ID: 1091811885

View in Genome Browser
Species Human (GRCh38)
Location 12:3406226-3406248
Sequence GTTCTGGGGCTACACACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 12, 3: 62, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811872_1091811885 21 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811885 12:3406226-3406248 GTTCTGGGGCTACACACAGCAGG 0: 1
1: 0
2: 12
3: 62
4: 318
1091811877_1091811885 11 Left 1091811877 12:3406192-3406214 CCAAGGATGGAGCAGCTGGGATT 0: 1
1: 0
2: 13
3: 150
4: 669
Right 1091811885 12:3406226-3406248 GTTCTGGGGCTACACACAGCAGG 0: 1
1: 0
2: 12
3: 62
4: 318
1091811873_1091811885 20 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811885 12:3406226-3406248 GTTCTGGGGCTACACACAGCAGG 0: 1
1: 0
2: 12
3: 62
4: 318
1091811874_1091811885 19 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811885 12:3406226-3406248 GTTCTGGGGCTACACACAGCAGG 0: 1
1: 0
2: 12
3: 62
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811885 Original CRISPR GTTCTGGGGCTACACACAGC AGG Intronic
900578343 1:3395237-3395259 GGTCTGTGGCTGGACACAGCTGG - Intronic
902718775 1:18290687-18290709 GTACTGGCCCTAGACACAGCTGG - Intronic
902976390 1:20091602-20091624 GTTCTAGGATTTCACACAGCAGG + Intergenic
903184156 1:21619971-21619993 GTTCTGGGGAGCCACAGAGCTGG - Intronic
903809131 1:26024905-26024927 GTTAGGGAGCTGCACACAGCAGG + Intronic
904213699 1:28902949-28902971 GTTCTGGACTCACACACAGCTGG + Intronic
906938433 1:50234930-50234952 GTCCTGAGGCTGCACAAAGCAGG - Intergenic
907798623 1:57742467-57742489 GGTTTGGGGCTCAACACAGCAGG - Intronic
907862963 1:58371702-58371724 GTCCTGAGGCTTCACAGAGCAGG - Intronic
908006892 1:59736967-59736989 GTCTTGAGGCTGCACACAGCAGG - Intronic
908963544 1:69730095-69730117 GTCCTGAAGCTGCACACAGCAGG + Intronic
909269202 1:73601141-73601163 GTCCTGAGGCTACACACAGCAGG + Intergenic
912043032 1:105416534-105416556 GTTCCTAGGCTACACAGAGCAGG - Intergenic
912094689 1:106123839-106123861 CATCTGGGGCTACAAAAAGCTGG + Intergenic
915465297 1:156094061-156094083 GGTCTGGGGCCGTACACAGCAGG + Intronic
915606056 1:156951631-156951653 GTTCTGGGGCATCATACTGCTGG + Exonic
916126439 1:161575622-161575644 TCTCTGGGGCAACACACAGAAGG - Intergenic
916136358 1:161657462-161657484 TCTCTGGGGCAACACACAGAAGG - Intronic
917140160 1:171827394-171827416 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
917245533 1:172996792-172996814 GTTCCTAGGCTGCACACAGCAGG - Intergenic
917966194 1:180180080-180180102 GTTCTGGAGCCACACTAAGCTGG + Intronic
918180417 1:182082132-182082154 GTTCTAGGGCTAAACACAGAAGG - Intergenic
918591529 1:186246096-186246118 GTCCTGAGGCTGCACACAGCAGG + Intergenic
922643445 1:227260421-227260443 GATCTTGGGCTACACAGAGTAGG - Intronic
923712689 1:236399831-236399853 GTTCTGAGACTCCACACCGCAGG + Intronic
924495599 1:244585637-244585659 GTTCTGTGTCTACACAGAGCTGG - Intronic
1064014227 10:11760370-11760392 GTTCTGCAGCTACACACTGCCGG + Intronic
1064960506 10:20958720-20958742 GTTCTGTGGCTACACTAAGTGGG + Intronic
1066154248 10:32657575-32657597 GTCCTGAGGCTGCACAGAGCAGG + Intronic
1067559011 10:47291586-47291608 GCTCTGGGTCCACTCACAGCTGG + Intergenic
1068215605 10:53978445-53978467 GTCCTGAGGCTATACACAGCAGG + Intronic
1070011946 10:72483802-72483824 GTACTGGGGCTGTGCACAGCAGG - Intronic
1071244882 10:83751766-83751788 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1073575785 10:104622164-104622186 GTCCTTTGGCTACAGACAGCAGG - Intergenic
1077195387 11:1277226-1277248 ATGCCGGGGCTACAGACAGCGGG + Exonic
1077444608 11:2585145-2585167 GTCCTGAGGCTGCACCCAGCTGG + Intronic
1077979588 11:7286383-7286405 GTCCTGAGGCTGCACACAGCAGG + Intronic
