ID: 1091811882

View in Genome Browser
Species Human (GRCh38)
Location 12:3406210-3406232
Sequence GGATTCAGGGGACAAGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811872_1091811882 5 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811882 12:3406210-3406232 GGATTCAGGGGACAAGGTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 229
1091811874_1091811882 3 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811882 12:3406210-3406232 GGATTCAGGGGACAAGGTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 229
1091811873_1091811882 4 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811882 12:3406210-3406232 GGATTCAGGGGACAAGGTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 229
1091811877_1091811882 -5 Left 1091811877 12:3406192-3406214 CCAAGGATGGAGCAGCTGGGATT 0: 1
1: 0
2: 13
3: 150
4: 669
Right 1091811882 12:3406210-3406232 GGATTCAGGGGACAAGGTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811882 Original CRISPR GGATTCAGGGGACAAGGTTC TGG Intronic
900268946 1:1777295-1777317 GGCTTGAGAGGACAATGTTCAGG + Intronic
902885221 1:19400027-19400049 GCATTCAGGGGAGAAGATTATGG - Intronic
903696679 1:25212518-25212540 CGATTTAGAGGACAACGTTCCGG - Intergenic
906117455 1:43366181-43366203 GGAATCCGAGGATAAGGTTCTGG - Intronic
908300178 1:62755230-62755252 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
908634488 1:66147422-66147444 TGAATCACGGGACATGGTTCAGG - Intronic
912358580 1:109075803-109075825 GAATTCAGCGGACAGAGTTCGGG - Intronic
913171033 1:116232414-116232436 GGATACAGGTGAGAAGGTTGGGG + Intergenic
914447747 1:147764200-147764222 GGAGTCAGAGGAAGAGGTTCTGG - Intronic
914677557 1:149916455-149916477 GGTTAAAGGAGACAAGGTTCAGG + Intronic
915169915 1:153970316-153970338 GGAATCTGGGGACAGGGCTCAGG + Intronic
915260325 1:154672450-154672472 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
916114211 1:161473623-161473645 GGACCCAGGGGACAAGGGTCAGG - Intergenic
916587790 1:166163945-166163967 GGATTCAGTGGGGAAGGGTCAGG + Intronic
916982496 1:170153977-170153999 GGTTTCAGGGGACCAGGCCCAGG + Intronic
917488273 1:175475132-175475154 GGAGTCAGGGGACATGGTGGTGG - Intronic
917856471 1:179105018-179105040 GGGTTGAGGGCTCAAGGTTCAGG - Exonic
920265285 1:204716925-204716947 GGAAACAGGGAACAAAGTTCAGG + Intergenic
921483268 1:215688171-215688193 AGAATCAGGGGACAAAGTTTTGG + Intronic
921624351 1:217361767-217361789 AGATTCAGGGGATAAGCTTAAGG - Intergenic
1063321945 10:5059347-5059369 GGACCCAGGGGGCAAGGGTCAGG + Intronic
1065516133 10:26526110-26526132 GGTTTCAGGTGACAGGGTTTAGG - Intronic
1068067015 10:52144223-52144245 GGATTTATGGGACAAGGAACTGG + Intronic
