 18:1927409-1927431 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1153817126 18:8800200-8800222 CAGCTGGGATGCAAGAGCCAGGG + Intronic
1154016958 18:10627296-10627318 CAGGTGGGACTCAGTGGGCAAGG - Intergenic
1154187902 18:12202307-12202329 CAGGTGGGACTCAGTGGGCAAGG + Intergenic
1155865843 18:30963782-30963804 AAGCTGGGAACCAGGGAACAGGG + Intergenic
1156329458 18:36106107-36106129 CTTGTGGGATTCAGGGGTCAAGG - Intergenic
1157587238 18:48811558-48811580 GAGCTGGGGAGCAGGGGACATGG - Intronic
1157739038 18:50075724-50075746 CAGCTTGTTTTCAGGGGACTTGG - Intronic
1160699083 19:497608-497630 CAGCTGGGGTTCGGGGGACTGGG + Intronic
1160855120 19:1213786-1213808 CAGGAGGGATTCAGGGACCAGGG + Intronic
1160929022 19:1561014-1561036 GAGTTGGAATTCTGGGGACATGG - Intronic
1161655266 19:5510494-5510516 CAGCTGGGATTGGAAGGACATGG + Intergenic
1161850408 19:6735251-6735273 GAACTGGGATTCTGGGGCCAGGG - Intronic
1162737869 19:12756438-12756460 AAGATAGGAGTCAGGGGACAAGG + Intronic
1162897900 19:13776387-13776409 CAGGTGGGATCCAGGAGACAAGG - Intronic
1163521891 19:17796471-17796493 GATCTGGGATTCAGGGCCCATGG + Intronic
1164715833 19:30389701-30389723 CTGCTAGGATTCAGGAGCCAAGG - Intronic
1164837323 19:31365378-31365400 GGGCTGGGATTCTGGGGACCTGG - Intergenic
1165286855 19:34849853-34849875 CAGCTGGGATTATAGGCACATGG + Intergenic
1165311488 19:35031301-35031323 CCGCTGGGATGCTGGGGACATGG + Intronic
1165385512 19:35508224-35508246 CTGCAGGGCTTCAGAGGACAGGG - Intronic
1165756170 19:38294342-38294364 CAGCTGAGCTTCAAGGGCCACGG - Intronic
1166074347 19:40404991-40405013 CCTCTGGGATTGGGGGGACAGGG + Intronic
1166977380 19:46612617-46612639 CAGCTGGGCTTTAGGGTAAATGG + Intergenic
1167114860 19:47483364-47483386 CCGCCAGGATTCAGGGGACAAGG - Exonic
1168071041 19:53951958-53951980 GAGCTGGGATCTAGGGGACACGG + Intergenic
926367206 2:12144301-12144323 GAGCTGTGATACAGGGGACTTGG + Intergenic
927502828 2:23593687-23593709 CAGCTGGGTTTTAGGTGTCAAGG - Intronic
927611607 2:24547007-24547029 CAGCCAGGATTCAAGGGACTGGG + Intronic
927848775 2:26485937-26485959 CTCCTGGGATTCCTGGGACATGG - Intronic
928396378 2:30945913-30945935 CAGCTGGGAGTCAGGGAGCTTGG + Intronic
928538872 2:32265587-32265609 CCTCTGGGATTCAAGGTACAGGG - Exonic
930428611 2:51244437-51244459 CACCTGGGATACAGTGGATAAGG + Intergenic
930558513 2:52929999-52930021 CAGCTGGGAAACAGGGCACCAGG + Intergenic
930738928 2:54809426-54809448 GCCCAGGGATTCAGGGGACAGGG + Intronic
931729549 2:65140921-65140943 GAGCTGGGAGTCAGGGAACTAGG - Intergenic
931834256 2:66082442-66082464 GAGCTGAGATTCAGGGGTCCTGG + Intergenic
931846084 2:66205345-66205367 GAGATGGGATTGAGGGGGCATGG + Intergenic
932935706 2:76098660-76098682 CAGCTGGGATGCAGGGCACCAGG + Intergenic
933851786 2:86373137-86373159 CAGATGGGAATAAGGGAACAAGG - Intergenic
934482479 2:94664179-94664201 CAGCTGGGATGCAGGACACCAGG + Intergenic
934662889 2:96152646-96152668 ATGCAGTGATTCAGGGGACAGGG + Intergenic
935145305 2:100391330-100391352 CAGAAGGAAGTCAGGGGACAGGG + Intergenic