1078386140 11:10894642-10894664 TTTCTGGGGCTGCTCACAGTAGG + Intergenic
1078834869 11:15017556-15017578 GTACTGAGGTTTCACACAGCAGG - Intronic
1080746023 11:35109439-35109461 GTCCTGGGGCTACATAGAGCAGG - Intergenic
1082119040 11:48358045-48358067 GTTCTGAGGCGGCACACAGCAGG + Intergenic
1082255252 11:50027102-50027124 GTTCTGAGGCTGCACACAGCAGG - Intergenic
1082685241 11:56230078-56230100 GTTCTGGAGCTAGACAGAGGTGG + Intergenic
1082948021 11:58780717-58780739 GTTCCAAGGCTGCACACAGCAGG + Intergenic
1083316370 11:61816975-61816997 GGTCTTGGGCAACTCACAGCTGG + Exonic
1085380347 11:76111416-76111438 GTTATTGGGCTACACAGAGTGGG - Intronic
1086084916 11:82944358-82944380 GTTCCTAGGCTGCACACAGCAGG + Intronic
1086503637 11:87479400-87479422 GTCCTAAGGCTGCACACAGCAGG - Intergenic
1086936129 11:92747395-92747417 GTCCTGAGGCTGCACAGAGCAGG + Intronic
1088447734 11:109950215-109950237 GTCCAGAGGCTCCACACAGCAGG + Intergenic
1088581562 11:111321339-111321361 GTTCTGGAGCCACACAGACCTGG + Intergenic
1089174327 11:116537401-116537423 GTTCTGGGGCTACAGAAGGCTGG - Intergenic
1090625983 11:128609305-128609327 TTTCTGGGGCTACATCCAGCTGG - Intergenic
1091811885 12:3406226-3406248 GTTCTGGGGCTACACACAGCAGG + Intronic
1093604992 12:21078446-21078468 GTTTCTGGGCTACACACAGCAGG + Intronic
1094282495 12:28755170-28755192 GTCCTTGGGCTGCACACAGCAGG + Intergenic
1094421189 12:30272932-30272954 GTCCTGAGGCTACATAGAGCAGG + Intergenic
1095640900 12:44483764-44483786 GTTCTGAGGCTGCACACAGCAGG + Intergenic
1095689301 12:45069295-45069317 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1097377988 12:58860987-58861009 GTTCTGATGCTGCAGACAGCAGG + Intergenic
1097443952 12:59646291-59646313 GTCTTGAGGCTGCACACAGCAGG - Intronic
1097551063 12:61070229-61070251 CTTCTGGGGCACCACAAAGCAGG - Intergenic
1099390186 12:82070083-82070105 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1099621253 12:85005314-85005336 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1099932625 12:89091507-89091529 GTTCTGAGGCTATACAGAGCAGG - Intergenic
1099996666 12:89786389-89786411 GTTCTGAGCCTGCACAGAGCAGG - Intergenic
1100032362 12:90208987-90209009 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1103263474 12:119609568-119609590 CGTCTGAGGCTGCACACAGCAGG - Intronic
1103264556 12:119618030-119618052 GTCCAGAGGCTGCACACAGCAGG - Intronic
1103294090 12:119871252-119871274 CTTGTGGGGCTACATTCAGCTGG - Intronic
1104808082 12:131602164-131602186 GTCCTGAGGCTGCGCACAGCAGG + Intergenic
1105257214 13:18751728-18751750 GTCCTGAGGCTGCACACAGAGGG + Intergenic
1105257700 13:18755256-18755278 GTCCTGAGGCTGCACACAGAGGG + Intergenic
1105259875 13:18771090-18771112 GTCCTGAGGCTGCACACAGAAGG + Intergenic
1105262555 13:18790413-18790435 GTCCTGAGGCTGCACACAGAAGG + Intergenic
1105573316 13:21624523-21624545 GCTCTAGTGCTACTCACAGCAGG - Intergenic
1108219234 13:48216439-48216461 GTCCTGAGGCTGCACACAGCAGG - Intergenic
1109407347 13:61919014-61919036 GTCCTTAGGCTGCACACAGCAGG + Intergenic
1109583943 13:64373775-64373797 GCTCCTAGGCTACACACAGCAGG + Intergenic
1109655719 13:65387969-65387991 GTCCTTAGGCTGCACACAGCAGG - Intergenic
1109718335 13:66245958-66245980 GTTGTGAGGCTACATAGAGCAGG - Intergenic
1110304983 13:73975913-73975935 GTTCTGTGACTGCACATAGCGGG - Intronic
1110701719 13:78556192-78556214 CTTCTGGGGTTACCAACAGCAGG - Intergenic
1111339247 13:86862421-86862443 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1111441302 13:88285566-88285588 GTCCTGAGGCTGCACACAGAAGG - Intergenic
1111606680 13:90547699-90547721 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1112259345 13:97863982-97864004 GTCCTTAGACTACACACAGCAGG + Intergenic
