ID: 1091811884

View in Genome Browser
Species Human (GRCh38)
Location 12:3406212-3406234
Sequence ATTCAGGGGACAAGGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811874_1091811884 5 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811884 12:3406212-3406234 ATTCAGGGGACAAGGTTCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 198
1091811872_1091811884 7 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811884 12:3406212-3406234 ATTCAGGGGACAAGGTTCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 198
1091811873_1091811884 6 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811884 12:3406212-3406234 ATTCAGGGGACAAGGTTCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 198
1091811877_1091811884 -3 Left 1091811877 12:3406192-3406214 CCAAGGATGGAGCAGCTGGGATT 0: 1
1: 0
2: 13
3: 150
4: 669
Right 1091811884 12:3406212-3406234 ATTCAGGGGACAAGGTTCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811884 Original CRISPR ATTCAGGGGACAAGGTTCTG GGG Intronic
901554133 1:10018302-10018324 ATGCATGGGACAAGGTTTAGTGG + Intergenic
903807088 1:26013276-26013298 ATTCCTGGGACAGGGGTCTGGGG - Intergenic
903807099 1:26013309-26013331 ATTCCTGGGACAGGGGTCTGGGG - Intergenic
904939930 1:34158510-34158532 AGTGAGGGGACCAGGTTCTAAGG + Intronic
905105427 1:35560898-35560920 ATTCAGGGGGCACGGTTGTCGGG - Exonic
907045291 1:51296838-51296860 ATTTAGTGGGCAAGGTGCTGGGG - Intronic
907263025 1:53236297-53236319 ATACAGTGGACAAGGTGATGTGG + Intronic
908094335 1:60721389-60721411 ATGCAGGGAACAATGTTCTGAGG - Intergenic
909209079 1:72799686-72799708 ATTCAGGGAAAAAGGTGATGAGG - Intergenic
909532099 1:76692938-76692960 ATGCAGGGAGCAATGTTCTGAGG + Intergenic
912913360 1:113786338-113786360 ATTCTGGGGATTAGGTTCTAGGG - Intronic
915342323 1:155183474-155183496 ATGCTGGGGAGATGGTTCTGAGG - Intronic
917899064 1:179523860-179523882 ATTCAGGGGAAAAGGGTGGGAGG - Intronic
918466641 1:184827508-184827530 ATTCAGTGGATACTGTTCTGAGG - Intronic
920242890 1:204566486-204566508 ATTCAGGGAAACAGCTTCTGAGG - Intergenic
921607575 1:217173672-217173694 ATACAGGGGGCAGGGTTCTTGGG - Intergenic
922585395 1:226730558-226730580 CCTCAGGGTAGAAGGTTCTGTGG - Intronic
924197523 1:241623894-241623916 ATTCAGCGGATGAGGTACTGTGG - Intronic
1063586383 10:7356742-7356764 CTTCCGGGTACAGGGTTCTGTGG - Intronic
1066075200 10:31868425-31868447 TTTGAGGGGACAAGGATGTGGGG + Intronic
1066109261 10:32181887-32181909 AATCAGGAGACAAGGTGCTGGGG - Intergenic
1066414158 10:35204035-35204057 ATCCAGGGAAGAAGGTTATGGGG - Intronic
1069154673 10:65012773-65012795 ATGCAGGGGTCACGGTTGTGGGG - Intergenic
1070354054 10:75621768-75621790 ATTGAGGGGACACTGCTCTGAGG + Intronic