937150227 2:119681284-119681306 CTTCTGGGCTTCACGGGACAAGG - Exonic
937886971 2:126906535-126906557 CAGCAGGAAGTCAGGGTACAAGG - Intergenic
939159002 2:138563349-138563371 TAGCTGGGATTAAAGGCACATGG - Intronic
939305751 2:140408474-140408496 AAGTGGGGATTCAGGAGACAAGG + Intronic
940854019 2:158715932-158715954 AAGCTAGGATTCAGGGCCCAGGG - Intergenic
941951997 2:171165334-171165356 GAGCTGGGTTTCAGGTGATAGGG + Intronic
943700962 2:190988072-190988094 CAGCTGAGATTCGGGGGATGGGG - Intronic
944030504 2:195229134-195229156 CTGCTGGGGGTCAGGGGTCAGGG - Intergenic
944132722 2:196364092-196364114 CAGGTGGGATTCAGAGACCAGGG - Intronic
945655591 2:212619243-212619265 CAGCTGGGGTTCAGAAGACTTGG - Intergenic
946381468 2:219351762-219351784 CGGCTGGGAGTCAGGATACAGGG + Intergenic
947130326 2:226916180-226916202 CAGCTCAGATTCATGGGATAGGG + Intronic
947687129 2:232097735-232097757 CAGCTCGGCCTCAGGGGAGAAGG - Intronic
947905349 2:233757287-233757309 CAGCTGGGGGTTGGGGGACAGGG + Intronic
948009104 2:234636567-234636589 CAGCTGGAATGCAGGGTACCAGG - Intergenic
948273149 2:236689007-236689029 CCGCAGGGACTCAGGAGACAGGG + Intergenic
948334017 2:237193806-237193828 CATCTGGGTTTTAGGGGAGAGGG + Intergenic
948610229 2:239162105-239162127 CTGCTGGGAAGCAGGGGTCACGG - Intronic
1169048809 20:2559108-2559130 CAGCTGGAGTTCAGGGGACGCGG - Intronic
1169639007 20:7727305-7727327 CTGCTGAGATTCAAGGGAAAGGG + Intergenic
1170025638 20:11886683-11886705 CAGGTGGTATTCATGGGACTAGG - Intergenic
1171186626 20:23127875-23127897 CCGCTGGGAATCAGGGGTCTAGG + Intergenic
1171516984 20:25745961-25745983 CTGCAGGGAGTCAGAGGACAGGG + Intergenic
1172467398 20:35166427-35166449 CAGCTGGACTTCAGAGGACCAGG - Intergenic
1172479070 20:35260421-35260443 CAGCTGGGAACCAGGGAACACGG - Intronic
1172540331 20:35709538-35709560 CAGCTGGGAATAATGGGAAATGG + Intronic
1173018483 20:39247915-39247937 CACCTGGGAGTGAGGGGAGAGGG + Intergenic
1174037568 20:47677747-47677769 CACCTGGGGGTCAGGGGACAGGG - Intronic
1174329226 20:49804604-49804626 GAGTTGGGATGCAGGGGAAAAGG + Intergenic
1174373771 20:50112335-50112357 AAGTTAGGTTTCAGGGGACAAGG - Intronic
1174589902 20:51636649-51636671 CAGCTGGAATTGAGGGGAGCTGG - Intronic
1175269436 20:57723495-57723517 CAGCTGTGAGCCAAGGGACATGG + Intergenic
1176139547 20:63538980-63539002 CCACTGGGATTAAGGGGACCAGG - Intergenic
1179122274 21:38559117-38559139 CAGCTAGGATTCATGGAGCAAGG - Intronic
1179277850 21:39908323-39908345 CAGGTGTCATTAAGGGGACAAGG + Intronic
1184190889 22:42893628-42893650 CAGCTGGGAGGCAGGGGGCTTGG + Intronic
1185094795 22:48800386-48800408 CAGCTGTGATTCAGGAGCCAGGG - Intronic
1185331675 22:50254818-50254840 CAGCTGTGAGTCAGGGAACCAGG - Intronic
949810131 3:7998413-7998435 TAGCTGGCAGTCAGGGGACCTGG + Intergenic
950034685 3:9877009-9877031 GAGCTGGGATTCAGCAGAGATGG - Intronic
950104231 3:10378219-10378241 CAGGTGGGAGGCAGGGGACAGGG - Intronic
950251536 3:11469648-11469670 TAGCTGGGCTGCAGTGGACAGGG - Intronic
950542921 3:13622812-13622834 TAGCTGGGACTCAGGGCAGACGG + Intronic