1113809847 13:113132580-113132602 GTTTTGGAGCTACACTCAGTGGG - Intronic
1115010570 14:28540207-28540229 GTTCCAAGGCTGCACACAGCAGG - Intergenic
1115445870 14:33488757-33488779 GTTCTGGGTGTGCACAGAGCTGG + Intronic
1115878755 14:37891731-37891753 GTTCCTAGGCTGCACACAGCAGG - Intronic
1115943044 14:38629555-38629577 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1116098932 14:40408582-40408604 GTCCTGAGGCTTCACAGAGCAGG + Intergenic
1116412236 14:44638316-44638338 GTTCTGGGACTACTCAAAACTGG - Intergenic
1117203661 14:53418397-53418419 GTTCTAAGGCTGCACTCAGCAGG - Intergenic
1118037418 14:61883052-61883074 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1119158240 14:72431190-72431212 GTTCTGCTGCTACACAGAGCAGG - Intronic
1120654186 14:87169482-87169504 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1120659058 14:87230885-87230907 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1124700831 15:31910328-31910350 GATCTGGGACTTCACACTGCTGG - Intergenic
1124706379 15:31970062-31970084 GTTCTGTGGCTGCAGAAAGCAGG - Intergenic
1126190573 15:45873838-45873860 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1126825093 15:52540583-52540605 GTCCAGAGGCTGCACACAGCAGG + Intergenic
1128983302 15:72201565-72201587 CTTCTGGGGTTTCACTCAGCTGG - Intronic
1129658559 15:77540648-77540670 TATCTGGGGCCTCACACAGCAGG - Intergenic
1131166122 15:90143404-90143426 AATCTGGGGCTGCACACAGCTGG - Intergenic
1132889747 16:2197641-2197663 GGTCTGGGGCCACACAGAGTGGG - Intergenic
1134072240 16:11267618-11267640 GTTCTTGGGCTACATACATGTGG + Intronic
1136236000 16:28914149-28914171 GTTCTGGGTCTGAACACAGGTGG + Intronic
1136615000 16:31393252-31393274 ATTCAGGGCCTCCACACAGCAGG - Intergenic
1138608506 16:58104572-58104594 GTTCTGTAGCTACACATGGCTGG - Intergenic
1138798846 16:60001736-60001758 GTCCTGAGGCTGCACACAGCAGG - Intergenic
1140146929 16:72320136-72320158 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1141313106 16:82934373-82934395 GTCCTTAGGCTGCACACAGCTGG + Intronic
1143931966 17:10438499-10438521 GTTCCAAGGCTGCACACAGCAGG + Intergenic
1146817873 17:35958602-35958624 GTGCTGGGGCAACACACAGCTGG + Intergenic
1147621966 17:41874031-41874053 GTTCTGAGAGTACACACAGCAGG - Intronic
1147744984 17:42689419-42689441 GTTCTGGGGCTTCAAGGAGCTGG + Intronic
1149339702 17:55672664-55672686 GTTCTGAGGCTGCACAGAGCAGG + Intergenic
1149582062 17:57757664-57757686 GTTCTGGGGTTCCACACAATGGG + Intergenic
1150153964 17:62835080-62835102 GTTCTTTGGCTAAAGACAGCAGG - Intergenic
1150198358 17:63325491-63325513 GTGCTAGGGCAACACACAGCTGG - Intronic
1150250946 17:63704216-63704238 AATCTGGAGCTACACACAGGAGG - Intronic
1150858857 17:68779822-68779844 GCTCTGGATCTACACACAACAGG - Intergenic
1151493575 17:74446593-74446615 GTGCTGGGGCTTCACAGAGGGGG - Intronic
1151706849 17:75773731-75773753 GTTCTGGGGATACACACAGTGGG - Intergenic
1153423008 18:4929675-4929697 ATTCAGGGGCAAAACACAGCTGG + Intergenic
1154426146 18:14273711-14273733 GTCCTGAGGCTGCACACAGAGGG - Intergenic
1154431159 18:14309640-14309662 GTCCTGAGGCTGCACACAGAGGG - Intergenic
1154433835 18:14328945-14328967 GTCCTGAGGCTGCACACAGAGGG - Intergenic
1155179915 18:23335507-23335529 GTTTTAGGGATACACACAGAGGG + Intronic
1156134392 18:34019522-34019544 CTTCAGGGGGAACACACAGCAGG - Exonic
1156169386 18:34463621-34463643 GTTCTAAGGCTGCACACAGAAGG + Intergenic
1156621566 18:38857667-38857689 GTTCTGTGGCTACATAGAGAGGG - Intergenic
1158735507 18:60075028-60075050 GTGCTGGGGGTGTACACAGCTGG - Intergenic
1159461219 18:68724177-68724199 GTCCTGAGGCTACATAGAGCTGG + Intronic
1159811783 18:73025648-73025670 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1160048750 18:75412032-75412054 GTTCTGCTGCTACACACTGAGGG + Intronic