1069154675 10:65012775-65012797 GGATGCAGGGGTCACGGTTGTGG - Intergenic
1072109403 10:92304136-92304158 GCATTCAGTGGAAAATGTTCTGG - Intronic
1072763593 10:98078586-98078608 GGAAGCAGGGGTCAAGGGTCAGG - Intergenic
1074539686 10:114354077-114354099 GGACTCAGGCGCGAAGGTTCCGG - Intronic
1075129135 10:119723780-119723802 GGCTGCAGTGGCCAAGGTTCAGG + Intergenic
1076930681 10:133529779-133529801 CGCTTCCGGAGACAAGGTTCTGG - Intronic
1077020173 11:413831-413853 GGGTTCAGGGGAGAGGGTGCAGG - Intronic
1077524992 11:3058755-3058777 GGACTTAGGGGACGAAGTTCTGG + Intergenic
1077719173 11:4609770-4609792 GGATTCAGGGCAGAGGGTTGGGG - Intergenic
1079981214 11:27153442-27153464 AGATTCAGGGGATAAGGATGTGG - Intergenic
1082002843 11:47403221-47403243 GTATCCAGGGGACAAGGCTAAGG + Intergenic
1082943476 11:58733331-58733353 AGATACAAGGGAAAAGGTTCGGG + Intergenic
1083046155 11:59737022-59737044 GGACTCAGGGGAAAGGGTGCGGG - Intronic
1083187454 11:61026067-61026089 GTTTCCAGGGGACAAGGTTAGGG - Intergenic
1083743086 11:64721472-64721494 GGAGACAGGGGAGAAGGGTCTGG - Intronic
1084695229 11:70749169-70749191 GGATTCAGGGGAAGAAGTGCAGG + Intronic
1086209836 11:84306721-84306743 GGATTTAGGGGAAGAGGGTCAGG - Intronic
1086547024 11:88009451-88009473 GGATTCTGGGGAGAAGTTTCAGG + Intergenic
1086997377 11:93373352-93373374 GGACTCAGGGGAAAGGGTTGGGG - Intronic
1087666288 11:101052940-101052962 GGATTCAGGGGTCAACATCCTGG + Intronic
1088358117 11:108964230-108964252 AGATTCAGGGGACACTGTGCAGG - Intergenic
1088492327 11:110400353-110400375 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
1088568515 11:111198135-111198157 GGATCCAGGGCACATGGTACAGG - Intergenic
1089011577 11:115136156-115136178 GAATGCAGGGGAGAAAGTTCAGG - Intergenic
1089134426 11:116237955-116237977 GGACTCACAGGACCAGGTTCAGG + Intergenic
1089986176 11:122816118-122816140 TGATTCAGGGGAGAAGGGTGGGG + Intergenic
1091044457 11:132313328-132313350 AGATTCAGGGGACATGCTTTGGG - Intronic
1091811882 12:3406210-3406232 GGATTCAGGGGACAAGGTTCTGG + Intronic
1092472064 12:8789147-8789169 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
1094338343 12:29384881-29384903 GGACCCAGGGGGCAAGGGTCAGG + Intergenic
1095323299 12:40856899-40856921 ACATTCAGGAGACAAAGTTCTGG + Intronic
1097389921 12:58997501-58997523 GAGTTCAGGGGACAGGATTCAGG + Intergenic
1097754225 12:63391040-63391062 GTGGTCAGGGGACAAGGTTGAGG + Intergenic
1098209822 12:68151823-68151845 AGATTCAGGGGACTAGGATGTGG - Intergenic
1098983426 12:76984774-76984796 GGGGTCAGGGGTCGAGGTTCAGG - Intergenic
1103741777 12:123096098-123096120 GGCTTCAGGGGACAAGCCACGGG - Intronic
1104043631 12:125146290-125146312 GCAGTCAGGTGACAAGGTTGTGG - Intergenic
1104305964 12:127611190-127611212 GGACCCAGGAGACAAGGGTCAGG - Intergenic
