ID: 1091811886

View in Genome Browser
Species Human (GRCh38)
Location 12:3406227-3406249
Sequence TTCTGGGGCTACACACAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 12, 3: 68, 4: 402}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811877_1091811886 12 Left 1091811877 12:3406192-3406214 CCAAGGATGGAGCAGCTGGGATT 0: 1
1: 0
2: 13
3: 150
4: 669
Right 1091811886 12:3406227-3406249 TTCTGGGGCTACACACAGCAGGG 0: 1
1: 0
2: 12
3: 68
4: 402
1091811874_1091811886 20 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811886 12:3406227-3406249 TTCTGGGGCTACACACAGCAGGG 0: 1
1: 0
2: 12
3: 68
4: 402
1091811873_1091811886 21 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811886 12:3406227-3406249 TTCTGGGGCTACACACAGCAGGG 0: 1
1: 0
2: 12
3: 68
4: 402
1091811872_1091811886 22 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811886 12:3406227-3406249 TTCTGGGGCTACACACAGCAGGG 0: 1
1: 0
2: 12
3: 68
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811886 Original CRISPR TTCTGGGGCTACACACAGCA GGG Intronic
900594431 1:3474326-3474348 TCCTGAGGCTACACATGGCAGGG + Intronic
902609250 1:17587671-17587693 TCCTGGGGCTACAGGGAGCATGG + Intronic
902637128 1:17741902-17741924 TTCTTGGGCTCCACACCCCAGGG - Intergenic
906938432 1:50234929-50234951 TCCTGAGGCTGCACAAAGCAGGG - Intergenic
907862962 1:58371701-58371723 TCCTGAGGCTTCACAGAGCAGGG - Intronic
908006891 1:59736966-59736988 TCTTGAGGCTGCACACAGCAGGG - Intronic
908767581 1:67568488-67568510 TCCTGGGGCTGCACCCTGCAAGG - Intergenic
908963545 1:69730096-69730118 TCCTGAAGCTGCACACAGCAGGG + Intronic
909065598 1:70931718-70931740 TTCCTGGGCTGCCCACAGCATGG + Intronic
909269203 1:73601142-73601164 TCCTGAGGCTACACACAGCAGGG + Intergenic
912043031 1:105416533-105416555 TTCCTAGGCTACACAGAGCAGGG - Intergenic
912135508 1:106656236-106656258 TTCCTAGGCTACACACAGCATGG + Intergenic
914351649 1:146845104-146845126 TCCTTAGGCTGCACACAGCAGGG + Intergenic
915579369 1:156804283-156804305 TTCTGTGGCTCCACAGAGCATGG - Intergenic
916126438 1:161575621-161575643 CTCTGGGGCAACACACAGAAGGG - Intergenic
916136357 1:161657461-161657483 CTCTGGGGCAACACACAGAAGGG - Intronic
916162016 1:161926471-161926493 TTCTGGGGCTGCTCACAACATGG + Intronic
916477362 1:165183171-165183193 TCCTTAGGCTGCACACAGCACGG - Intergenic
917140161 1:171827395-171827417 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
917773846 1:178311719-178311741 TTCTTGGGCTAAATACACCAAGG - Intronic
918180416 1:182082131-182082153 TTCTAGGGCTAAACACAGAAGGG - Intergenic
918591530 1:186246097-186246119 TCCTGAGGCTGCACACAGCAGGG + Intergenic
919835378 1:201569668-201569690 TGCTGGGGCTGCACACAGAGAGG + Intergenic
920318140 1:205094810-205094832 GTCAAGGGCTACACAAAGCAAGG + Intronic
920491710 1:206420709-206420731 TTCTGAGGCTAAACACAGATTGG + Intronic
921496912 1:215853329-215853351 TCCTTAGGCTGCACACAGCATGG + Intronic
922643444 1:227260420-227260442 ATCTTGGGCTACACAGAGTAGGG - Intronic
923712690 1:236399832-236399854 TTCTGAGACTCCACACCGCAGGG + Intronic
924495598 1:244585636-244585658 TTCTGTGTCTACACAGAGCTGGG - Intronic
1065901923 10:30215674-30215696 TTCTCAGGCTAAACACAACACGG - Intergenic
1065972357 10:30815686-30815708 TTCTGGAGCTGAACACAGCCAGG - Intergenic
1066154249 10:32657576-32657598 TCCTGAGGCTGCACAGAGCAGGG + Intronic
1067712941 10:48664841-48664863 TTCTTCTGCTCCACACAGCATGG - Intergenic
1068215606 10:53978446-53978468 TCCTGAGGCTATACACAGCAGGG + Intronic
1068300504 10:55132106-55132128 GGCTGGGGCTACACACTCCATGG - Intronic
1068805802 10:61192728-61192750 TCCAGAGGCTGCACACAGCAGGG + Intergenic
1068908374 10:62351970-62351992 TCCTTAGGCTGCACACAGCATGG + Intergenic
1071244881 10:83751765-83751787 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
1071550086 10:86560132-86560154 TTCCTAGGCTACACACAGCATGG + Intergenic
1073875652 10:107918796-107918818 TTCAGGGGCTTCACACTACAGGG + Intergenic
1074306969 10:112287985-112288007 ATCGGGGGCTAAATACAGCATGG + Intronic
1074575153 10:114661924-114661946 TTTTGGGGCTACACAGTGCTCGG + Intronic
1076409203 10:130233883-130233905 TTCTGGAGCTCCAGCCAGCAAGG - Intergenic
1076464860 10:130672054-130672076 TCCCTAGGCTACACACAGCATGG + Intergenic
1076833792 10:133009879-133009901 TTCTGTGGATACAAACAGCGTGG + Intergenic