1072308694 10:94133380-94133402 ATGCAGTGTACAAGTTTCTGAGG - Intronic
1074470348 10:113721299-113721321 ATTCAGGGGAAAGGGTTATGCGG + Intronic
1074939173 10:118218050-118218072 ATGGAAGGGACAAGGTTCTCTGG + Intergenic
1075339909 10:121638584-121638606 AGTCAGGGGACAAGGAAATGGGG + Intergenic
1076590692 10:131580197-131580219 ATCCAGGGGAAAGGGCTCTGGGG - Intergenic
1076750240 10:132538599-132538621 ATTCCAGGGCCAGGGTTCTGAGG - Intronic
1076851321 10:133094794-133094816 ATCCTGGGGACAAGAATCTGGGG + Intronic
1084323980 11:68388533-68388555 GCTCAGGGGTGAAGGTTCTGAGG - Intronic
1085737289 11:79049904-79049926 GTTCATGGGACAAAGTTCGGAGG - Intronic
1087675596 11:101158077-101158099 ATTCAGGGCACCATGTCCTGAGG - Intergenic
1089157323 11:116412458-116412480 AGTCACGAGACAAGGTGCTGGGG - Intergenic
1090513668 11:127401689-127401711 ATTCAGGTGAAAAGGCTGTGTGG + Intergenic
1091811884 12:3406212-3406234 ATTCAGGGGACAAGGTTCTGGGG + Intronic
1095956057 12:47806891-47806913 ATTCAGGAGAAAATGGTCTGTGG - Intronic
1096622207 12:52871981-52872003 GTTCCGGGGACTAGATTCTGGGG - Intergenic
1098103526 12:67044271-67044293 ATTTAGGGGAAAAAGTTCTTGGG - Intergenic
1098713654 12:73801250-73801272 ATGCAGGGCACCAGGTCCTGAGG - Intergenic
1099932627 12:89091521-89091543 ATGCAGGGGACCATGTTCTGAGG - Intergenic
1103578222 12:121894656-121894678 CTTCAGAGGAGAAGGGTCTGGGG + Intronic
1103593490 12:122008867-122008889 AGTGAGGGGACCAGGTGCTGTGG - Intergenic
1103888266 12:124219241-124219263 ATTGAGGGAACAGTGTTCTGTGG - Intronic
1104317697 12:127719588-127719610 TTTCATGGGAAAAGGTTCTGGGG + Intergenic
1105258036 13:18757850-18757872 ATTCAGAGCACAAGGGTATGAGG + Intergenic
1107105382 13:36637145-36637167 ATGCAGGGAACAATGTCCTGAGG + Intergenic
1107119848 13:36784667-36784689 TGTCAGGGAACAAGGTGCTGTGG + Intergenic
1109502429 13:63255419-63255441 ATTCAGGGTACACTGGTCTGAGG + Intergenic
1109513041 13:63404420-63404442 ATTCAGGGCACAAAGTTCCTAGG + Intergenic
1113634362 13:111909711-111909733 ACTCAGGCCACAAGGTTCTTAGG + Intergenic
1115932163 14:38508964-38508986 ATGCAGGGCACCAGGTCCTGAGG + Intergenic
1117230537 14:53712899-53712921 ATTCAGGGGAAAGGGTTGGGGGG - Intergenic
1117444676 14:55792289-55792311 AGTCAAGAGACAAGGTGCTGGGG - Intergenic
1120127732 14:80765841-80765863 AGTCAGGGGATCAGGTTATGGGG - Intronic
1120443282 14:84564239-84564261 ATACAGGGCACCATGTTCTGAGG - Intergenic
1121338038 14:93089127-93089149 CTCCTGGGGTCAAGGTTCTGAGG - Intronic
1121439165 14:93937968-93937990 GTTGAGGGGACATGGTTCAGGGG - Intronic
1121974794 14:98393262-98393284 ATTCAGGAGAGAACTTTCTGGGG + Intergenic
1122107648 14:99470620-99470642 ATTCAGGGTACAGGGGACTGAGG - Intronic
1126184069 15:45813805-45813827 ATTCGGGGGAAAAGGGTCGGGGG - Intergenic