1162323777 19:9986466-9986488 GAGCTGGGGCTAGACAGAGCAGG - Intronic
1162855607 19:13466071-13466093 GTTCTGGAGCTAGACAGAGGTGG + Intronic
1164590407 19:29503793-29503815 TCTCTGGGGCCACACGCAGCAGG + Intergenic
1168095021 19:54109562-54109584 GTTCTGTGGAGACACACAGTGGG + Intronic
925474044 2:4192815-4192837 GTCCTGAGGCTACACACAGCAGG + Intergenic
926088061 2:10032501-10032523 GCTCTGGGGCTGCACACATCTGG - Intergenic
926456545 2:13074262-13074284 GTCCTGAGGCTTCACACAGCAGG + Intergenic
926836742 2:17031696-17031718 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
927389789 2:22582326-22582348 GTCCTGTGTCTGCACACAGCAGG - Intergenic
928594244 2:32845417-32845439 GTCCTTAGGCTGCACACAGCAGG - Intergenic
930521290 2:52470703-52470725 GTCCTTAGGCTGCACACAGCAGG - Intergenic
931079421 2:58752736-58752758 GTCCTGAGACTGCACACAGCAGG - Intergenic
935323074 2:101907210-101907232 GTTCTGAGGCTGCATAGAGCAGG + Intergenic
936728965 2:115357952-115357974 GTACCGAGGCTATACACAGCAGG + Intronic
936937735 2:117854162-117854184 CTTCTGGGGCCAGTCACAGCAGG + Intergenic
937287397 2:120762060-120762082 GTTCTGGTGCCACACTCTGCTGG + Intronic
938027118 2:127959292-127959314 GTTCTTGGGCTAGACAGAGTAGG - Intronic
939784674 2:146494648-146494670 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
939830392 2:147064250-147064272 GTCCTGAGGTTGCACACAGCAGG - Intergenic
940444773 2:153764800-153764822 GTCCCTGGGCTGCACACAGCAGG - Intergenic
940691311 2:156923989-156924011 GTTCCAAGGCTGCACACAGCAGG - Intergenic
940791475 2:158033989-158034011 GCTCTGGGGCAACACAGACCCGG + Intronic
941227262 2:162865283-162865305 GTCCTGAGGCTACACACAGCAGG + Intergenic
941977708 2:171423980-171424002 GTCCTGAGGCTGCACACAGTAGG - Intronic
943620254 2:190140635-190140657 GTCCTGAGGCTGCATACAGCAGG + Intronic
945017722 2:205536848-205536870 GTTCTGGGGCTTCAAACAGAAGG + Intronic
946348473 2:219130640-219130662 ATTCTGGGGCTTTGCACAGCTGG - Intronic
946562244 2:220926422-220926444 GTACTTAGGCTGCACACAGCAGG + Intergenic
946874475 2:224114160-224114182 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
947398250 2:229707607-229707629 GCACTGGGGCTACATACAGTAGG - Intronic
947904493 2:233750631-233750653 GTCCTGAGGCTGCACACAGCAGG - Intronic
948016773 2:234697457-234697479 GTCCTGAGGCTTCACACAGCAGG + Intergenic
948592629 2:239060936-239060958 GAGCTGTGGCCACACACAGCGGG - Intronic
948595430 2:239076584-239076606 GTCCTGTGGCCACCCACAGCCGG + Intronic
948878890 2:240845729-240845751 GTTCCAAGGCTGCACACAGCAGG - Intergenic
1170810902 20:19673582-19673604 GTTCTTGGTTTACACACAGGTGG + Exonic
1171349173 20:24489971-24489993 GCTCGGGGGCCACACACAGATGG - Intronic
1173323455 20:42010279-42010301 GTCCTGGGGCTGCACACAGCAGG + Intergenic
1173763896 20:45588555-45588577 GTTGTGGGGAGACAGACAGCAGG - Intergenic
1175483422 20:59327450-59327472 GATGTGGGGCAGCACACAGCAGG + Intergenic
1175635940 20:60583585-60583607 TTTCTAGGGCCACTCACAGCAGG - Intergenic
1176103956 20:63377016-63377038 GCTCTGGGTGTAGACACAGCAGG + Intronic
1176170818 20:63695674-63695696 CACCTGGGGCTACACCCAGCAGG - Intronic
1176843202 21:13856796-13856818 GTCCTGAGGCTCCACACAGAGGG + Intergenic
1176845888 21:13876130-13876152 GTCCTGAGGCTGCACACAGAGGG + Intergenic
1176848621 21:13895673-13895695 GTCCTGAGGCTGCACACAGAGGG + Intergenic
1177359523 21:20049989-20050011 GTCCTGAGGCTGTACACAGCAGG - Intergenic
1177606003 21:23378791-23378813 GTCCTGTGGCTGCACACAGCAGG - Intergenic
1177761019 21:25402270-25402292 GTCCCTAGGCTACACACAGCAGG - Intergenic
1178046211 21:28696960-28696982 GTCCGGAGGCTGCACACAGCAGG + Intergenic
1179351359 21:40614137-40614159 GGCCTGGGGCTGCACTCAGCAGG - Intronic