1077942585 11:6859210-6859232 TTCCTAGGCTGCACACAGCATGG + Intergenic
1077979589 11:7286384-7286406 TCCTGAGGCTGCACACAGCAGGG + Intronic
1078151517 11:8763562-8763584 ATCTGCAGCTACACACAACATGG + Intronic
1078386141 11:10894643-10894665 TTCTGGGGCTGCTCACAGTAGGG + Intergenic
1078834868 11:15017555-15017577 TACTGAGGTTTCACACAGCAGGG - Intronic
1079747644 11:24153458-24153480 TTCTCAGGCTGCACACACCATGG - Intergenic
1080269364 11:30434440-30434462 TCCTGGGGGTAAACACACCATGG - Intronic
1080746022 11:35109438-35109460 TCCTGGGGCTACATAGAGCAGGG - Intergenic
1081867555 11:46367840-46367862 TCCTGGGGCGGCCCACAGCAGGG - Intronic
1082948022 11:58780718-58780740 TTCCAAGGCTGCACACAGCAGGG + Intergenic
1084085157 11:66851662-66851684 CTCTGTGGCCACACGCAGCAGGG - Intronic
1084904584 11:72335823-72335845 TTCTGAGGCCACACAGAACATGG + Intronic
1086084917 11:82944359-82944381 TTCCTAGGCTGCACACAGCAGGG + Intronic
1086503636 11:87479399-87479421 TCCTAAGGCTGCACACAGCAGGG - Intergenic
1086564387 11:88208960-88208982 TTCTGGGGCTTCACAAAGGCTGG + Intergenic
1086936130 11:92747396-92747418 TCCTGAGGCTGCACAGAGCAGGG + Intronic
1087255584 11:95948867-95948889 TTCCTAGGCTGCACACAGCATGG + Intergenic
1087385484 11:97463868-97463890 TCCTGAGGCTACACACAGCAAGG - Intergenic
1087698554 11:101409734-101409756 TTCTGGGGCTACAAAGACGAAGG + Intergenic
1087908309 11:103724715-103724737 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
1088111461 11:106266884-106266906 TTCCTAGGCTGCACACAGCAAGG - Intergenic
1088447735 11:109950216-109950238 TCCAGAGGCTCCACACAGCAGGG + Intergenic
1091788991 12:3260469-3260491 AGCTGGGGCTACACAGAACAGGG + Intronic
1091811886 12:3406227-3406249 TTCTGGGGCTACACACAGCAGGG + Intronic
1092098063 12:5860734-5860756 ATCTGGGGCTACCAACAGGATGG - Intronic
1092342661 12:7689976-7689998 TGGTGGGGATACACACAGCCTGG + Exonic
1092926479 12:13276839-13276861 ATCTGGGGCTAAAGACAGCCCGG + Intergenic
1093604993 12:21078447-21078469 TTTCTGGGCTACACACAGCAGGG + Intronic
1094282496 12:28755171-28755193 TCCTTGGGCTGCACACAGCAGGG + Intergenic
1094421190 12:30272933-30272955 TCCTGAGGCTACATAGAGCAGGG + Intergenic
1094592561 12:31835336-31835358 TTCTTAGGCTACACTCAACACGG + Intergenic
1094756373 12:33474228-33474250 TTCAGTGACTACACACAGCAAGG + Intergenic
1095640901 12:44483765-44483787 TTCTGAGGCTGCACACAGCAGGG + Intergenic
1095803455 12:46293138-46293160 TTCTGTGGCTAAACACCACAGGG + Intergenic
1095901070 12:47328573-47328595 TTCTGGGGCCTCTCAGAGCAGGG - Intergenic
1096590595 12:52656505-52656527 TTGTGTGGCTACACAGATCATGG - Intergenic
1097377989 12:58860988-58861010 TTCTGATGCTGCAGACAGCAGGG + Intergenic
1097443951 12:59646290-59646312 TCTTGAGGCTGCACACAGCAGGG - Intronic
1098384121 12:69900568-69900590 TGCTGGTGCTACTCAAAGCATGG - Intronic
1099096348 12:78379220-78379242 TCCCTAGGCTACACACAGCAAGG + Intergenic
1099105096 12:78486881-78486903 TCCCTGGGCTGCACACAGCATGG + Intergenic
1099390187 12:82070084-82070106 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
1099621252 12:85005313-85005335 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
1099932624 12:89091506-89091528 TTCTGAGGCTATACAGAGCAGGG - Intergenic
1099996665 12:89786388-89786410 TTCTGAGCCTGCACAGAGCAGGG - Intergenic
1100032361 12:90208986-90209008 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
1102211754 12:111132284-111132306 TCCTTAGGCTGCACACAGCATGG + Intronic
1102316501 12:111892128-111892150 ATCTGCTGCTACACACAACATGG - Intronic
1103184812 12:118947386-118947408 TTCTGGTGCTACACTAGGCATGG - Intergenic
1103263473 12:119609567-119609589 GTCTGAGGCTGCACACAGCAGGG - Intronic
1103264555 12:119618029-119618051 TCCAGAGGCTGCACACAGCAGGG - Intronic
1103294089 12:119871251-119871273 TTGTGGGGCTACATTCAGCTGGG - Intronic
1104487366 12:129163095-129163117 TTCTTGGGCAAGACACAGAAGGG + Intronic
1104808083 12:131602165-131602187 TCCTGAGGCTGCGCACAGCAGGG + Intergenic
1105259876 13:18771091-18771113 TCCTGAGGCTGCACACAGAAGGG + Intergenic
1105262556 13:18790414-18790436 TCCTGAGGCTGCACACAGAAGGG + Intergenic
1105573315 13:21624522-21624544 CTCTAGTGCTACTCACAGCAGGG - Intergenic
1105644590 13:22303438-22303460 TCCTGAGGCTGCACACAGTAGGG + Intergenic