1131410268 15:92201491-92201513 ATTCTGGGTACACGGTTGTGTGG - Intergenic
1131666390 15:94575866-94575888 ATACAGGGGAGAGGGTCCTGTGG + Intergenic
1131846420 15:96494427-96494449 ATTCAAGGCACAAGATTCTTTGG - Intergenic
1133914699 16:10098799-10098821 ATTCAGGGGAAAGGGTGGTGAGG + Intronic
1134481198 16:14620707-14620729 ATTCAAGGGTAAATGTTCTGAGG + Intronic
1134678272 16:16105540-16105562 TTTCAGGGGACACAGTTCTGGGG + Intronic
1135148305 16:19982943-19982965 ATTCAGGGGAGAAGGGTGAGGGG + Intergenic
1135481439 16:22823908-22823930 ATTCAGGGAACCTGGTTCTTGGG - Intronic
1139446546 16:67001746-67001768 GTTCAGGGGATAGAGTTCTGGGG - Intronic
1141310389 16:82908204-82908226 ATTCATGGGACAATATCCTGTGG - Intronic
1144951041 17:18993596-18993618 CTTCAGGGCTCCAGGTTCTGGGG - Intronic
1145211101 17:21013725-21013747 ATTCATGGGACAAAATTCAGAGG + Intronic
1145903400 17:28502223-28502245 ATTCAGGGGCCAAGGGTCTCAGG - Intronic
1146503768 17:33386851-33386873 ATGCAAAGGCCAAGGTTCTGAGG - Intronic
1148137117 17:45300662-45300684 ATAGAGGAGACAAGGTGCTGTGG - Intronic
1153008782 18:519247-519269 ATTCGGGGGCCCAGGCTCTGGGG - Intergenic
1154432131 18:14316424-14316446 ATCCAGGGCACAAGGGTATGAGG - Intergenic
1157465293 18:47938789-47938811 ATAAAGGGGGCCAGGTTCTGGGG + Intergenic
1158125946 18:54099919-54099941 AGTCAGGGGAGAGGGTACTGGGG + Intergenic
1158229263 18:55235110-55235132 TTTCAGGGGATAAGATTCTCAGG + Intronic
1159578754 18:70210786-70210808 ATTCATAGGACAAAGTTATGGGG - Intergenic
1163611724 19:18305201-18305223 ATTCAGGGTCCCAGGTGCTGGGG - Intergenic
1166587263 19:43960640-43960662 ATTCAGGGCACAATGTCTTGAGG - Intronic
926949510 2:18226701-18226723 ATGCAGGGCACCAAGTTCTGAGG - Intronic
929569324 2:43010208-43010230 ATTTGGGAGACAAGTTTCTGGGG - Intergenic
930443398 2:51437947-51437969 ATTCAGGGGACAGGGTAGTAGGG + Intergenic
933165321 2:79069049-79069071 ATTGTGGGGACAAAGTTCAGAGG - Intergenic
934493611 2:94779314-94779336 ATCCAGGGCACAAGGGTGTGAGG + Intergenic
935553337 2:104481141-104481163 TTTCAGGGGGTGAGGTTCTGGGG + Intergenic
943144972 2:184031816-184031838 ATTCATTGGAAAAGTTTCTGTGG + Intergenic
943448546 2:188019869-188019891 ATGCAGGGCACCAAGTTCTGAGG - Intergenic
944327343 2:198422085-198422107 ATACAGGGAAAAATGTTCTGAGG + Intronic
944480842 2:200155760-200155782 ATTTGGGGGAAAAGATTCTGAGG + Intergenic
947615638 2:231555199-231555221 AAGCAGGGGACAAGGTCCTCTGG + Intergenic
948009103 2:234636559-234636581 ATGCAGGGTACCAGGTTCAGAGG - Intergenic
1169699225 20:8428027-8428049 AATCAGGGAAGAAGGTTGTGGGG - Intronic
1169969717 20:11256372-11256394 ACTCAGGGGAAAGGGTTGTGTGG - Intergenic
1170378915 20:15734590-15734612 TTTCAGGGAACAAAGTGCTGTGG - Intronic