1105762236 13:23525716-23525738 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
1106072669 13:26427255-26427277 GGATTCAGGGGCTAATTTTCTGG - Intergenic
1107097292 13:36550267-36550289 GGATTAATGGGGGAAGGTTCAGG + Intergenic
1109500816 13:63234749-63234771 GGATGCAGGAGGCAAGGGTCAGG - Intergenic
1110334167 13:74307390-74307412 GGATTCAGGGGCCTAGATTATGG + Intergenic
1113738645 13:112696300-112696322 GGAGTGCGGGGAGAAGGTTCCGG - Intronic
1114454879 14:22847910-22847932 GGATTCAGGGGCCAGAGTTGGGG + Intronic
1115453074 14:33571182-33571204 GGATCCAGGAGACCTGGTTCTGG + Intronic
1117230539 14:53712901-53712923 GGATTCAGGGGAAAGGGTTGGGG - Intergenic
1117440176 14:55752362-55752384 GGGTGCAGAGGAAAAGGTTCTGG - Intergenic
1118366554 14:65101994-65102016 GGATCCGGGGGACAAGGATGGGG - Intronic
1119120421 14:72070610-72070632 GGATTCAGGGTTCAGAGTTCAGG - Intronic
1121439167 14:93937970-93937992 GTGTTGAGGGGACATGGTTCAGG - Intronic
1121512203 14:94520845-94520867 GGATTCCAGGTACAAGGTTGAGG - Intergenic
1122161311 14:99786203-99786225 GGATTCAGGATAAAAGGATCTGG + Intronic
1122705307 14:103617136-103617158 GGATTCAGTGGCCAGGGGTCTGG - Intronic
1126184071 15:45813807-45813829 GGATTCGGGGGAAAAGGGTCGGG - Intergenic
1126191063 15:45879303-45879325 GGACTCAGGGGAAAGGGTTGGGG + Intergenic
1127179002 15:56395120-56395142 GGATTGAGGGGAGCAGGGTCAGG - Intronic
1128941311 15:71790160-71790182 GGGTGCAGGGGGCATGGTTCTGG - Intergenic
1129295556 15:74598246-74598268 GGGTGAAGGGGAGAAGGTTCAGG - Intergenic
1129744433 15:78008164-78008186 TGATTCAAGGGCCAAGGATCTGG + Intronic
1131407018 15:92173423-92173445 GGCTACAGAGGACAAGATTCAGG - Intergenic
1131410959 15:92208083-92208105 GGATCCAGGAGGCAAGGGTCAGG - Intergenic
1131624587 15:94104150-94104172 GCATTCAGAGGACAAGGCTGAGG - Intergenic
1132119839 15:99167232-99167254 TGTTTCAGGGCACAAGGTTCAGG - Intronic
1134127944 16:11629369-11629391 GGAGTAAGGAGACAAGGTGCAGG + Intronic
1134678270 16:16105538-16105560 GTTTTCAGGGGACACAGTTCTGG + Intronic
1137003934 16:35255342-35255364 GGGTTCTGAGGAGAAGGTTCCGG - Intergenic
1138376042 16:56564819-56564841 GGTTTCAGGGAACCAGGCTCAGG - Intergenic
1138378395 16:56582904-56582926 GGAGTCAAGAGACATGGTTCAGG + Intergenic
1138386036 16:56636169-56636191 GGGTTCAGGACAGAAGGTTCTGG + Intergenic
1140513693 16:75527105-75527127 GGAGTCAGGGCCCAAGGTTTTGG - Intergenic
1141675269 16:85514278-85514300 AGATTCAGGGGAGAAGGGCCAGG + Intergenic
1144782667 17:17815783-17815805 AGATTCAGGCGACAAGGGACAGG + Intronic
1146548465 17:33759631-33759653 GGTTTCAGGGGACAAGCCTGAGG + Intronic
1146715976 17:35087959-35087981 GTAGGCAGGGGACAAGGTACTGG - Intronic