1106452669 13:29897053-29897075 TTCAGGGGATACACACAGACTGG + Intergenic
1107699180 13:43030783-43030805 TTCTAGGGCCAAGCACAGCACGG + Intronic
1108219233 13:48216438-48216460 TCCTGAGGCTGCACACAGCAGGG - Intergenic
1108719669 13:53118032-53118054 TCCCTAGGCTACACACAGCATGG + Intergenic
1109346972 13:61126031-61126053 TTCCTAGGCTGCACACAGCATGG + Intergenic
1109407348 13:61919015-61919037 TCCTTAGGCTGCACACAGCAGGG + Intergenic
1109583944 13:64373776-64373798 CTCCTAGGCTACACACAGCAGGG + Intergenic
1109655718 13:65387968-65387990 TCCTTAGGCTGCACACAGCAGGG - Intergenic
1109718334 13:66245957-66245979 TTGTGAGGCTACATAGAGCAGGG - Intergenic
1109793883 13:67284862-67284884 TCCTGTGGCCACACACACCAAGG + Intergenic
1109823911 13:67692550-67692572 TCCCTAGGCTACACACAGCATGG + Intergenic
1109836277 13:67861163-67861185 TTCAGTGACTGCACACAGCAAGG + Intergenic
1111339246 13:86862420-86862442 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
1111441301 13:88285565-88285587 TCCTGAGGCTGCACACAGAAGGG - Intergenic
1111606681 13:90547700-90547722 TCCTGAGGCTGCACACAGCAGGG + Intergenic
1112259346 13:97863983-97864005 TCCTTAGACTACACACAGCAGGG + Intergenic
1113452843 13:110424028-110424050 TTCTGGGCATACAGAAAGCAGGG - Intronic
1113614346 13:111670359-111670381 ATCTGGTGCGACACCCAGCAGGG + Intronic
1113619814 13:111755273-111755295 ATCTGGTGCGACACCCAGCAGGG + Intergenic
1113771380 13:112911369-112911391 GTCTGGGTCTACACCCTGCATGG - Intronic
1114687591 14:24548584-24548606 TCCTTAGGCTGCACACAGCATGG + Intergenic
1115010569 14:28540206-28540228 TTCCAAGGCTGCACACAGCAGGG - Intergenic
1115878754 14:37891730-37891752 TTCCTAGGCTGCACACAGCAGGG - Intronic
1115893841 14:38061737-38061759 TCCCTGGGCTGCACACAGCAAGG + Intergenic
1115943045 14:38629556-38629578 TCCTGAGGCTGCACACAGCAGGG + Intergenic
1117085460 14:52196238-52196260 TCCTGAGGCTGCACAGAGCATGG - Intergenic
1117198529 14:53364430-53364452 TCCCTAGGCTACACACAGCATGG + Intergenic
1117203660 14:53418396-53418418 TTCTAAGGCTGCACTCAGCAGGG - Intergenic
1118037419 14:61883053-61883075 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
1118069582 14:62231685-62231707 TCCCTGGGCTGCACACAGCACGG - Intergenic
1118151406 14:63194741-63194763 TCCTGAGGCTGCACACAGCAAGG - Intergenic
1118402888 14:65395616-65395638 TTCCTAGGCTGCACACAGCAAGG + Intergenic
1118630010 14:67694278-67694300 TCCTGGAGCTACATACAGTAAGG - Intronic
1120131844 14:80817154-80817176 ATCAGTGGCTACACACTGCAGGG + Intronic
1120654187 14:87169483-87169505 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
1120659059 14:87230886-87230908 TCCTGAGGCTGCACACAGCAGGG + Intergenic
1120756197 14:88246631-88246653 TTCTGGGGCCACACCCAGTGAGG + Intronic
1122253155 14:100454856-100454878 TTCTGCTGCTGCACACCGCAAGG + Intronic
1123138222 14:106050314-106050336 TCCTTAGGCTGCACACAGCACGG - Intergenic
1124658363 15:31526278-31526300 ACCCAGGGCTACACACAGCATGG - Intronic
1124706378 15:31970061-31970083 TTCTGTGGCTGCAGAAAGCAGGG - Intergenic
1126190574 15:45873839-45873861 TCCTGAGGCTGCACACAGCAGGG + Intergenic
1126825094 15:52540584-52540606 TCCAGAGGCTGCACACAGCAGGG + Intergenic
1126942851 15:53784983-53785005 TCCTTAGGCTGCACACAGCAAGG + Intergenic
1130740099 15:86590121-86590143 TCTTGAGGCTACACACAGAATGG + Intronic
1132122774 15:99192392-99192414 TTCCTAGGCTGCACACAGCATGG - Intronic
1132769486 16:1553359-1553381 TGCTGGGGCCACACAGGGCAGGG + Intronic
1132793699 16:1707595-1707617 TTCTGGGCCCACACACAGGCAGG - Intronic
1133111367 16:3550017-3550039 GTCTGGGGCCACCCACATCAAGG - Intronic
1133175547 16:4011358-4011380 TTCTGGGGCCACGGGCAGCAGGG + Intronic
1135486660 16:22871583-22871605 TTGTGGGGATACAGACAGTAAGG - Intronic
1138269692 16:55686329-55686351 TGCTTGGGCTTCTCACAGCATGG + Intronic
1138282635 16:55783786-55783808 TTCTGGGACTAGAGACAGGAGGG - Intergenic
1138798845 16:60001735-60001757 TCCTGAGGCTGCACACAGCAGGG - Intergenic
1139982385 16:70870431-70870453 TCCTTAGGCTGCACACAGCAGGG - Intronic
1141665055 16:85461720-85461742 TCCTGGAGCTTCACGCAGCACGG - Intergenic
1143931967 17:10438500-10438522 TTCCAAGGCTGCACACAGCAGGG + Intergenic
1144386144 17:14750999-14751021 ATCTGGGGCTGCACACTCCATGG + Intergenic
1144643972 17:16956144-16956166 TTCAGTGACTACACACAACAAGG + Intronic