1172531755 20:35635888-35635910 ATGCAGGGGCCAGGGTGCTGTGG - Intronic
1173140585 20:40478441-40478463 ATTCAGGGGAACAGGATCTCTGG + Intergenic
1173795941 20:45859936-45859958 ATTCAGGGAAATAGGTGCTGCGG + Intronic
1176241651 20:64078359-64078381 TTTCAGGGGTCAAGTTTCTAGGG + Intronic
1176844030 21:13862879-13862901 ATTCAGAGCACAAGGGTATGAGG + Intergenic
1177083491 21:16672380-16672402 ATTCAGGGAACATTGTTCTCAGG + Intergenic
1183554919 22:38517787-38517809 ATTCAGGGAAGCAGCTTCTGTGG + Intergenic
1184355670 22:43978016-43978038 ATTCAGGAGCTAAGATTCTGTGG - Intronic
1185183442 22:49377904-49377926 TTTCTGGGGACAATGTCCTGAGG + Intergenic
951129102 3:19020289-19020311 ATTCAGAGGTCAGGATTCTGGGG + Intergenic
951592013 3:24276644-24276666 AGGCAGGGGACTAGGTCCTGAGG + Intronic
952354649 3:32572718-32572740 ATTGAGGGGAAAATGCTCTGAGG - Intergenic
952502816 3:33979783-33979805 AATCAGGGGACAAGGTAGGGGGG + Intergenic
954159597 3:48711294-48711316 ATCCAGGATACAAGGTCCTGGGG - Intronic
957059264 3:75468797-75468819 ATTCTGGGGAGAAGGATTTGGGG - Intergenic
958024752 3:88037725-88037747 ATTCAGGGGAGAAGATTGGGAGG - Intergenic
960365504 3:116766700-116766722 ATTCATGGGCTAAGGATCTGTGG + Intronic
961609182 3:128123301-128123323 ATTAAGGGGACGGGGTTGTGTGG + Intronic
962878464 3:139554022-139554044 ATTTTGGAGACAAGGTTCTGGGG + Intergenic
963121112 3:141777967-141777989 ATTCAGGGTACAGGGCTATGTGG + Intergenic
966019051 3:175184261-175184283 ATTAAAGGGAAAAAGTTCTGAGG - Intronic
966456209 3:180118644-180118666 AATAAGGGAACAAGGTTCAGAGG - Intergenic
966593357 3:181704524-181704546 ATGAAGGGGAAAAGGGTCTGAGG - Intergenic
966851660 3:184168623-184168645 AGTCAGGAGACAGGGCTCTGAGG - Intronic
967017137 3:185492650-185492672 ATTCTGGGTACTTGGTTCTGGGG + Intronic
967824788 3:193869541-193869563 ATTCAGGGGACTAGGAGCAGAGG + Intergenic
968350712 3:198049721-198049743 ATCCAGGGCACAAGGGTGTGAGG + Intergenic
968892891 4:3380731-3380753 ATTCAGGGCACCATGTCCTGAGG + Intronic
969707132 4:8818101-8818123 AGCAATGGGACAAGGTTCTGGGG + Intergenic
972623762 4:40775676-40775698 ATTTAGGTGACAAGGTAATGGGG + Intronic
972839438 4:42913820-42913842 ATGCAGGGCACAATGTCCTGAGG - Intronic
973979535 4:56296545-56296567 ATGCAGTGGGCAAGGTCCTGGGG - Intronic
977989263 4:103421067-103421089 ATGCAGGGCACCAAGTTCTGAGG + Intergenic
979568758 4:122190009-122190031 ATTAATGGGAGAAGGTTTTGTGG + Exonic
980509913 4:133771937-133771959 ATTCAGGGCACAAAGTTCCTAGG + Intergenic
982669591 4:158304532-158304554 ACTGAGAAGACAAGGTTCTGTGG - Intergenic
982805227 4:159755031-159755053 ATACAGGGCACCATGTTCTGAGG - Intergenic
983037988 4:162890925-162890947 CTTCAGGGGAAAAGGGTCAGGGG + Intergenic
984040973 4:174733508-174733530 ATAGAGGGGGGAAGGTTCTGAGG - Intronic
