ID: 1091811883

View in Genome Browser
Species Human (GRCh38)
Location 12:3406211-3406233
Sequence GATTCAGGGGACAAGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811874_1091811883 4 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811883 12:3406211-3406233 GATTCAGGGGACAAGGTTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 144
1091811872_1091811883 6 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811883 12:3406211-3406233 GATTCAGGGGACAAGGTTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 144
1091811873_1091811883 5 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811883 12:3406211-3406233 GATTCAGGGGACAAGGTTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 144
1091811877_1091811883 -4 Left 1091811877 12:3406192-3406214 CCAAGGATGGAGCAGCTGGGATT 0: 1
1: 0
2: 13
3: 150
4: 669
Right 1091811883 12:3406211-3406233 GATTCAGGGGACAAGGTTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811883 Original CRISPR GATTCAGGGGACAAGGTTCT GGG Intronic
902885220 1:19400026-19400048 CATTCAGGGGAGAAGATTATGGG - Intronic
903696678 1:25212517-25212539 GATTTAGAGGACAACGTTCCGGG - Intergenic
905000003 1:34660694-34660716 GATGCAGGGGCCAAGGCCCTTGG - Intergenic
905105428 1:35560899-35560921 CATTCAGGGGGCACGGTTGTCGG - Exonic
906685255 1:47759092-47759114 GATGCATGAGACAATGTTCTAGG - Intergenic
911484504 1:98488755-98488777 GATACAGGTGAAAATGTTCTTGG + Intergenic
911944436 1:104088312-104088334 GCCTCAGGGGATAAGATTCTAGG + Intergenic
912913361 1:113786339-113786361 GATTCTGGGGATTAGGTTCTAGG - Intronic
919167014 1:193908082-193908104 GATTCAGTTGACAAGTTGCTTGG + Intergenic
920447032 1:206025364-206025386 GGTTCAGGGGTCAAAGGTCTAGG - Intergenic
921483269 1:215688172-215688194 GAATCAGGGGACAAAGTTTTGGG + Intronic
921607576 1:217173673-217173695 TATACAGGGGGCAGGGTTCTTGG - Intergenic
924274803 1:242374946-242374968 GCTTCAGGGGTCAAGGGCCTTGG + Intronic
1063851775 10:10200472-10200494 GCTTCAGGGGAGAAGGAGCTAGG - Intergenic
1064509738 10:16076903-16076925 GAGTCAGAGGAAAAGGTTTTAGG + Intergenic
1065168728 10:23007070-23007092 GATACAGGAGAAAAGGGTCTGGG - Intronic
1066075199 10:31868424-31868446 GTTTGAGGGGACAAGGATGTGGG + Intronic
1066109262 10:32181888-32181910 AAATCAGGAGACAAGGTGCTGGG - Intergenic
1069154674 10:65012774-65012796 GATGCAGGGGTCACGGTTGTGGG - Intergenic
1073299067 10:102459766-102459788 GATTCTGGGGGCAAGGTTCATGG + Intergenic
1074504761 10:114059777-114059799 GACTGAGGGGAGAGGGTTCTGGG + Intergenic
1076427225 10:130375940-130375962 GATTTAAGGGACAATTTTCTAGG - Intergenic
1086547025 11:88009452-88009474 GATTCTGGGGAGAAGTTTCAGGG + Intergenic
1087348352 11:96999847-96999869 GAATCAGGGGATGAGGTTTTTGG - Intergenic
1087491313 11:98830457-98830479 GATTGAGAGGACATGATTCTAGG - Intergenic
1091044456 11:132313327-132313349 GATTCAGGGGACATGCTTTGGGG - Intronic
1091713255 12:2757611-2757633 GGTTCAGGGGACAAAGATATGGG - Intergenic
1091811883 12:3406211-3406233 GATTCAGGGGACAAGGTTCTGGG + Intronic