1146817874 17:35958603-35958625 TGCTGGGGCAACACACAGCTGGG + Intergenic
1147621965 17:41874030-41874052 TTCTGAGAGTACACACAGCAGGG - Intronic
1148162183 17:45456666-45456688 TGCCAGGGCTACCCACAGCAAGG + Intronic
1149339703 17:55672665-55672687 TTCTGAGGCTGCACAGAGCAGGG + Intergenic
1150198357 17:63325490-63325512 TGCTAGGGCAACACACAGCTGGG - Intronic
1150250945 17:63704215-63704237 ATCTGGAGCTACACACAGGAGGG - Intronic
1150393416 17:64803314-64803336 TGCCAGGGCTACCCACAGCAAGG + Intergenic
1151086651 17:71388182-71388204 TCCTGAGTCTGCACACAGCAAGG + Intergenic
1152289630 17:79432293-79432315 TTCTGGGTATACACCCAACAGGG - Intronic
1152731827 17:81976361-81976383 TTCTGAGGTTGCACAGAGCATGG + Intergenic
1153423009 18:4929676-4929698 TTCAGGGGCAAAACACAGCTGGG + Intergenic
1155515976 18:26624405-26624427 TCCTGAGGCTGCACAGAGCAAGG - Intronic
1156134391 18:34019521-34019543 TTCAGGGGGAACACACAGCAGGG - Exonic
1156169387 18:34463622-34463644 TTCTAAGGCTGCACACAGAAGGG + Intergenic
1156525694 18:37765492-37765514 ATTTGGGGCTACACTCAGCCAGG + Intergenic
1157485026 18:48080725-48080747 TGCTGGGGCTGCACACAGTGAGG + Intronic
1159811782 18:73025647-73025669 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
1160062256 18:75542757-75542779 TTCTGGGGTTAGATACGGCAGGG + Intergenic
1161514742 19:4690146-4690168 TACTGGGGCTTCCCACAGGAAGG - Intronic
1164210070 19:23091056-23091078 TCCTTAGGCTGCACACAGCATGG - Intronic
1166971256 19:46569810-46569832 TTTTGGGTATATACACAGCATGG - Intronic
1167013015 19:46821507-46821529 GGCTGGGGCTACACACTCCATGG + Intergenic
1167702330 19:51056814-51056836 TGCTGGGGCTAAACAAGGCAGGG + Intronic
1167852933 19:52215764-52215786 TTCTGGAGCTGCAGACAGGAAGG - Exonic
925970388 2:9102716-9102738 TTCGGGGGATAGACACAGAACGG + Intergenic
926088060 2:10032500-10032522 CTCTGGGGCTGCACACATCTGGG - Intergenic
926456546 2:13074263-13074285 TCCTGAGGCTTCACACAGCAGGG + Intergenic
926859429 2:17292423-17292445 GTCTGGGGCTGCACACTCCATGG - Intergenic
927389788 2:22582325-22582347 TCCTGTGTCTGCACACAGCAGGG - Intergenic
929618483 2:43331035-43331057 TTCTGGGGCTACCAACAGGAAGG + Intronic
930521289 2:52470702-52470724 TCCTTAGGCTGCACACAGCAGGG - Intergenic
930585630 2:53263852-53263874 TTCCTAGGCTGCACACAGCATGG + Intergenic
931041403 2:58305065-58305087 TCCTAAGGCTGCACACAGCAGGG - Intergenic
931079420 2:58752735-58752757 TCCTGAGACTGCACACAGCAGGG - Intergenic
932449676 2:71801663-71801685 TTGTGAGGCTCCTCACAGCATGG + Intergenic
934932051 2:98434758-98434780 TTCAAGGGCTACTGACAGCAGGG + Intergenic
935323075 2:101907211-101907233 TTCTGAGGCTGCATAGAGCAGGG + Intergenic
935518912 2:104079033-104079055 GTCTGGGGCTGCACACTCCATGG - Intergenic
936089279 2:109490584-109490606 TTCTGGGGAGACACACAAGATGG - Exonic
936728966 2:115357953-115357975 TACCGAGGCTATACACAGCAGGG + Intronic
936921377 2:117692122-117692144 GTCTGGGGCCAGACAAAGCAAGG - Intergenic
936937736 2:117854163-117854185 TTCTGGGGCCAGTCACAGCAGGG + Intergenic
938503577 2:131851142-131851164 TCCTTAGGCTGCACACAGCAAGG + Intergenic
939112618 2:138026893-138026915 TTCCTGGGCTTCACCCAGCATGG - Intergenic
939605815 2:144253964-144253986 TCTTGAGGCTGCACACAGCAGGG - Intronic
939784675 2:146494649-146494671 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
939830391 2:147064249-147064271 TCCTGAGGTTGCACACAGCAGGG - Intergenic
940337358 2:152543354-152543376 TTGTGTGGCTGCACAAAGCAGGG - Intronic
940444772 2:153764799-153764821 TCCCTGGGCTGCACACAGCAGGG - Intergenic
941227263 2:162865284-162865306 TCCTGAGGCTACACACAGCAGGG + Intergenic
941741863 2:169044092-169044114 TTCCTAGGCTGCACACAGCATGG - Intergenic
942313777 2:174680783-174680805 TCTTGGTGCTACACACTGCATGG + Intronic
942313879 2:174681652-174681674 GTCTGGGGCTACACGCAGCCAGG + Intronic
942950055 2:181712097-181712119 TTCCAAGGCTGCACACAGCATGG - Intergenic
943448544 2:188019854-188019876 TTCTGAGGCTGAACACAGCATGG - Intergenic
943483938 2:188456360-188456382 TTCCTAGGCTGCACACAGCACGG - Intronic
943620255 2:190140636-190140658 TCCTGAGGCTGCATACAGCAGGG + Intronic
943961061 2:194264640-194264662 GGCTGGGGCTACACACTCCATGG + Intergenic
944041871 2:195365151-195365173 TTCTGGGACTTCAGCCAGCATGG + Intergenic
945739673 2:213644883-213644905 TTGTGGCTCTACACTCAGCAGGG + Intronic