985999047 5:3615837-3615859 CTTCTGGTGACAAGGCTCTGTGG + Intergenic
989975288 5:50578514-50578536 AATCAAGAGACAAGGTTTTGGGG - Intergenic
990393885 5:55355845-55355867 AGTCAGGGAAGAAGGCTCTGTGG + Intronic
991122415 5:63031821-63031843 ATTCAGGGGACAGAGTTATAGGG + Intergenic
992210019 5:74469575-74469597 ATTTAGGGGACAAGCATCCGAGG - Intergenic
993164682 5:84337188-84337210 TTTAAGGAGACAAAGTTCTGAGG - Intronic
995758598 5:115540008-115540030 ATTCACTGGAAATGGTTCTGAGG - Intronic
997162842 5:131627079-131627101 ATTCAGGGGACAAAGTTTAGTGG + Intronic
999143931 5:149380502-149380524 ATTCAGGCCACAAGTTTGTGAGG + Intronic
999640894 5:153672191-153672213 ATGCAGGGGAGAGGATTCTGGGG + Intronic
1000621508 5:163492017-163492039 ATTCTGGGGACAAGGTGGTGTGG - Intergenic
1008704118 6:54137350-54137372 ATGCAGGGGAAAAGGGTCTTTGG - Exonic
1010034199 6:71303029-71303051 ATTCAGGGGTCCAGCATCTGTGG + Exonic
1010322174 6:74524714-74524736 ATACAGGGGAAAGGATTCTGTGG + Intergenic
1010458227 6:76083053-76083075 ACTCAGGGCACCAAGTTCTGAGG + Intergenic
1012148273 6:95713777-95713799 ATTCAGGGAACCAAGTTCAGTGG - Intergenic
1012756638 6:103240303-103240325 ATTCAGGGCACCAGGTTCCTAGG - Intergenic
1014469967 6:121801703-121801725 ATACAGGGCACCATGTTCTGAGG - Intergenic
1015110740 6:129588979-129589001 ATTCAGGGCACCATGTCCTGAGG + Intronic
1015380016 6:132556429-132556451 ACTCAGGGGAGAAGGTTGGGGGG - Intergenic
1016414808 6:143821050-143821072 ATGCAGGGAACAATGTCCTGAGG + Intronic
1016540558 6:145159471-145159493 ATGCAGGGCACCAGGTCCTGAGG - Intergenic
1018402315 6:163436474-163436496 ATTCAGGGAACAACTTACTGAGG + Intronic
1020388286 7:7631751-7631773 ATGCAGGGCACCAAGTTCTGAGG - Intergenic
1020854558 7:13401533-13401555 ATTCAGGGGACAAAATTCTCTGG + Intergenic
1021917098 7:25444581-25444603 ATTCATGGGAGAAGTGTCTGTGG + Intergenic
1029307816 7:99633822-99633844 ATTCAGGAGCCAAGGTCCAGGGG - Intergenic
1029464545 7:100716945-100716967 ATGCAGGGGAGCAGGGTCTGAGG + Intergenic
1029939479 7:104464699-104464721 ATGCAGGGCACCAAGTTCTGAGG + Intronic
1031686998 7:124742950-124742972 ACTGGGGGGAAAAGGTTCTGAGG - Intergenic
1034746069 7:153524853-153524875 ACTCAGGGGCCATGTTTCTGGGG + Intergenic
1034916569 7:155044760-155044782 AGTCAAGAGACAAGGTGCTGGGG - Intergenic
1037320333 8:17635287-17635309 ATTCAGGGGAAAGGGTTGGGGGG - Intronic
1040878954 8:52183215-52183237 AATCAGTGGGCAAGGTCCTGTGG - Intronic
1041137310 8:54774137-54774159 ATTCAGGGTACAATTTCCTGTGG + Intergenic
1042407577 8:68422977-68422999 ATTCAGGGCACCATGTCCTGAGG + Intronic
1042832612 8:73048447-73048469 ATTCAGGGGCCAGGGCTCAGTGG - Intergenic
1043801372 8:84614860-84614882 ATTCTGGGGAAACTGTTCTGTGG - Intronic