1146912818 17:36659173-36659195 GGGCTCAGGGCACAAGGTCCTGG + Intergenic
1149213400 17:54328491-54328513 GGACCCAGGGGGCAAGGGTCAGG + Intergenic
1149541945 17:57474038-57474060 TGCTTCAGGGGACAGAGTTCAGG + Intronic
1150194963 17:63288192-63288214 GAATTCAAGGGACAGAGTTCTGG - Intronic
1151567781 17:74909312-74909334 GGACCCAGGGGACAAGGGTCAGG - Intergenic
1152807257 17:82362020-82362042 GGATGAAGGGGACAAGGAGCAGG - Exonic
1155066390 18:22272827-22272849 GGAGCCAGGGGAGAGGGTTCTGG + Intergenic
1155128988 18:22911316-22911338 TGATTCAGGTGACAAGGCTAGGG + Intronic
1157732358 18:50015123-50015145 GGGTTCACGGGACAGGGATCAGG + Intronic
1158125944 18:54099917-54099939 GGAGTCAGGGGAGAGGGTACTGG + Intergenic
1159486272 18:69062292-69062314 GGATTCAGGGGTCCATGTGCAGG + Intergenic
1160793160 19:932376-932398 GGAGTCAGGGGAGAAGGTGCTGG - Intronic
1160965174 19:1744287-1744309 GGATTCTGGGGAGATGGTACCGG - Intergenic
1161984715 19:7647067-7647089 GTATTCAGGGGCCAAGATCCTGG - Intronic
1162558539 19:11402424-11402446 GGGGTCAGGGGTCAAGGGTCAGG + Intronic
1162737870 19:12756444-12756466 GGAGTCAGGGGACAAGGTCAAGG + Intronic
1164708910 19:30340293-30340315 GGTTTCAGGGGACAAGATGATGG + Intronic
1164733860 19:30526205-30526227 GGATGCAGCGGGCAAGGTTTGGG - Intronic
1166380779 19:42354061-42354083 TGGGTCAGGGGACACGGTTCTGG - Intronic
1167409931 19:49338625-49338647 GGGATCAGGGGACAAGGTGATGG - Intronic
927106345 2:19830635-19830657 GGGTTCAGGGGACCAGGTTTTGG + Intergenic
928620199 2:33081238-33081260 GGCTTCAGGGGAGAAGGGCCAGG + Intronic
930038270 2:47101449-47101471 GGACCCAGGGGGCAAGGGTCAGG - Intronic
930620941 2:53643130-53643152 GGGTGCAGGGGACAAGGATCAGG + Intronic
933512847 2:83263068-83263090 GCATTTAGGGGACAAGGACCAGG - Intergenic
934866884 2:97822040-97822062 GGACCCAGGGGGCAAGGGTCAGG - Intronic
937150225 2:119681278-119681300 GGCTTCACGGGACAAGGTCAGGG - Exonic
937265806 2:120614036-120614058 GGAATCAGGGGGCAAAGCTCTGG - Intergenic
940854018 2:158715926-158715948 GGATTCAGGGCCCAGGGTCCTGG - Intergenic
942991433 2:182207824-182207846 GGATGCAGGGCACAATGTCCAGG - Intronic
943642982 2:190379306-190379328 GTACTCATGTGACAAGGTTCTGG - Intergenic
944728732 2:202497689-202497711 GGACCCAGGGGGCAAGGGTCAGG - Intronic
945448134 2:209962227-209962249 GGCTTCAGGAAAAAAGGTTCTGG + Intronic
945966160 2:216189316-216189338 GGTTTCAGGGGACAAGGGAGAGG + Intronic
946818665 2:223608156-223608178 GGATTTGGGGGAGAAAGTTCTGG - Intergenic
948746208 2:240095854-240095876 GGATGCAGGGGCCAGGGTGCAGG + Intergenic
1169385017 20:5141375-5141397 GGCTTTAGAGGACAGGGTTCAGG + Intronic
1171182417 20:23100619-23100641 GGATTAAGGGGACAGGGTAAGGG - Intergenic