945930975 2:215854535-215854557 TTCTGAGGCTGCATAGAGCAGGG - Intergenic
946874474 2:224114159-224114181 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
947256306 2:228168531-228168553 TTTTGGGGCACCACACACCATGG + Intronic
947311732 2:228810267-228810289 TTTTGGGTATACACCCAGCAGGG + Intergenic
947904492 2:233750630-233750652 TCCTGAGGCTGCACACAGCAGGG - Intronic
948016774 2:234697458-234697480 TCCTGAGGCTTCACACAGCAGGG + Intergenic
948727577 2:239944343-239944365 CCCTGGGGCCACACTCAGCATGG - Intronic
948878889 2:240845728-240845750 TTCCAAGGCTGCACACAGCAGGG - Intergenic
1169525131 20:6416299-6416321 ATCTGGGGCTACTAACATCAGGG + Intergenic
1169862726 20:10169845-10169867 TTCTGAGGCTACACTCAGGGTGG - Intergenic
1171118741 20:22549733-22549755 TTCCTAGGCTGCACACAGCACGG + Intergenic
1171321152 20:24245635-24245657 GTCGGGGGCAACCCACAGCATGG + Intergenic
1171426906 20:25054599-25054621 TCCTGGGGCTTGTCACAGCATGG - Intronic
1172413693 20:34746100-34746122 TCCTGGGGCTTCTCAAAGCAGGG - Intronic
1173026158 20:39309484-39309506 TTGTGTGGCTACATTCAGCAGGG + Intergenic
1173323456 20:42010280-42010302 TCCTGGGGCTGCACACAGCAGGG + Intergenic
1173614538 20:44394262-44394284 TTCAGGGGCTCCAGCCAGCATGG - Intronic
1174890618 20:54388210-54388232 TACTGGGGCTGCTCACAGAAAGG - Intergenic
1175796733 20:61775960-61775982 GTGTGGGGCCACACACAGCTTGG - Intronic
1176103957 20:63377017-63377039 CTCTGGGTGTAGACACAGCAGGG + Intronic
1177606002 21:23378790-23378812 TCCTGTGGCTGCACACAGCAGGG - Intergenic
1177742142 21:25167682-25167704 TCCCTAGGCTACACACAGCAAGG - Intergenic
1177761018 21:25402269-25402291 TCCCTAGGCTACACACAGCAGGG - Intergenic
1178046212 21:28696961-28696983 TCCGGAGGCTGCACACAGCAGGG + Intergenic
1182999562 22:34843962-34843984 TCCTGAGGCTGCACACAGCAAGG - Intergenic
1184139399 22:42569623-42569645 TTTTGGGCCTGCACACAGGAGGG - Intronic
1184199788 22:42960333-42960355 TTCTGTGACTACACACAACAAGG + Intronic
1184338851 22:43874387-43874409 TCCTAAGGCTGCACACAGCAGGG - Intergenic
1184656748 22:45945799-45945821 TTCCTGGGCTGCACACAGCAGGG - Intronic
1184869577 22:47226579-47226601 GGCTGGGGCTACACACTCCATGG - Intergenic
950413044 3:12851369-12851391 TTCTGTGGCTCCACACTTCAGGG - Intronic
950766409 3:15276436-15276458 TCCGGGGGGTACACACTGCATGG - Intronic
952185263 3:30961345-30961367 TTCCTAGGCTGCACACAGCATGG + Intergenic
952608754 3:35181756-35181778 TCCTGAGGCTACATAGAGCAGGG + Intergenic
953232714 3:41078781-41078803 CTCTGGAGCTAGACACAGGAAGG + Intergenic
954643137 3:52114290-52114312 TACTGGGGCTGGGCACAGCATGG - Intronic
956149463 3:66225443-66225465 TCCTGAGGCTGCACACAGCAAGG + Intronic
957471808 3:80668324-80668346 TCCAGAGGCTGCACACAGCAGGG - Intergenic
958911154 3:99995845-99995867 TCCCTGGGCTGCACACAGCATGG + Intronic
959381074 3:105641837-105641859 TCCTTAGGCTGCACACAGCAGGG + Intergenic
959893686 3:111583765-111583787 TCCCGAGGCTGCACACAGCAAGG + Intronic
962339521 3:134570051-134570073 TTCCTAGGCTGCACACAGCATGG + Intronic
962609083 3:137058034-137058056 GTGTAGGGCTTCACACAGCAAGG - Intergenic
963058160 3:141204459-141204481 CTCTGGGGCTGCAGACAGCCAGG - Intergenic
963297082 3:143558057-143558079 TCCTGAGGCTGCACAGAGCAGGG - Intronic
963363252 3:144303415-144303437 TCCTTAGGCTACACACAGCAGGG + Intergenic
963433756 3:145242061-145242083 TCCTGAAGCTGCACACAGCAGGG + Intergenic
965092857 3:164183845-164183867 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
965224547 3:165971878-165971900 TCCTGAGACTACACATAGCAGGG - Intergenic
966720428 3:183057106-183057128 TTCTGGGGGTAGACACAACAGGG - Intronic
966972786 3:185060859-185060881 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
967609121 3:191483100-191483122 TCCCTGGGCTGCACACAGCATGG - Intergenic
967622588 3:191651081-191651103 TCCCTGGGCTTCACACAGCAGGG + Intergenic
967758872 3:193201663-193201685 TTGTGAGGCTACACTCAGTACGG - Intergenic
967807326 3:193727527-193727549 TGCTGCGGCCACACAGAGCAGGG - Intergenic
968380683 4:93278-93300 TCCTGAGACTGCACACAGCAGGG + Intergenic
969438252 4:7200802-7200824 TGCTGGGGCCACACACTCCATGG + Intronic
970721867 4:18997477-18997499 TCCTCAGGCTGCACACAGCAGGG + Intergenic
971440423 4:26679252-26679274 TCCTGAGGCTGCACAGAGCAGGG - Intronic
972012825 4:34205929-34205951 TCCTGAGGCTTCACAGAGCAGGG - Intergenic