950578838 3:13850075-13850097 CAGCCAGGACTCAGGGGACTTGG - Intronic
951107414 3:18761399-18761421 CAGATGGGATTAAGTGCACAAGG + Intergenic
951824567 3:26853869-26853891 CAGCTGGGATTTAGGAGACTTGG - Intergenic
953004069 3:38961086-38961108 CAGCTGAGATAAAGGGTACAGGG + Intergenic
954870586 3:53764679-53764701 AAGCTGGGCCACAGGGGACAGGG - Intronic
954971988 3:54659090-54659112 TAGCTGGAGATCAGGGGACAGGG - Intronic
955886084 3:63600363-63600385 CAGCTGGTATCCAGAGGGCAGGG - Intronic
956685229 3:71820597-71820619 GAGCAGGGAGTGAGGGGACAAGG + Intergenic
958739950 3:98057000-98057022 TAGCTGGAATTCCTGGGACAGGG + Intergenic
960064441 3:113355055-113355077 CTGCTGGGACCCAGGGGAAAGGG + Intronic
960179706 3:114561283-114561305 CATTTGTGATTCATGGGACAAGG - Intronic
961007596 3:123415254-123415276 CAGCTGGGGACCAGGGGACAGGG + Intronic
961550622 3:127668755-127668777 CAGCTTGGGTTCTGGGGACAAGG + Intronic
962336183 3:134533193-134533215 AAACTGGCATTTAGGGGACAGGG + Intronic
963716373 3:148808787-148808809 CAGATGGGATCCTGGGGAAATGG - Intronic
964411204 3:156399526-156399548 CAGCTGGCATTGACAGGACATGG + Intronic
964649284 3:158992724-158992746 GAGCCTGGATTCATGGGACAGGG + Intronic
966280187 3:178217140-178217162 CAACTGGCATTCTGGGGAGAAGG + Intergenic
966746381 3:183281179-183281201 CAAATGGGATGCAGGGGAGAAGG + Intronic
966883568 3:184362618-184362640 GAGCTGGTATCCAAGGGACAGGG + Intronic
967862357 3:194161482-194161504 GAGCTGGGATCCAAGGCACAAGG + Intergenic
968622510 4:1610295-1610317 CAGCTGGGGTCCGGGGGCCAGGG - Intergenic
969222856 4:5772756-5772778 CAGCTGGAAGTCAGGGAGCAAGG - Intronic
969275114 4:6129515-6129537 CACCTGGCTTTCAGGAGACATGG - Intronic
969413953 4:7046816-7046838 CATGTGGGATTCATGGGAGAGGG + Intronic
973942482 4:55924606-55924628 CAGGTGGGATTCAAGGAAGAAGG + Intergenic
974095443 4:57358860-57358882 TAGCTGGGAGTCAAGGGAGAAGG + Intergenic
975139026 4:70902052-70902074 CAGCTGGGCTCCAGAGGTCAGGG - Intergenic
976185254 4:82436768-82436790 CACCTAGGATTCAGGAGACCTGG + Intronic
976630414 4:87230323-87230345 CTGCTGGAAGCCAGGGGACAAGG + Intronic
978379638 4:108113362-108113384 CAGCTGTGTTACAGGGGAGAAGG + Intronic
978843848 4:113248496-113248518 CAGCTGGAAGCCAGAGGACAAGG + Intronic
980688147 4:136256877-136256899 CTGTTGGGGGTCAGGGGACAAGG + Intergenic
981453055 4:144921097-144921119 GAGCTGGGGTGCAGGGGACCAGG + Intergenic
981735221 4:147942643-147942665 CAGCTGGGAATTAGGGGAGAAGG - Intronic
982677782 4:158395795-158395817 CAGGAGGAAATCAGGGGACAGGG + Intronic
982803996 4:159740345-159740367 CTTCAGGGATTCAGGGGAAAGGG - Intergenic
983478234 4:168241972-168241994 CAGCTGGGATGCAAGGCACCAGG - Intronic
984436742 4:179719047-179719069 CAGCTGGGACACAGGGCACCAGG + Intergenic
984893333 4:184513222-184513244 CAGATGGGACTCAGGTGGCAAGG + Intergenic
986911635 5:12565055-12565077 CAGCTGGGATGCAGGGCACCAGG + Intergenic
987594224 5:19974813-19974835 CAGCTGGGATCCAGGGTGCAGGG + Intronic
987709068 5:21486134-21486156 CAGCTGGGATGCAGGGCACCAGG + Intergenic