1092289907 12:7153840-7153862 CACTCAGGGGAGAAGGTGCTGGG - Intronic
1095925356 12:47573676-47573698 AATTCATGGGATAAGGTACTAGG + Intergenic
1098103527 12:67044272-67044294 AATTTAGGGGAAAAAGTTCTTGG - Intergenic
1101314399 12:103616044-103616066 GATTCACTGGACAAGGTGTTTGG - Intronic
1101808131 12:108082852-108082874 GACTCAGGTGATAAGGTTTTAGG + Intergenic
1104317696 12:127719587-127719609 ATTTCATGGGAAAAGGTTCTGGG + Intergenic
1104936575 12:132367690-132367712 GAGCCACGGGACACGGTTCTAGG - Intergenic
1106105459 13:26729036-26729058 GACTCAAGGGAGAAGGATCTGGG + Intergenic
1106760416 13:32862220-32862242 CATTCAGGTGAAAAGGTTTTAGG - Intergenic
1107726515 13:43304987-43305009 GACTCAGGGGACAGAGTTCATGG - Intronic
1111749161 13:92305877-92305899 GATTCAGGGGAATAGCTTTTAGG + Intronic
1115857655 14:37648409-37648431 GATTCTGGGAAAAATGTTCTAGG + Intronic
1117230538 14:53712900-53712922 GATTCAGGGGAAAGGGTTGGGGG - Intergenic
1119212510 14:72843064-72843086 AATCCAGCGGACAAGGCTCTTGG + Intronic
1120347765 14:83312099-83312121 GATTCAAAGGACAAGTTTATTGG + Intergenic
1122705306 14:103617135-103617157 GATTCAGTGGCCAGGGGTCTGGG - Intronic
1122764328 14:104055039-104055061 GGCTCAGAGGAGAAGGTTCTTGG + Intergenic
1126184070 15:45813806-45813828 GATTCGGGGGAAAAGGGTCGGGG - Intergenic
1126804734 15:52336144-52336166 GATTCTGGAGTCAAGCTTCTTGG - Intronic
1126824185 15:52532485-52532507 GCTTCAGAGGACTAGGTACTGGG + Intergenic
1128941310 15:71790159-71790181 GGTGCAGGGGGCATGGTTCTGGG - Intergenic
1129639308 15:77357965-77357987 GAAGCAGAGGACAAGGTCCTTGG - Intronic
1131444546 15:92486444-92486466 CACTCAGGGGACCAGGTTCATGG - Intronic
1133387591 16:5382712-5382734 GATTCAGTTGGCAAGGTTTTCGG + Intergenic
1134678271 16:16105539-16105561 TTTTCAGGGGACACAGTTCTGGG + Intronic
1135481440 16:22823909-22823931 TATTCAGGGAACCTGGTTCTTGG - Intronic
1135968740 16:27056662-27056684 GAGTCAGGGGAGCAGGATCTTGG - Intergenic
1137005476 16:35271479-35271501 GAATCAGGGAACAAGGTACCTGG + Intergenic
1140033465 16:71356332-71356354 GATCAGGGGGACATGGTTCTGGG - Intergenic
1140274731 16:73498496-73498518 TCTTCAGGGGCCAAGGTTCCAGG - Intergenic
1143098580 17:4491957-4491979 GATTCAGGAGCCAGGGTTCCTGG + Intergenic
1144410061 17:14992125-14992147 GCTTCAGGGGAGAAGGTTGAAGG + Intergenic
1144951042 17:18993597-18993619 GCTTCAGGGCTCCAGGTTCTGGG - Intronic
1146715975 17:35087958-35087980 TAGGCAGGGGACAAGGTACTGGG - Intronic
1147027034 17:37595614-37595636 GATTCAGGGGGCACGTTTGTAGG - Intronic
1148158205 17:45435432-45435454 GATTCAGGGCTCATGGTTTTAGG - Intergenic
1148985134 17:51614012-51614034 TATTCAGGGGAAACGTTTCTAGG + Intergenic
1150194962 17:63288191-63288213 AATTCAAGGGACAGAGTTCTGGG - Intronic
1152613673 17:81328400-81328422 GATTCAGGGGAGAAGATGCATGG - Intronic
1157393730 18:47324821-47324843 GAATCAGAGGACAGGGTTGTGGG - Intergenic
1158125945 18:54099918-54099940 GAGTCAGGGGAGAGGGTACTGGG + Intergenic
1159882447 18:73871499-73871521 GACTCAGGGCCCAAGTTTCTTGG + Intergenic
1160283641 18:77518179-77518201 GGTGCAGGGGACACGGTGCTGGG + Intergenic