1180028042 21:45179872-45179894 GCTCCAGGGCCACACACAGCTGG - Intronic
1180685722 22:17664859-17664881 GTCCAGAGGCTGCACACAGCAGG + Intronic
1180904283 22:19397691-19397713 GTGGTGGGGGTGCACACAGCAGG + Intronic
1181084669 22:20433994-20434016 GTTTTAGGGCCACACTCAGCTGG + Intronic
1181730748 22:24844664-24844686 GTTCAGGTTCTTCACACAGCAGG - Intronic
1183168463 22:36165948-36165970 GTTCTGGGGCTAAACTTAGGTGG - Intronic
1183320618 22:37163090-37163112 GCTCTGGAGCTACAGACCGCAGG + Intronic
1183847360 22:40553404-40553426 GTCCTGAGGCTGCACAGAGCAGG - Intronic
1184338852 22:43874388-43874410 GTCCTAAGGCTGCACACAGCAGG - Intergenic
1184656749 22:45945800-45945822 CTTCCTGGGCTGCACACAGCAGG - Intronic
1184745287 22:46452479-46452501 GCACTGGGGGTACACACAGCTGG + Intronic
1185192255 22:49446378-49446400 GTTCTCGGGCTGCCCTCAGCAGG + Intronic
952575799 3:34773089-34773111 GTTCCTAGGCTGCACACAGCAGG - Intergenic
952608753 3:35181755-35181777 GTCCTGAGGCTACATAGAGCAGG + Intergenic
957949501 3:87107024-87107046 GTCCTGAGGCTGCTCACAGCAGG - Intergenic
959381073 3:105641836-105641858 GTCCTTAGGCTGCACACAGCAGG + Intergenic
959476658 3:106820966-106820988 GTTCTGGAGCTGCACCCAGGAGG - Intergenic
959659353 3:108848594-108848616 GGTCTGGGGCTGCACAATGCTGG - Intronic
961372231 3:126438514-126438536 ATCCTGTGGCTCCACACAGCAGG + Intronic
962883239 3:139598948-139598970 GGTTTGGGGCTACACATAGATGG - Intronic
963297083 3:143558058-143558080 GTCCTGAGGCTGCACAGAGCAGG - Intronic
963363251 3:144303414-144303436 GTCCTTAGGCTACACACAGCAGG + Intergenic
963433755 3:145242060-145242082 GTCCTGAAGCTGCACACAGCAGG + Intergenic
965092856 3:164183844-164183866 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
965224548 3:165971879-165971901 GTCCTGAGACTACACATAGCAGG - Intergenic
965249775 3:166327938-166327960 GTTCTGAGACTGCACAGAGCTGG + Intergenic
965931123 3:174044133-174044155 GTCCTGAGACTACACACACCTGG + Intronic
966325279 3:178746369-178746391 GTTCCTAGGCTGCACACAGCTGG + Intronic
966444043 3:179980686-179980708 GATCTGGGGCCACAGACAGGTGG + Intronic
966720429 3:183057107-183057129 GTTCTGGGGGTAGACACAACAGG - Intronic
966972787 3:185060860-185060882 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
967525719 3:190490000-190490022 GTTCTGGAGTCAGACACAGCAGG + Intergenic
967622587 3:191651080-191651102 GTCCCTGGGCTTCACACAGCAGG + Intergenic
968380682 4:93277-93299 GTCCTGAGACTGCACACAGCAGG + Intergenic
969674042 4:8605170-8605192 GTCCCTGGGCCACACACAGCTGG + Intronic
971440424 4:26679253-26679275 GTCCTGAGGCTGCACAGAGCAGG - Intronic
971912359 4:32810470-32810492 GTCCTGAGGCTGCACACAGCAGG + Intergenic
972012826 4:34205930-34205952 GTCCTGAGGCTTCACAGAGCAGG - Intergenic
972051698 4:34743212-34743234 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
972268140 4:37482781-37482803 GTCCTGAGGCTGCACAGAGCAGG - Intronic
972872106 4:43312964-43312986 GTCCTTAGGCTACACACAGCAGG - Intergenic
972879495 4:43406585-43406607 GTCCTGAGGCTGCACACAGCAGG - Intergenic
974666576 4:64969707-64969729 GTCCTGAGGCTGCACATAGCAGG + Intergenic
976365779 4:84230732-84230754 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
976887425 4:90002849-90002871 CTTCTGGAACTACAGACAGCTGG - Intergenic
977435426 4:96989184-96989206 GTACTTAGGCTACACACAGCAGG - Intergenic
977707584 4:100088543-100088565 GTGCGGGAGCCACACACAGCTGG - Intergenic
977918456 4:102618883-102618905 GCTCTGGAGCTAGACAGAGCTGG - Intergenic
978920994 4:114183103-114183125 GTCCCTAGGCTACACACAGCAGG - Intergenic
980280108 4:130707669-130707691 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
980430190 4:132684122-132684144 GTCCTGAGGCTGCACACAGCAGG + Intergenic