988750544 5:34188019-34188041 CAGCTGGGATGCAGGGCACCAGG - Intergenic
994808224 5:104479238-104479260 CAGCTGGGATGAAGGGCACAAGG - Intergenic
995070658 5:107918069-107918091 CAGCAAGGAATGAGGGGACATGG - Intronic
995752435 5:115467513-115467535 CACATGGGATTGAGGAGACAGGG + Intergenic
996870889 5:128192335-128192357 CAGCTGGTGTTAAGGGGAGATGG - Intergenic
997261406 5:132467952-132467974 TATCTGGGATGGAGGGGACAGGG + Intronic
997609831 5:135208106-135208128 CAGCTGGGGGTCAGGGCACAGGG - Intronic
997611908 5:135221297-135221319 GAGCTGGCAGTCAGGAGACATGG + Intronic
998107097 5:139475636-139475658 CAGCTAGGCTTAAGGGGCCAGGG + Intronic
998364575 5:141620997-141621019 CATCTGGGATTCAGGTGTTAGGG + Exonic
999518825 5:152329583-152329605 CAGCTGAGATTTTGGAGACACGG + Intergenic
999813641 5:155153496-155153518 CAGCTGGGAACCATGGGACAGGG - Intergenic
1000642732 5:163722057-163722079 CTGCTTGGATGCAGGAGACAAGG + Intergenic
1000777902 5:165442321-165442343 CAGCTGGGACGCAGGGCACTAGG + Intergenic
1001334836 5:170788554-170788576 CACCTGGGAAACAGGGGGCAAGG - Exonic
1001971032 5:175955090-175955112 CAGCTGGGATGAAAGGAACATGG + Intronic
1002246410 5:177888687-177888709 CAGCTGGGATGAAAGGAACATGG - Intergenic
1002286479 5:178165834-178165856 CCGCTGGGACTCAGCGGTCATGG + Intergenic
1002456133 5:179346088-179346110 CAGATGGGGGACAGGGGACAGGG - Intergenic
1002464549 5:179400252-179400274 CAGCTGGGACACAGGGTACCAGG - Intergenic
1002469333 5:179426117-179426139 CAGCTGGAAGTCAGAGGGCAAGG - Intergenic
1002822651 6:740895-740917 CAGCTGTGATTCATGGGAGGAGG - Intergenic
1005155804 6:22804786-22804808 AAGATGGGATTCAGAGGAGAAGG + Intergenic
1005254085 6:23981372-23981394 CTGCTGCCATTCAGGGGCCATGG + Intergenic
1005928369 6:30463397-30463419 GAGCTGGGACTGAGGGGAAAAGG + Intergenic
1005944496 6:30585538-30585560 TAGCTGGGTTTCAGAGAACAGGG - Exonic
1006389243 6:33748877-33748899 CAGGGGGGAGTCAGGGGGCAGGG - Intergenic
1007676961 6:43603963-43603985 GAGCTGGGATTCAGTGAACTGGG - Exonic
1009876438 6:69511534-69511556 CAGCTGGGATGGAGGGGCCAAGG - Intergenic
1010538620 6:77063417-77063439 CACCTGGGTCTCAAGGGACATGG - Intergenic
1010619681 6:78059584-78059606 CAGGAGGCATTCAGGGGACTGGG - Intergenic
1010732355 6:79404548-79404570 AAGCTTGGCTTCAGGGGAGAGGG + Intergenic
1010821677 6:80422138-80422160 CAGCTGGGATGCAGGGTACCAGG - Intergenic
1011789165 6:90879416-90879438 CAGCTGGGTTGGAGGGGAGAAGG - Intergenic
1012756639 6:103240311-103240333 CAGTTGGCATTCAGGGCACCAGG - Intergenic
1013493883 6:110678298-110678320 TAGCTGGTGTTCAGGGGAGATGG - Intronic
1013704256 6:112813719-112813741 CTGCTGGGGGTCAGGGGTCAGGG - Intergenic
1016219264 6:141646643-141646665 CAGCTGGGATGGAGGGCACCAGG - Intergenic
1016982826 6:149868517-149868539 CAGGTGAGCTCCAGGGGACATGG + Intergenic
1017103113 6:150865791-150865813 CGGCTGGTTCTCAGGGGACACGG - Exonic
1017788987 6:157779063-157779085 CAGCTGCCAGTCATGGGACAAGG + Intronic
1019114627 6:169750084-169750106 AATCTGGGAGTGAGGGGACATGG - Intronic