972051699 4:34743213-34743235 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
972203733 4:36747325-36747347 TGCTGGGGCCACACACTCCATGG + Intergenic
972872105 4:43312963-43312985 TCCTTAGGCTACACACAGCAGGG - Intergenic
972879494 4:43406584-43406606 TCCTGAGGCTGCACACAGCAGGG - Intergenic
972956041 4:44392677-44392699 TTCTGGAGCTAAAAATAGCAAGG + Intronic
973978127 4:56283438-56283460 TACCAGAGCTACACACAGCAAGG - Intronic
974317961 4:60306626-60306648 TCCTGAGGCTGCACACACCAAGG + Intergenic
974666577 4:64969708-64969730 TCCTGAGGCTGCACATAGCAGGG + Intergenic
975583496 4:75928066-75928088 GTCTGGTGATCCACACAGCAAGG - Intronic
976365780 4:84230733-84230755 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
976887424 4:90002848-90002870 TTCTGGAACTACAGACAGCTGGG - Intergenic
977041480 4:92024630-92024652 TTCCTAGGCTGCACACAGCAGGG + Intergenic
977070325 4:92376880-92376902 TCCCTAGGCTACACACAGCATGG + Intronic
977435425 4:96989183-96989205 TACTTAGGCTACACACAGCAGGG - Intergenic
978579565 4:110218456-110218478 TTCCTAGGCTGCACACAGCATGG + Intergenic
978904029 4:113985325-113985347 TCCTGAGGCTGCACACAGAAAGG - Intergenic
978964698 4:114726079-114726101 TGCTGGGGCTGCACACTCCATGG - Intergenic
980006828 4:127552255-127552277 TCCTGAAGCTGCACACAGCATGG - Intergenic
980280109 4:130707670-130707692 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
980430191 4:132684123-132684145 TCCTGAGGCTGCACACAGCAGGG + Intergenic
980742773 4:136973623-136973645 TTCTGGGGCCAAACAGAGCAGGG + Intergenic
980767122 4:137321252-137321274 TCCCCAGGCTACACACAGCAGGG + Intergenic
981200415 4:141973114-141973136 TCCTTAGTCTACACACAGCAGGG + Intergenic
982026851 4:151259648-151259670 TGATGGGTCTCCACACAGCAGGG - Intronic
982598932 4:157421029-157421051 TTCTGGGCCTACAGAGAGCTTGG + Intergenic
982833793 4:160096988-160097010 TTCTGGAGGTACACAAGGCAAGG - Intergenic
983657533 4:170098366-170098388 TCCTTAGGCTGCACACAGCAGGG + Intergenic
983785883 4:171729091-171729113 TCCTTAGGCTGCACACAGCACGG - Intergenic
983889456 4:173015932-173015954 TCCTGAGGCCACACAGAGCAGGG - Intronic
986129109 5:4910596-4910618 TCCTGAGGCTGCACAGAGCAAGG + Intergenic
987262987 5:16222147-16222169 GTGTGGGGCTAGACACAGAAAGG - Intergenic
987659534 5:20854831-20854853 TTCCTAGGCTGCACACAGCAGGG - Intergenic
987709072 5:21486157-21486179 TTCCTAGGCTGCACACAGCAGGG + Intergenic
988345709 5:30035571-30035593 TCCTGAGGCTGCACACAGTAGGG - Intergenic
988473911 5:31565847-31565869 TCCTGAGGCTACACAGAGCAGGG + Intergenic
988750540 5:34187996-34188018 TTCCTAGGCTGCACACAGCAGGG - Intergenic
988764111 5:34350815-34350837 TTCCTAGGCTGCACACAGCAGGG + Intergenic
989132815 5:38124470-38124492 TCCTGAGGCTGCATACAGCAGGG + Intergenic
989389165 5:40882503-40882525 TCCCGAGGCTACACACAGCATGG - Intergenic
990108467 5:52293378-52293400 TCCTGAGGCTGCACACAGCAGGG + Intergenic
991110008 5:62888952-62888974 TTCTGCAGCTACTCACACCAGGG - Intergenic
991735680 5:69629910-69629932 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991738805 5:69651194-69651216 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991759392 5:69905233-69905255 TTCCTAGGCTGCACACAGCAGGG + Intergenic
991787943 5:70212885-70212907 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991790380 5:70230935-70230957 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991812171 5:70485549-70485571 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991815129 5:70506026-70506048 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991818265 5:70527311-70527333 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991838620 5:70780299-70780321 TTCCTAGGCTGCACACAGCAGGG + Intergenic
991880389 5:71213249-71213271 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991882830 5:71231275-71231297 TTCCTAGGCTGCACACAGCAGGG - Intergenic
991940840 5:71850530-71850552 TCCTGAGGATGCACACAGCAGGG + Intergenic
993893735 5:93505731-93505753 TTCCTAGGCTGCACACAGCATGG + Intergenic
994421197 5:99527500-99527522 TTCCTAGGCTGCACACAGCAGGG + Intergenic
994485846 5:100386814-100386836 TTCCTAGGCTGCACACAGCAGGG - Intergenic
994590797 5:101769304-101769326 TCCTGAGGCTGCACACAGCAGGG + Intergenic