980742772 4:136973622-136973644 GTTCTGGGGCCAAACAGAGCAGG + Intergenic
980767121 4:137321251-137321273 GTCCCCAGGCTACACACAGCAGG + Intergenic
980777845 4:137460191-137460213 GGTCTGGGGCTACACAGAACTGG - Intergenic
981200414 4:141973113-141973135 GTCCTTAGTCTACACACAGCAGG + Intergenic
982240693 4:153296558-153296580 GCTCTCCAGCTACACACAGCTGG - Intronic
983657532 4:170098365-170098387 GTCCTTAGGCTGCACACAGCAGG + Intergenic
983889457 4:173015933-173015955 GTCCTGAGGCCACACAGAGCAGG - Intronic
985276494 4:188242734-188242756 GTTCTAGGTCTGCACCCAGCTGG - Intergenic
986875243 5:12099350-12099372 GTACTCAGGCTTCACACAGCAGG - Intergenic
987169577 5:15240350-15240372 ATTCTGAGGCTGCACAGAGCAGG - Intergenic
987610649 5:20198788-20198810 GTCCCTGGGCTGCACACAGCAGG - Intronic
987659535 5:20854832-20854854 GTTCCTAGGCTGCACACAGCAGG - Intergenic
987709071 5:21486156-21486178 GTTCCTAGGCTGCACACAGCAGG + Intergenic
988345710 5:30035572-30035594 GTCCTGAGGCTGCACACAGTAGG - Intergenic
988473910 5:31565846-31565868 GTCCTGAGGCTACACAGAGCAGG + Intergenic
988750541 5:34187997-34188019 GTTCCTAGGCTGCACACAGCAGG - Intergenic
988764110 5:34350814-34350836 GTTCCTAGGCTGCACACAGCAGG + Intergenic
989132814 5:38124469-38124491 GTCCTGAGGCTGCATACAGCAGG + Intergenic
990108466 5:52293377-52293399 ATCCTGAGGCTGCACACAGCAGG + Intergenic
990143345 5:52730971-52730993 GTCCTGAGGCTGCACATAGCAGG - Intergenic
990487492 5:56273619-56273641 GTTCTGGGGCTACTGAAAGCTGG + Intergenic
990818505 5:59811663-59811685 GTTCTGAGGCTTCATGCAGCTGG - Intronic
991110009 5:62888953-62888975 GTTCTGCAGCTACTCACACCAGG - Intergenic
991735681 5:69629911-69629933 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991738806 5:69651195-69651217 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991759391 5:69905232-69905254 GTTCCTAGGCTGCACACAGCAGG + Intergenic
991787944 5:70212886-70212908 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991790381 5:70230936-70230958 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991812172 5:70485550-70485572 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991815130 5:70506027-70506049 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991818266 5:70527312-70527334 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991838619 5:70780298-70780320 GTTCCTAGGCTGCACACAGCAGG + Intergenic
991880390 5:71213250-71213272 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991882831 5:71231276-71231298 GTTCCTAGGCTGCACACAGCAGG - Intergenic
991913167 5:71581556-71581578 GATCTGGGGATACAGAAAGCTGG + Intergenic
991940839 5:71850529-71850551 GTCCTGAGGATGCACACAGCAGG + Intergenic
994421196 5:99527499-99527521 GTTCCTAGGCTGCACACAGCAGG + Intergenic
994485847 5:100386815-100386837 GTTCCTAGGCTGCACACAGCAGG - Intergenic
994590735 5:101768894-101768916 GTCCTGAGACTACACACAGCAGG - Intergenic
994590796 5:101769303-101769325 GTCCTGAGGCTGCACACAGCAGG + Intergenic
994749574 5:103721372-103721394 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
994905770 5:105839539-105839561 GTTCTGAGACTGCACAAAGCAGG + Intergenic
995389717 5:111626990-111627012 GTCCAGAGGCTGCACACAGCAGG - Intergenic
995390951 5:111639865-111639887 GTTCTGAGGCTGCACAGAGAAGG - Intergenic
995667217 5:114555394-114555416 GTTCTGAGGCTACACAGAGCAGG + Intergenic
995721622 5:115140715-115140737 GATCTGCAGCTGCACACAGCAGG - Intronic
996122925 5:119691612-119691634 GTCCAGAGGCTGCACACAGCAGG + Intergenic
996251022 5:121332025-121332047 GTCCTGAAGCTGCACACAGCAGG - Intergenic
998759063 5:145411996-145412018 GTCCTGAGGCTGCACACAGCAGG + Intergenic
1003230062 6:4243704-4243726 GTCCTGAGACTACACAGAGCTGG + Intergenic
1004142376 6:13030848-13030870 GTTCAGAGGATACAGACAGCAGG + Intronic