1044064931 8:87687748-87687770 ATTCAGGGGACAGGTTTTAGGGG + Intergenic
1046508959 8:115174106-115174128 ATACAAGTGACAAGGTACTGGGG + Intergenic
1046758012 8:117991437-117991459 ATTCAGGGGAGAGGGTCCAGTGG - Intronic
1048668372 8:136689701-136689723 ATTCAGGGCACAAAGTTCTGAGG + Intergenic
1049216917 8:141412520-141412542 ATCCAGGGGACAGGGCCCTGAGG - Intronic
1049703310 8:144024596-144024618 CTTCAGGAGAGAGGGTTCTGAGG - Intronic
1050669804 9:7983105-7983127 ACGCAGGGGAAGAGGTTCTGAGG + Intergenic
1052518211 9:29510421-29510443 ATTCAGGGCACCACGTTCAGAGG + Intergenic
1052915396 9:33921404-33921426 ATCCAGTGGACAGGGCTCTGTGG + Intergenic
1052945599 9:34165819-34165841 ATTCATGGGACTGGATTCTGAGG - Intergenic
1054455408 9:65427783-65427805 ATTGAGGGGCCAAGGGTCTTGGG - Intergenic
1055776333 9:79770358-79770380 ATTCATGGGACAAGGTTTTGAGG + Intergenic
1056099545 9:83287602-83287624 TTTCAGGGAAGAGGGTTCTGGGG - Intronic
1057677172 9:97144940-97144962 ATCCAGGGCACAAGGGTGTGAGG + Intergenic
1058722091 9:107773382-107773404 ATACAGGGCACTATGTTCTGAGG + Intergenic
1058825864 9:108775298-108775320 AGTCAGGGGACACGGGGCTGAGG + Intergenic
1060552185 9:124490917-124490939 ATTCAGTGAACAAAGGTCTGAGG - Intronic
1060573975 9:124671940-124671962 CTGGAGGGCACAAGGTTCTGAGG - Intronic
1060882676 9:127129402-127129424 AAACAGGAGACAAGGTACTGAGG + Intronic
1061960598 9:133987060-133987082 AATGAAGGCACAAGGTTCTGAGG + Intronic
1062011970 9:134272285-134272307 AATGAGGGGACAAGGTCCTGGGG + Intergenic
1186653786 X:11590961-11590983 ATTCAGGGGGCCAGGCTCAGTGG + Intronic
1187549716 X:20290102-20290124 AGTCAGTGGACCAGGCTCTGGGG - Intergenic
1187621478 X:21061141-21061163 CTTCAGGGCCCAAGCTTCTGGGG - Intergenic
1187761441 X:22590395-22590417 ATTCAGGTGCCACGGTTCAGTGG + Intergenic
1188022455 X:25173761-25173783 ATTCAGAGCACCAGGCTCTGAGG + Intergenic
1188142705 X:26571796-26571818 ATTCAGGTTAAAAGGTTGTGTGG + Intergenic
1190374625 X:49776717-49776739 ATTCCTGGGTCAAGATTCTGGGG - Intergenic
1190619721 X:52273655-52273677 ATGCATGGCCCAAGGTTCTGGGG + Intergenic
1191853961 X:65607778-65607800 AGGCAGGGGACATGGTTCTGGGG + Intronic
1191899987 X:66030981-66031003 ACTCAGGGGACAAGGTTGGGTGG + Intronic
1192848871 X:74932585-74932607 ATTCAGGGTAGAAGCTTCTTAGG - Intergenic
1194599828 X:95906496-95906518 AATCAGGGCACAATTTTCTGAGG + Intergenic
1195608384 X:106835345-106835367 ATGCAGGGGACCATGTCCTGAGG + Intronic
1197040780 X:121932792-121932814 ATGCAGGGCACAAAGTCCTGAGG + Intergenic
1197556343 X:127959682-127959704 ATTCAGGGGATAAGGGTGGGAGG - Intergenic
1198202428 X:134435405-134435427 ATTCAGGGGGCCAGGTGCGGTGG + Intergenic
1198747488 X:139905039-139905061 ATTCAGGGGACCACAATCTGTGG + Intronic