1160851819 19:1196323-1196345 GTTGCAGGGGCCCAGGTTCTAGG - Intronic
1160852243 19:1198137-1198159 GTTGCAGGGGCCCAGGTTCTAGG - Intronic
1162374039 19:10294660-10294682 GATGGAGGGGACACGGTCCTCGG + Intronic
1164289209 19:23852174-23852196 GCCTCAGGGGTCAAAGTTCTGGG + Intergenic
1164330113 19:24246169-24246191 GCCTCAGGGGTCAAAGTTCTGGG - Intergenic
1164708911 19:30340294-30340316 GTTTCAGGGGACAAGATGATGGG + Intronic
1165261749 19:34624832-34624854 GATTCAGGGGACAGGCTTGATGG - Intronic
1165956461 19:39504576-39504598 GATTCAGGGCCCAAGGTAGTGGG + Intronic
1166117780 19:40666622-40666644 GACTCAGGAGGAAAGGTTCTAGG + Exonic
1167409930 19:49338624-49338646 GGATCAGGGGACAAGGTGATGGG - Intronic
925006112 2:444438-444460 GATTCAGAGGAAAAGGTGCCAGG + Intergenic
927106346 2:19830636-19830658 GGTTCAGGGGACCAGGTTTTGGG + Intergenic
930443397 2:51437946-51437968 GATTCAGGGGACAGGGTAGTAGG + Intergenic
933934632 2:87192204-87192226 GAATGAGAGGAAAAGGTTCTAGG - Intergenic
936358511 2:111773692-111773714 GAATGAGAGGAAAAGGTTCTAGG + Intronic
937038242 2:118800310-118800332 GAATCAAGGGACCAGTTTCTAGG + Intergenic
937170319 2:119859512-119859534 GATTCAGGAGACAAGGTAGATGG - Intronic
937265805 2:120614035-120614057 GAATCAGGGGGCAAAGCTCTGGG - Intergenic
939801970 2:146721318-146721340 GAGTAAGGGGGCAAGTTTCTTGG - Intergenic
946016439 2:216607804-216607826 GAGTCAGTGGACAATGATCTTGG - Intergenic
946818664 2:223608155-223608177 GATTTGGGGGAGAAAGTTCTGGG - Intergenic
1170721704 20:18886551-18886573 TATTCAGGGGACCAGTTTCATGG + Intergenic
1170808268 20:19653356-19653378 GATCCAGGGGAAAATGTTCTTGG - Intronic
1175552228 20:59825006-59825028 GCTGCAGGGGGCATGGTTCTGGG - Intronic
1176241650 20:64078358-64078380 CTTTCAGGGGTCAAGTTTCTAGG + Intronic
1181870667 22:25896389-25896411 GAGACAGGAGACAAGGCTCTGGG - Intronic
1183102124 22:35590708-35590730 GCTTCAGGGGCCTAGGTTCAGGG + Intergenic
950847423 3:16028412-16028434 GACTCAGGGGAGAAAGTTCCAGG + Intergenic
952390498 3:32875370-32875392 GATCCAGGTGACAAGGTTTTAGG + Intronic
952516344 3:34108059-34108081 GACTAAGGGTACTAGGTTCTGGG + Intergenic
953879613 3:46684840-46684862 GCTTCAGGGGACACAGGTCTAGG + Intronic
955114969 3:55988995-55989017 GATTCAGAGGGGAAGTTTCTTGG - Intronic
957297417 3:78350765-78350787 ATTTCAGGGGAAAAGGGTCTGGG + Intergenic
959476450 3:106818113-106818135 GAAGTAGGGGAGAAGGTTCTTGG + Intergenic
961999234 3:131277717-131277739 GATGCAGGGGGCAAGCTGCTGGG + Intronic
962102870 3:132360881-132360903 GATTGAAGGCACAAGGTTCTAGG - Intronic
962878463 3:139554021-139554043 AATTTTGGAGACAAGGTTCTGGG + Intergenic
963791451 3:149586936-149586958 GATACATAGGACAAGGTACTTGG - Intronic
965508207 3:169539565-169539587 TATTTAGGGTACAAAGTTCTTGG - Intronic
971013351 4:22463051-22463073 GCTTCAGTAGACAAGGTTGTAGG - Intronic
973837164 4:54821618-54821640 GATTGGGGGTACAAGCTTCTGGG + Intergenic
973954789 4:56051633-56051655 GATTCAGGGGAGAAAGCTCTGGG - Intergenic
975204607 4:71630316-71630338 GACTCAGGGGAAAACGTTGTGGG + Intergenic