1171348797 20:24487030-24487052 GGAATCACGGGCCAAGGTTGGGG + Intronic
1172483350 20:35284635-35284657 GGATTCAGGGCCGGAGGTTCTGG - Intronic
1172775481 20:37404302-37404324 GGAATCAGGGTAAAAGGTGCAGG + Exonic
1174115332 20:48223036-48223058 GGAGACAGGGGACATGGCTCTGG + Intergenic
1176278357 20:64286958-64286980 GGGGTCAGGGGTCAAGGGTCGGG + Intronic
1181024012 22:20117489-20117511 GGGGTCAGGGGTCGAGGTTCGGG + Intronic
1182009738 22:26990406-26990428 GAATTCAGGTAACAAGGCTCTGG + Intergenic
1183102123 22:35590707-35590729 AGCTTCAGGGGCCTAGGTTCAGG + Intergenic
1183230063 22:36576366-36576388 GGATTCAGGGGGAAAGGGTGGGG + Intronic
1183625013 22:38996517-38996539 GGATTCGGGGCAGAAGGTCCTGG + Intergenic
1184653824 22:45931421-45931443 GGGCTCAGGGGACAGGGTGCCGG + Intronic
952516343 3:34108058-34108080 GGACTAAGGGTACTAGGTTCTGG + Intergenic
953033277 3:39191553-39191575 GGAGTCAGGAGACATGCTTCAGG - Intronic
958549459 3:95594622-95594644 GGACCCAGGGGTCAAGGGTCAGG + Intergenic
958576027 3:95950592-95950614 GGACCCAGGAGACAAGGGTCAGG + Intergenic
958820537 3:98968863-98968885 GAATTCAGAGGGCATGGTTCTGG + Intergenic
958878835 3:99646038-99646060 AGATTTAGGGGAGCAGGTTCTGG - Intronic
959965030 3:112344406-112344428 AGATTTATGGGACAATGTTCTGG - Intronic
961902332 3:130225164-130225186 AGATTCAGGGGATAATGTACAGG + Intergenic
962119677 3:132548533-132548555 GGCTTCAGGGGAAATGGTCCCGG - Intergenic
962878462 3:139554020-139554042 GAATTTTGGAGACAAGGTTCTGG + Intergenic
963192077 3:142483935-142483957 GGACTCAGGGGATGAGGGTCTGG + Intronic
963760823 3:149285549-149285571 GGAACCAGGGGGCAAGGCTCAGG - Intergenic
966637010 3:182146644-182146666 GGCTTAAGGGGACAAGGATCTGG - Intergenic
967583390 3:191186388-191186410 GGATCCAGGGGGCAAGGGTTAGG - Intergenic
969003245 4:3999621-3999643 GGATTCTAGGCACAAGGATCTGG - Intergenic
969810681 4:9645198-9645220 GGATTCTAGGCACAAGGATCTGG + Intergenic
970219932 4:13799677-13799699 GGGGTCAGGGGACAGGGGTCAGG - Intergenic
971215106 4:24655398-24655420 AGAATCAGGGGACCAGCTTCAGG + Intergenic
971406785 4:26328961-26328983 GGATACAGAGGACAAGGGTAAGG + Intronic
971491869 4:27221084-27221106 GCATTCAGTGTACAAGTTTCTGG + Intergenic
971577015 4:28287303-28287325 GGATTCAGGGGAAAGGGTAGGGG + Intergenic
971578247 4:28303957-28303979 GGACCCAGGAGGCAAGGTTCAGG - Intergenic
972908340 4:43779851-43779873 GGATGCAGTGGAGGAGGTTCAGG + Intergenic
973954790 4:56051634-56051656 TGATTCAGGGGAGAAAGCTCTGG - Intergenic
975204606 4:71630315-71630337 GGACTCAGGGGAAAACGTTGTGG + Intergenic
976174575 4:82338156-82338178 GGATCCAGGAGGCAAGGGTCAGG + Intergenic
976915324 4:90366739-90366761 GGATTTAAGGGACACAGTTCAGG + Intronic
977883848 4:102236186-102236208 GGACCCAGGGGACAAGGGTCAGG - Intergenic