1005242733 6:23850987-23851009 GTTCTGAGTCTACACACAGGGGG + Intergenic
1005548613 6:26894302-26894324 GTTCCTGGGCTGCACACAGCAGG - Intergenic
1007506208 6:42337241-42337263 GCCCTCGGGCTGCACACAGCTGG - Intronic
1007599984 6:43075658-43075680 GTGCTGGGCCTCCCCACAGCTGG + Intergenic
1008337515 6:50324860-50324882 GTCCCTAGGCTACACACAGCAGG + Intergenic
1009019369 6:57935409-57935431 GTTCCTAGGCTGCACACAGCAGG - Intergenic
1009245542 6:61232272-61232294 GGTCTTGGGCAAGACACAGCAGG + Intergenic
1009631733 6:66208998-66209020 GTTCCTAGGCTGCACACAGCAGG + Intergenic
1010458229 6:76083067-76083089 GTTCTGAGGCTGCACAGAGCAGG + Intergenic
1010782775 6:79964601-79964623 GTTCTGGGGCTGAACTCAGGTGG - Intergenic
1010819401 6:80395816-80395838 GTTCTAAGGCTGCACACAGCAGG - Intergenic
1010981750 6:82376772-82376794 AGTCTGAGGCTGCACACAGCAGG + Intergenic
1012709666 6:102582707-102582729 GGTCTGGCACTGCACACAGCTGG - Intergenic
1013213704 6:108008512-108008534 GTTCTGAGGCTGCATAGAGCAGG + Intergenic
1013360420 6:109388929-109388951 GTTCTGAGGATTGACACAGCAGG - Intergenic
1014475980 6:121872528-121872550 GTTCCTAGGCTGCACACAGCAGG + Intergenic
1014562998 6:122913765-122913787 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1016187973 6:141221388-141221410 GTCCAGGGGCAGCACACAGCAGG + Intergenic
1016274035 6:142327543-142327565 GTTCTGGTGCTACACAATGAGGG - Intronic
1016540556 6:145159457-145159479 GTCCTGAGGCTGCACACAGCAGG - Intergenic
1016790247 6:148060269-148060291 GTCCTAAGGCTGCACACAGCAGG + Intergenic
1018477748 6:164159735-164159757 GTCCTGAGGCTGCACACAGTAGG + Intergenic
1019751070 7:2730184-2730206 CTTCTGGGGCTTCAGAAAGCTGG - Exonic
1020581749 7:10011602-10011624 GTTCTGAGGCTGCACAGACCAGG - Intergenic
1020729659 7:11865885-11865907 GTCTTGAGGCTGCACACAGCAGG - Intergenic
1021001765 7:15340520-15340542 GTGCTGAGGCTGCACACAGCAGG - Intronic
1021323511 7:19239990-19240012 GTCCTGAGGCTGCACATAGCAGG + Intergenic
1023521006 7:41049973-41049995 GTTTTGGGGGCACACACATCAGG + Intergenic
1024865849 7:53904477-53904499 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1028957755 7:96713027-96713049 GTCCTGAGGCTGCATACAGCAGG - Intergenic
1029389209 7:100263727-100263749 CTTCTGAGCCTGCACACAGCTGG - Intronic
1033943739 7:146688017-146688039 TTTCTGTGGCTAAAAACAGCTGG + Intronic
1034518549 7:151601117-151601139 GTCCTGGGGTTACCCACAGGGGG + Intronic
1034967323 7:155399292-155399314 GTGCTGGGTCTCCACGCAGCAGG - Intergenic
1035149928 7:156861364-156861386 GTCCTGAGGCTGCACAGAGCAGG + Intronic
1035164935 7:156981414-156981436 GTTCTGGGGAGAGACACAGGTGG + Intergenic
1035207966 7:157307104-157307126 GAGCTGTGGCTGCACACAGCTGG - Intergenic
1041847284 8:62344129-62344151 CTTCTGGGGCAACACAGTGCTGG + Intronic
1042601292 8:70502262-70502284 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1044028084 8:87198734-87198756 TTTCTGTGGCTATACACTGCAGG + Intronic
1044220466 8:89663614-89663636 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1046107410 8:109682825-109682847 GTCCTGAGGCTGAACACAGCAGG - Intronic
1046243140 8:111525903-111525925 GTCCTGGTGCCACAGACAGCAGG + Intergenic
1046309425 8:112415214-112415236 GTCCTGAGGCTGCACAGAGCAGG - Intronic
1047502908 8:125455836-125455858 GTTCTGTGGGAACACACAGGAGG + Intergenic
1047691159 8:127356041-127356063 GTGCAGTGGCCACACACAGCGGG + Intergenic
1047869921 8:129071360-129071382 GTCCTGAGGCTGCACAAAGCAGG - Intergenic
1047924477 8:129669482-129669504 GTCCCTGGGCTGCACACAGCAGG - Intergenic
1048279526 8:133094898-133094920 ATTCTGGGGCTGCACACAATGGG - Intronic
1048483993 8:134831436-134831458 GCCCTGGTGCTACACACAGGCGG + Intergenic