1019547558 7:1585834-1585856 CGGCTGGGATGCAGCGGCCAGGG - Intergenic
1019623066 7:2002024-2002046 TGGCTGGGATTCAGGGCACCTGG - Intronic
1019835657 7:3380766-3380788 CATCTGTGATTCAGGCGAAAGGG + Intronic
1019910366 7:4096804-4096826 GAGCTGAGATTCAGGGGCCGGGG + Intronic
1019982325 7:4630552-4630574 AAGCTGGAATTCATGGAACATGG - Intergenic
1020405799 7:7832817-7832839 CAGGTGGGATTCAGTGGAGGTGG + Intronic
1020978036 7:15032249-15032271 GAGGTGGGAATCAGGCGACATGG - Intergenic
1021275254 7:18642262-18642284 CAACTGGGAGTCAGGGGACTTGG - Intronic
1021795391 7:24249229-24249251 CAACTGGGAGGCAGAGGACAAGG + Intergenic
1023370302 7:39506338-39506360 GAGCTGGGAGTGGGGGGACAAGG + Intergenic
1023582993 7:41701362-41701384 CTGATGGGATCCAGGGGAGATGG + Intronic
1023852140 7:44156538-44156560 CTGCAGGGAAGCAGGGGACATGG + Intronic
1023942838 7:44781053-44781075 CAGTTGGGACTTGGGGGACAGGG + Intergenic
1025226941 7:57173807-57173829 CACCTTCGATTCATGGGACAAGG - Intergenic
1025238427 7:57251065-57251087 CACCTGGGATTCACAAGACAGGG - Intergenic
1026901499 7:74039941-74039963 CAGCTGGGAGTCCAGGGACCTGG - Intronic
1028094706 7:86745492-86745514 CAGCTTGGATTCAGGGCTCAAGG + Intronic
1028527027 7:91797881-91797903 CAGCTGGAATGCAGAGGACATGG + Intronic
1030612922 7:111708187-111708209 CAGCTGGCAGTGAGGGGAAAAGG + Intergenic
1031676737 7:124619717-124619739 CAGCCAGGATTCAGGGGTCCAGG + Intergenic
1032551692 7:132790590-132790612 CAGCTGGGATGCTGGTCACAGGG - Intronic
1033416203 7:141163368-141163390 GAGCTCAGATTCAGGGGGCAGGG + Intronic
1033539534 7:142343873-142343895 CAGCTGGGATTTAAGACACAGGG - Intergenic
1034859347 7:154582567-154582589 CAGCTGGGCTTCAGATGTCAAGG + Intronic
1034958908 7:155352134-155352156 CTGCTGGTGTGCAGGGGACACGG + Intergenic
1035167906 7:157002613-157002635 AGGCTGGGTTCCAGGGGACAGGG + Intronic
1035986547 8:4438760-4438782 CACTTGTGATTCAGGGCACATGG - Intronic
1036491684 8:9232186-9232208 CAACTGGGATTCTGGGGAGAGGG + Intergenic
1036569558 8:9968101-9968123 CAGCTGTGGTTGAGGGGATAAGG + Intergenic
1037582681 8:20254902-20254924 CAGCGGGGATTTAGGGGGCCAGG - Exonic
1037704919 8:21310608-21310630 CAGCTGGGAGTCAGTGGGAAAGG + Intergenic
1037705654 8:21313584-21313606 CAGCTGGGAGTCAGTGGGAAAGG + Intergenic
1037705819 8:21314299-21314321 CAGCTGGGAGTCAGTGGGAAAGG + Intergenic
1038349297 8:26761872-26761894 CAGATGGGCTGCTGGGGACAGGG + Intronic
1039221988 8:35342213-35342235 TACCTGGGATTCTGGGGTCACGG - Intronic
1039498650 8:38000118-38000140 CAGCTGGGAGACAAAGGACAAGG - Intergenic
1039574258 8:38611040-38611062 CAGCTGGGATTCAGGGGTAGGGG + Intergenic
1041362383 8:57066918-57066940 CAGCTGGGGCCCAGGGGCCATGG + Intergenic
1042340099 8:67669825-67669847 CATCTGGGAGCCACGGGACATGG + Intronic
1044538259 8:93381849-93381871 TAGCTGGGATGCAGGGCACCAGG + Intergenic
1046175580 8:110571138-110571160 CAGCTGGGACACAGAGCACAAGG + Intergenic
1046507863 8:115159359-115159381 CAGCTGGGCTTCTGGGTCCATGG - Intergenic
1048339884 8:133530222-133530244 CAGCAGGCACTCAGAGGACAAGG + Intronic