994749575 5:103721373-103721395 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
994831212 5:104785982-104786004 TCCTTAGGCTGCACACAGCACGG - Intergenic
995389716 5:111626989-111627011 TCCAGAGGCTGCACACAGCAGGG - Intergenic
995390950 5:111639864-111639886 TTCTGAGGCTGCACAGAGAAGGG - Intergenic
995667218 5:114555395-114555417 TTCTGAGGCTACACAGAGCAGGG + Intergenic
996122926 5:119691613-119691635 TCCAGAGGCTGCACACAGCAGGG + Intergenic
996467977 5:123825611-123825633 TCTGGAGGCTACACACAGCAAGG - Intergenic
998339269 5:141402780-141402802 TTCTGCGGCTACACAAAACCCGG + Intronic
998759064 5:145411997-145412019 TCCTGAGGCTGCACACAGCAGGG + Intergenic
999122707 5:149221398-149221420 TTCTGGAGCTGGACACAGCATGG + Intronic
999651471 5:153771785-153771807 TTCTGGGACTACGCTAAGCAAGG + Intronic
1001352245 5:170980485-170980507 TTCCTAGGCTGCACACAGCATGG - Intronic
1001757682 5:174183200-174183222 TGCTGTGGGAACACACAGCATGG - Intronic
1002613688 5:180437247-180437269 CTTTAGGGCTCCACACAGCAGGG + Intergenic
1005187006 6:23173752-23173774 TTCTAGGGCTACAAAAAGAAAGG - Intergenic
1005497043 6:26396853-26396875 TCATGGGGATCCACACAGCAGGG - Intergenic
1005548612 6:26894301-26894323 TTCCTGGGCTGCACACAGCAGGG - Intergenic
1005581882 6:27242953-27242975 TCCTGGCGCTACACAGAGAAAGG - Intergenic
1007257769 6:40540761-40540783 TCCTGGGGACACACACACCACGG + Intronic
1007296422 6:40825310-40825332 TTCTGGGTGTTAACACAGCAGGG - Intergenic
1007807705 6:44462863-44462885 TTTTGCTGCTCCACACAGCAGGG + Intergenic
1008337516 6:50324861-50324883 TCCCTAGGCTACACACAGCAGGG + Intergenic
1008650069 6:53552756-53552778 TCCCTGGGCTGCACACAGCACGG - Intronic
1009019368 6:57935408-57935430 TTCCTAGGCTGCACACAGCAGGG - Intergenic
1010458230 6:76083068-76083090 TTCTGAGGCTGCACAGAGCAGGG + Intergenic
1010981751 6:82376773-82376795 GTCTGAGGCTGCACACAGCAGGG + Intergenic
1011663863 6:89616823-89616845 TCCTGGGGCTGCTCAGAGCAGGG - Intronic
1011870437 6:91886133-91886155 CCCTGAGGCTGCACACAGCAGGG - Intergenic
1012312259 6:97739902-97739924 TACTGGGGCCATACATAGCAAGG + Intergenic
1013213705 6:108008513-108008535 TTCTGAGGCTGCATAGAGCAGGG + Intergenic
1014475981 6:121872529-121872551 TTCCTAGGCTGCACACAGCAGGG + Intergenic
1014500764 6:122186135-122186157 ATCTTGGGCTTCTCACAGCATGG - Intergenic
1014562997 6:122913764-122913786 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
1014771766 6:125465525-125465547 TCCTTCGGCTGCACACAGCATGG - Intergenic
1015455808 6:133424876-133424898 TGCTGGGGCTGCACACTCCATGG - Intronic
1016187974 6:141221389-141221411 TCCAGGGGCAGCACACAGCAGGG + Intergenic
1016540555 6:145159456-145159478 TCCTGAGGCTGCACACAGCAGGG - Intergenic
1016790248 6:148060270-148060292 TCCTAAGGCTGCACACAGCAGGG + Intergenic
1017231334 6:152077135-152077157 TTCCTAGGCTGCACACAGCATGG - Intronic
1017975469 6:159353185-159353207 CTCTGGGGCTACAGACAACCTGG - Intergenic
1018477749 6:164159736-164159758 TCCTGAGGCTGCACACAGTAGGG + Intergenic
1019119927 6:169794435-169794457 TTCAGGGGTGACAGACAGCAAGG + Intergenic
1020200681 7:6077448-6077470 GGCTAGGGCTACTCACAGCATGG - Intergenic
1020581748 7:10011601-10011623 TTCTGAGGCTGCACAGACCAGGG - Intergenic
1020729658 7:11865884-11865906 TCTTGAGGCTGCACACAGCAGGG - Intergenic
1021323512 7:19239991-19240013 TCCTGAGGCTGCACATAGCAGGG + Intergenic
1023386396 7:39662111-39662133 TCCCTAGGCTACACACAGCATGG + Intronic
1023786861 7:43716817-43716839 TTCCTAGGCTGCACACAGCATGG - Intronic
1024137955 7:46429921-46429943 TTCCTAGGCTGCACACAGCATGG + Intergenic
1024232673 7:47374669-47374691 TTTGGGGGCTGCAAACAGCAGGG - Intronic
1024438592 7:49388397-49388419 TTCCTAGGCTGCACACAGCATGG + Intergenic
1024865850 7:53904478-53904500 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
1026457392 7:70584668-70584690 CTCTGGGGCTGCACTAAGCATGG - Intronic
1026905805 7:74062091-74062113 TTCAGGGGCTACAGACAGCGTGG - Intronic
1028745330 7:94320641-94320663 GTCCTGGGCTGCACACAGCATGG + Intergenic
1028957754 7:96713026-96713048 TCCTGAGGCTGCATACAGCAGGG - Intergenic
1030269531 7:107655367-107655389 TGATGGAGCAACACACAGCAAGG - Intergenic
1031288966 7:119908286-119908308 TCCTCAGGCTGCACACAGCATGG + Intergenic
1033144006 7:138855364-138855386 TTCTGATGCTGAACACAGCATGG - Intronic
1034967322 7:155399291-155399313 TGCTGGGTCTCCACGCAGCAGGG - Intergenic