1048537709 8:135312983-135313005 GTTCTGAGACTGCACAAAGCAGG + Intergenic
1048988346 8:139747510-139747532 ATGCAGGGGGTACACACAGCAGG + Intronic
1048988443 8:139747866-139747888 ATGCAGGGGTTACACACAGCAGG + Intronic
1048988566 8:139748339-139748361 ATGCAGGGGGTACACACAGCAGG + Intronic
1048988595 8:139748458-139748480 ATGCAGGGGGTACACACAGCAGG + Intronic
1049436125 8:142587053-142587075 CCTGTGTGGCTACACACAGCAGG + Intergenic
1051986574 9:23096472-23096494 GTCCTGAGGCTTCACTCAGCAGG - Intergenic
1052124236 9:24755780-24755802 GTTCCTAGGCTACACAAAGCAGG - Intergenic
1052879071 9:33589442-33589464 GTCCTGAGGCTACACACAGCAGG - Intergenic
1053020332 9:34689980-34690002 GGTCTGGGGGTGCACAGAGCTGG + Exonic
1053496905 9:38554777-38554799 GTCCTGAGGCTACACACAGCAGG + Intronic
1055701250 9:78948013-78948035 GTCCTGAGGCTGCACACAGGAGG - Intergenic
1057161403 9:92890912-92890934 GTCCTGAGGATGCACACAGCAGG + Intergenic
1057279262 9:93698468-93698490 GGTCGGGGGCTGCACACAGCTGG + Intergenic
1057445719 9:95113070-95113092 GTCCTGGTGTTACACAGAGCTGG - Intronic
1057676815 9:97142334-97142356 GTCCTGAGGCTGCACACTGCAGG + Intergenic
1058164799 9:101607205-101607227 GCTCTGGGGCTACAAAGAGATGG + Intronic
1059069528 9:111120659-111120681 GTCCCGAGGCTGCACACAGCAGG + Intergenic
1061137089 9:128741262-128741284 GTTCTCAGGCTGCCCACAGCTGG - Intronic
1061195835 9:129106692-129106714 GCTGTGGGGCTGCACACAGGAGG - Intronic
1061299256 9:129695338-129695360 CCTCTGGGGCTAAAGACAGCTGG - Intronic
1062066071 9:134527042-134527064 GTACGGGGGCTCCCCACAGCGGG - Intergenic
1062154750 9:135040783-135040805 CTTCTGGGGCTCCACAGCGCAGG - Intergenic
1185797705 X:2981197-2981219 GTTCCAAGGCTGCACACAGCAGG - Intergenic
1186103561 X:6182078-6182100 GGTCTGTGGCTAAACACTGCTGG + Intronic
1186280543 X:7988465-7988487 GTTCTGGGGCTACTCAGGGCAGG + Intergenic
1186352898 X:8757902-8757924 GTTCTGGGGCTACTCAGGGCAGG - Intergenic
1187072389 X:15901195-15901217 GTCTTTAGGCTACACACAGCAGG + Intergenic
1187097390 X:16162560-16162582 GTCCCTGGGCTGCACACAGCAGG + Intergenic
1187683999 X:21798329-21798351 GTTTTGGAGCTACACATACCTGG + Intergenic
1188062518 X:25618396-25618418 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1188221531 X:27546782-27546804 GCCCTGAGGCTACACAGAGCAGG + Intergenic
1188857041 X:35209313-35209335 GTCCTTAGGCTCCACACAGCAGG + Intergenic
1188865150 X:35305283-35305305 GTCCTGAGGCTGCACACAGCAGG - Intergenic
1189815751 X:44822886-44822908 GTCCTGAGGCTACATAGAGCAGG - Intergenic
1190946368 X:55097881-55097903 GTTCTTTGGCTAAACACAGCAGG + Intronic
1190950585 X:55139539-55139561 GTTCTGAGGCTGCACAGAGCAGG - Intronic
1194049665 X:89053385-89053407 GTCCTGAGGCTACACACAGCAGG + Intergenic
1194542412 X:95190558-95190580 GTTCCTGGGCTGCACACAGCAGG + Intergenic
1194554248 X:95337766-95337788 GTCCTGAGGCTGCACAGAGCAGG + Intergenic
1194893252 X:99406588-99406610 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1195154517 X:102109878-102109900 GTCCTTAGGCAACACACAGCAGG - Intergenic
1197057060 X:122134529-122134551 GTCTTGAGGCTGCACACAGCAGG - Intergenic
1197109591 X:122756653-122756675 GTTCCGGGGCTGCACAGAGCAGG + Intergenic
1197301732 X:124789215-124789237 GTTCCTAGGCTGCACACAGCAGG + Intronic
1197721389 X:129747135-129747157 GTTCTGGGGCCTCAGACAGCTGG + Intronic
1197858735 X:130947326-130947348 CATCTGGGGCTACACACTGCAGG + Intergenic
1198274645 X:135089337-135089359 GTCCTGAGGCTGCACAGAGCAGG - Intergenic
1199206977 X:145160241-145160263 GTCCTGAGACTGCACACAGCAGG + Intergenic
1199309560 X:146307304-146307326 GTTCTGAGGCTGCACAGAGCAGG - Intergenic
1199384348 X:147206701-147206723 ATTTTGGGGCTTCACACAGAGGG - Intergenic
1201298543 Y:12486530-12486552 GTTCTGGAACTAGATACAGCTGG - Intergenic