1048530577 8:135245282-135245304 CTTCGGGGATTCAGGGGAAAGGG - Intergenic
1049056470 8:140241047-140241069 CAGCAGGGATGCAGGTGACAGGG - Intronic
1049529581 8:143147718-143147740 CACCTGGGAGTGTGGGGACAGGG + Intergenic
1050488482 9:6161712-6161734 CAACAGGGATTGAGAGGACAGGG - Intergenic
1051462847 9:17342853-17342875 CAGCTGGGATTAGCAGGACAGGG - Intronic
1052795019 9:32915606-32915628 TAGATGGGATTGAGGGGAGATGG + Intergenic
1053142192 9:35689269-35689291 CAGCTGGGACAGAGGGGACTTGG + Exonic
1053575975 9:39357738-39357760 CAGCTGGAAATCAGGAGACTGGG - Exonic
1053675364 9:40420556-40420578 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1053840490 9:42185675-42185697 CAGCTGGAAATCAGGAGACTGGG - Exonic
1053925153 9:43046893-43046915 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054097544 9:60916429-60916451 CAGCTGGAAATCAGGAGACTGGG - Intergenic
1054118946 9:61192059-61192081 CAGCTGGAAATCAGGAGACTGGG - Exonic
1054288636 9:63259082-63259104 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054386462 9:64560619-64560641 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054509258 9:65955736-65955758 CAGCTGGGATGCAGGGCACCAGG + Intergenic
1054588805 9:66990503-66990525 CAGCTGGAAATCAGGAGACTGGG + Intergenic
1056462117 9:86818355-86818377 CAGATGGGGTCCAGGCGACAGGG - Intergenic
1056580200 9:87884571-87884593 AAGCTGGAAATCAGGAGACAGGG - Exonic
1056591497 9:87969037-87969059 CATCTGGAACCCAGGGGACAGGG - Intronic
1056621297 9:88216983-88217005 CAGCCCTGATTCAGGGAACAAGG + Intergenic
1056761707 9:89420124-89420146 CAGCTGGGAGGCAGGACACAAGG - Intronic
1057513947 9:95705053-95705075 CAGCATGAATTCAGGGGACCTGG - Intergenic
1057720177 9:97525995-97526017 TAGCTAGGATTCATGGGTCAGGG - Intronic
1059533886 9:115063236-115063258 ACGCTGGGATTCAGGTGAGATGG + Intronic
1059730137 9:117048836-117048858 CAGCTGTGTGTCAGGAGACATGG - Intronic
1060803794 9:126562459-126562481 CACCAGGGGTTCTGGGGACAAGG - Intergenic
1060986129 9:127819974-127819996 CAGCTGTGAGGCAGAGGACAGGG - Exonic
1062249497 9:135587218-135587240 CAGCTGGGACTCATGGGGCCTGG - Intergenic
1062343468 9:136103986-136104008 CTGCTGGGGTTCAGGGAACTCGG + Intergenic
1185430757 X:10481-10503 CATCTGGGATTTAGGGGACCTGG + Intergenic
1185440023 X:222878-222900 CATCTGGGATTTAGGGGACCTGG + Intergenic
1185948134 X:4401114-4401136 CAGCTGGGATACTGGGAACCTGG + Intergenic
1191598474 X:62974466-62974488 CAGCTGGAATGCAGGGTACCAGG + Intergenic
1194662090 X:96639036-96639058 CAGCAGGGATGCAGGGCACCAGG - Intergenic
1195657419 X:107345380-107345402 CAGCTGGAAGTCAGGCTACATGG + Intergenic
1196796026 X:119502595-119502617 ATGCTGGGATGCAGGGGGCATGG + Intergenic
1197767967 X:130071306-130071328 CAGCTGGGACTCAGGTGAGGTGG - Intronic
1198283146 X:135162721-135162743 CATCTGAGAGTCAGGGGCCATGG - Intronic
1198655089 X:138905133-138905155 AATCTGGGATTCTTGGGACAGGG + Intronic
1200810685 Y:7481498-7481520 CCGCTGAGTTTCAGAGGACAAGG + Intergenic
1201381699 Y:13386866-13386888 CAGCTGGGATTGCAGGCACATGG - Intronic