977885701 4:102250279-102250301 GGATTGTGGGCACAAGGCTCAGG - Intergenic
979510856 4:121551884-121551906 GGACTCAGGATAAAAGGTTCTGG + Intergenic
981190798 4:141860471-141860493 GGATTCAAGGAACAACATTCTGG + Intergenic
981216874 4:142179939-142179961 GGAATCAGGAGACCAGGTTTGGG - Intronic
982700876 4:158658854-158658876 GGACCCAGAGGACAAGGGTCAGG - Intergenic
983037986 4:162890923-162890945 AGCTTCAGGGGAAAAGGGTCAGG + Intergenic
985467490 5:11821-11843 GGGGTCAGGGGTCAGGGTTCGGG - Intergenic
988830949 5:34986830-34986852 GTATCCAGGGGAAAATGTTCAGG + Intergenic
989957108 5:50371213-50371235 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
990505261 5:56437676-56437698 GGATTTAGGGGAAAAGGTGGGGG + Intergenic
992049102 5:72927190-72927212 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
994009474 5:94884376-94884398 GGAGTCAAGGAACAAGGTTATGG - Intronic
995526600 5:113055222-113055244 GGATTCTGGGGACAAGGACAGGG - Intronic
995583688 5:113625001-113625023 GGACTCATGGGGCAAGGGTCAGG + Intergenic
997046605 5:130326562-130326584 GGATTCAGGGCAATAGGTTGGGG + Intergenic
999123446 5:149228204-149228226 GGACTAAGGGCAGAAGGTTCAGG - Intronic
1001316460 5:170644452-170644474 GGATTGAGGGGAGAAGGGGCTGG + Intronic
1002094973 5:176825261-176825283 GGATTCAGGGGACAATTTTGAGG + Intronic
1006639590 6:35483067-35483089 GGCTCCAGGGGACAGGGCTCTGG + Intronic
1008587268 6:52961162-52961184 GGACCCAGGGGGCAAGGGTCAGG + Intergenic
1009407973 6:63332353-63332375 GGACCCAGGGGGCAAGGGTCAGG + Intergenic
1011965365 6:93150729-93150751 GGACTCAGGGGAAAGGGTTGGGG - Intergenic
1014829215 6:126081574-126081596 GGAGTAAGGGGATAAGTTTCTGG + Intergenic
1015380018 6:132556431-132556453 GGACTCAGGGGAGAAGGTTGGGG - Intergenic
1015975950 6:138790915-138790937 GGAATCAGGTGACAAGGTCCTGG - Intronic
1019307322 7:342026-342048 GGAGACAGGGGACAAGGGACAGG - Intergenic
1022954899 7:35371935-35371957 GTACTCAGAGGACAAGATTCAGG - Intergenic
1023078203 7:36503791-36503813 GGACTCAGGAGGCAAGGGTCAGG + Intergenic
1024640844 7:51327287-51327309 GGCATCAGGGGACACGGTTGGGG + Intergenic
1027679947 7:81207626-81207648 GTATCCAGGGGACAAGATGCAGG + Intergenic
1029307818 7:99633824-99633846 GGATTCAGGAGCCAAGGTCCAGG - Intergenic
1029484952 7:100834585-100834607 GGATTCAGGAGATAAGGGTTGGG + Intronic
1031858763 7:126954319-126954341 GGATTCAGGGGAAAGGCTTAAGG - Intronic
1032083573 7:128872299-128872321 GGGTTCAGGGGAGAAAGTTCAGG - Intronic
1033759513 7:144423965-144423987 GGACCCAGGGGGCAAGGGTCAGG + Intergenic
1034726339 7:153339665-153339687 GAATTCAGGAGAAAAGGCTCAGG + Intergenic
1034912494 7:155008776-155008798 GGTGTCAGGAGACCAGGTTCTGG - Intergenic