976261592 4:83150476-83150498 GATTCTGGAGAAGAGGTTCTGGG - Intergenic
983037987 4:162890924-162890946 GCTTCAGGGGAAAAGGGTCAGGG + Intergenic
985784133 5:1885444-1885466 GATTCAGAGGCCAGGTTTCTGGG - Intronic
991122414 5:63031820-63031842 GATTCAGGGGACAGAGTTATAGG + Intergenic
991173136 5:63652215-63652237 GATTCTGGGGACAGGTTTTTTGG + Intergenic
994009473 5:94884375-94884397 GAGTCAAGGAACAAGGTTATGGG - Intronic
994652190 5:102543009-102543031 GCTTCAGGGGAGAAGGATGTGGG - Intergenic
995609264 5:113891643-113891665 GAATCAAGGGAAAATGTTCTGGG - Intergenic
998029050 5:138848010-138848032 GATTCAGGGGTCTTGCTTCTTGG + Intronic
1000148220 5:158473715-158473737 GAATCAGGGTACAAGGAACTAGG + Intergenic
1000932650 5:167270676-167270698 GATTGAAGGAACTAGGTTCTTGG + Intergenic
1001316461 5:170644453-170644475 GATTGAGGGGAGAAGGGGCTGGG + Intronic
1002940194 6:1709033-1709055 GAGTCAGTGTACACGGTTCTCGG - Intronic
1004718474 6:18242609-18242631 GACTAATGGGCCAAGGTTCTGGG - Intronic
1006935231 6:37712568-37712590 AAAGCAGGGGCCAAGGTTCTGGG - Intergenic
1015380017 6:132556430-132556452 GACTCAGGGGAGAAGGTTGGGGG - Intergenic
1016489650 6:144583341-144583363 GATACAGGGGGTTAGGTTCTAGG - Intronic
1021718032 7:23478216-23478238 GAGTCAAGGGACAAAATTCTAGG - Intergenic
1024949156 7:54840116-54840138 GTTTCAGGGAACAAGGGCCTTGG - Intergenic
1029307817 7:99633823-99633845 GATTCAGGAGCCAAGGTCCAGGG - Intergenic
1030731315 7:112992913-112992935 GTTTCAGTGGACAATGTTATTGG - Intergenic
1031814383 7:126414923-126414945 AATTCATGGGAAAAGTTTCTTGG + Intergenic
1033121498 7:138670481-138670503 GAGTCAGGGGTCATGGGTCTGGG - Intronic
1037320334 8:17635288-17635310 GATTCAGGGGAAAGGGTTGGGGG - Intronic
1037728252 8:21501905-21501927 GATGCAGGGCACAAGGTTTCTGG - Intergenic
1041525674 8:58802721-58802743 CATTCAGGAGACAAGTTTCATGG - Intergenic
1046219018 8:111188769-111188791 GATTCAGGGTACAGAGATCTAGG + Intergenic
1046271446 8:111902611-111902633 CATCCAAAGGACAAGGTTCTTGG - Intergenic
1050459817 9:5868050-5868072 GGTTGAGGAGCCAAGGTTCTTGG - Intergenic
1050700451 9:8332749-8332771 GAGTCAGGGGAGAAGGTTGATGG - Intronic
1054455409 9:65427784-65427806 CATTGAGGGGCCAAGGGTCTTGG - Intergenic
1056099546 9:83287603-83287625 GTTTCAGGGAAGAGGGTTCTGGG - Intronic
1059516693 9:114902599-114902621 GAATATGGGGACAAGGTTCAGGG - Intronic
1061019011 9:128001919-128001941 GATTCAGGGGAAAAGGCTGTTGG - Intergenic
1061929729 9:133826328-133826350 GATTCTGGGGCCAGGGCTCTGGG - Intronic
1062011969 9:134272284-134272306 AAATGAGGGGACAAGGTCCTGGG + Intergenic
1203794529 EBV:169567-169589 GATTCAGGCGAAAAGGGTGTGGG + Intergenic
1187293516 X:17977456-17977478 GATTTAGAGGACATGGTTGTTGG - Intergenic
1189020568 X:37333617-37333639 GATTCAGAGGACAGAGTTCCGGG - Intergenic
1189692468 X:43631723-43631745 GATGTAGGGGCCAAGGTCCTTGG + Intergenic
1190374626 X:49776718-49776740 GATTCCTGGGTCAAGATTCTGGG - Intergenic
1191853960 X:65607777-65607799 GAGGCAGGGGACATGGTTCTGGG + Intronic
1193741192 X:85219734-85219756 GAGTCAGGGGCCCAGGTTATGGG - Intergenic