1037307875 8:17524648-17524670 GGAATCAGGGGAAAGGGTTGGGG + Intronic
1037320335 8:17635289-17635311 GGATTCAGGGGAAAGGGTTGGGG - Intronic
1039679027 8:39708822-39708844 GGGTGCAGGGGCCAAGGTGCAGG + Intronic
1041832489 8:62170529-62170551 GGACTCAGGGGAAAGGGTTGGGG + Intergenic
1044456893 8:92400007-92400029 GGACCCAGGAGACAAGGGTCAGG + Intergenic
1048596448 8:135871983-135872005 GAATTGAGGGGACAAGTTTTTGG + Intergenic
1051761357 9:20468617-20468639 GGAATCAGGGGACCTGGTTCTGG + Intronic
1051934999 9:22435431-22435453 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
1053532599 9:38897184-38897206 GGACCCAGGAGACAAGGGTCAGG + Intergenic
1054204822 9:62121605-62121627 GGACCCAGGAGACAAGGGTCAGG + Intergenic
1054633536 9:67466753-67466775 GGACCCAGGAGACAAGGGTCAGG - Intergenic
1056099547 9:83287604-83287626 GGTTTCAGGGAAGAGGGTTCTGG - Intronic
1058633210 9:107010258-107010280 GGCTTCAGGGACCAAGCTTCAGG - Intronic
1058715418 9:107718308-107718330 GGAGGCAGGGGAGAAGGTGCAGG - Intergenic
1059516694 9:114902600-114902622 AGAATATGGGGACAAGGTTCAGG - Intronic
1060221757 9:121767827-121767849 GGCTGCAAGGGACAAGGTTAGGG + Intronic
1061270266 9:129536350-129536372 GGCTTCAGGGAAGAGGGTTCTGG + Intergenic
1061370696 9:130195907-130195929 GGGTTCAGGGCTCAGGGTTCAGG - Intronic
1061489638 9:130938086-130938108 AGATTCAGGGGGTCAGGTTCAGG + Intronic
1061912299 9:133731616-133731638 GGATTCAAGGGACAGGCTCCGGG - Intronic
1062011968 9:134272283-134272305 GAAATGAGGGGACAAGGTCCTGG + Intergenic
1203794528 EBV:169566-169588 GGATTCAGGCGAAAAGGGTGTGG + Intergenic
1186232280 X:7468268-7468290 GGATTCTGGGAACATTGTTCTGG + Intergenic
1188392172 X:29634212-29634234 GGATTCAGGGGTAAAGGCTGGGG + Intronic
1188890037 X:35599006-35599028 GGACTCAGGGGAAAAGGTGGAGG + Intergenic
1189020569 X:37333618-37333640 AGATTCAGAGGACAGAGTTCCGG - Intergenic
1189325146 X:40107219-40107241 GGATTTAGGGGGAAAGGGTCGGG + Intronic
1190374627 X:49776719-49776741 GGATTCCTGGGTCAAGATTCTGG - Intergenic
1191222837 X:58008717-58008739 GGATTCAGGGGAAAGGGTGGGGG - Intergenic
1191689607 X:63926287-63926309 GGGATCAGGACACAAGGTTCTGG - Intergenic
1191853959 X:65607776-65607798 GGAGGCAGGGGACATGGTTCTGG + Intronic
1191858158 X:65644275-65644297 GGATTTAGGGGAAAAGGTAAAGG - Intronic
1193741193 X:85219735-85219757 GGAGTCAGGGGCCCAGGTTATGG - Intergenic
1194620347 X:96163125-96163147 GGATTCAGGTGAGCAGGTGCAGG - Intergenic
1198495935 X:137193414-137193436 GGAGTCAGTGGACCAGGTTATGG + Intergenic
1201429421 Y:13889826-13889848 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
1201468573 Y:14311113-14311135 GGACCCAGGGGGCAAGGGTCAGG - Intergenic
1201561554 Y:15322580-15322602 GGAGTCAGGGGACAAAGGTGAGG - Intergenic