1035149929 7:156861365-156861387 TCCTGAGGCTGCACAGAGCAGGG + Intronic
1035281401 7:157780712-157780734 TGATGGGGCCACACCCAGCACGG + Intronic
1036824222 8:11963774-11963796 TGTTGGGGCCACTCACAGCAGGG + Intergenic
1039834905 8:41248541-41248563 GGCTGGGGCTGCTCACAGCATGG - Intergenic
1040835987 8:51731858-51731880 TCCTGAGACTGCACACAGCAAGG + Intronic
1043834738 8:85033394-85033416 TTCCTAGGCTGCACACAGCATGG + Intergenic
1044028085 8:87198735-87198757 TTCTGTGGCTATACACTGCAGGG + Intronic
1044220467 8:89663615-89663637 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
1045139808 8:99267951-99267973 TACTAAGGCTGCACACAGCAAGG - Intronic
1045610995 8:103841526-103841548 TTCTGGAGCTACACACTGATTGG - Intronic
1045940102 8:107728669-107728691 TCCCTAGGCTACACACAGCATGG + Intergenic
1046107409 8:109682824-109682846 TCCTGAGGCTGAACACAGCAGGG - Intronic
1046309424 8:112415213-112415235 TCCTGAGGCTGCACAGAGCAGGG - Intronic
1046359426 8:113131350-113131372 TCCTGAGGCTGCACAGAGCAAGG - Intronic
1046432055 8:114140297-114140319 TTCTGGGGCAAGACATAGCATGG - Intergenic
1047502909 8:125455837-125455859 TTCTGTGGGAACACACAGGAGGG + Intergenic
1047924476 8:129669481-129669503 TCCCTGGGCTGCACACAGCAGGG - Intergenic
1048172393 8:132119902-132119924 TTCTGTGGAAACACAAAGCATGG - Intergenic
1048189284 8:132273412-132273434 TCCTTAGGCTGCACACAGCATGG + Intronic
1048537710 8:135312984-135313006 TTCTGAGACTGCACAAAGCAGGG + Intergenic
1050255587 9:3789243-3789265 TCCTGAGGCTGCACACAGCATGG - Intergenic
1051382232 9:16470565-16470587 TTCCTAGGCTGCACACAGCATGG - Intronic
1051986573 9:23096471-23096493 TCCTGAGGCTTCACTCAGCAGGG - Intergenic
1052124235 9:24755779-24755801 TTCCTAGGCTACACAAAGCAGGG - Intergenic
1052594095 9:30536727-30536749 TTCCTAGGCTGCACACAGCATGG - Intergenic
1052879070 9:33589441-33589463 TCCTGAGGCTACACACAGCAGGG - Intergenic
1052915801 9:33923615-33923637 TGCTGGATCTAAACACAGCAGGG + Intronic
1052969448 9:34368159-34368181 TCCCTGGGCTGCACACAGCAAGG + Exonic
1053077908 9:35150724-35150746 GGCTGGGGCTACACACTCCATGG + Intergenic
1053187663 9:36032206-36032228 TTCCTGAGCTCCACACAGCAAGG + Intergenic
1053496906 9:38554778-38554800 TCCTGAGGCTACACACAGCAGGG + Intronic
1056092188 9:83216356-83216378 TCCCTAGGCTACACACAGCAAGG - Intergenic
1057161404 9:92890913-92890935 TCCTGAGGATGCACACAGCAGGG + Intergenic
1057279263 9:93698469-93698491 GTCGGGGGCTGCACACAGCTGGG + Intergenic
1057676816 9:97142335-97142357 TCCTGAGGCTGCACACTGCAGGG + Intergenic
1058181694 9:101807621-101807643 TTCCTAGGCTCCACACAGCATGG - Intergenic
1058527208 9:105871688-105871710 TTCTGTGGGAGCACACAGCAGGG + Intergenic
1059069529 9:111120660-111120682 TCCCGAGGCTGCACACAGCAGGG + Intergenic
1059601386 9:115783172-115783194 TCCTGAGGCTGCACACAACAGGG - Intergenic
1059715411 9:116908593-116908615 TTCTGGAGCCACACAGAACAAGG - Intronic
1203376912 Un_KI270442v1:383939-383961 TTCTGGGACCCCACAGAGCACGG + Intergenic
1185797704 X:2981196-2981218 TTCCAAGGCTGCACACAGCAGGG - Intergenic
1186324017 X:8459152-8459174 TTCCTAGGCTACACACAGCACGG + Intergenic
1187072390 X:15901196-15901218 TCTTTAGGCTACACACAGCAGGG + Intergenic
1187097391 X:16162561-16162583 TCCCTGGGCTGCACACAGCAGGG + Intergenic
1187962851 X:24583234-24583256 TGCTTGGGCTTCTCACAGCATGG - Intronic
1188062519 X:25618397-25618419 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
1188865149 X:35305282-35305304 TCCTGAGGCTGCACACAGCAGGG - Intergenic
1189815750 X:44822885-44822907 TCCTGAGGCTACATAGAGCAGGG - Intergenic
1190048405 X:47130868-47130890 TTCTGGGGATATATAAAGCAGGG - Intergenic
1190217353 X:48488835-48488857 TTCTGGGGTCACACAGAGTAGGG - Intergenic
1190235691 X:48613687-48613709 TTCTGGTGTCACACAGAGCAGGG - Intergenic
1190513316 X:51195845-51195867 TTCCCAGGCTGCACACAGCATGG + Intergenic
1190950584 X:55139538-55139560 TTCTGAGGCTGCACAGAGCAGGG - Intronic
1192846260 X:74909765-74909787 TTCCTAGGCTGCACACAGCATGG - Intronic
1193256457 X:79354832-79354854 GTCTGAGGCTGCACAGAGCAAGG - Intergenic
1193540088 X:82760626-82760648 ATATGGGGTTACACACATCAAGG + Intergenic
1193796911 X:85888192-85888214 TCCTTAGGCTTCACACAGCAGGG - Intronic
1194049666 X:89053386-89053408 TCCTGAGGCTACACACAGCAGGG + Intergenic
1194092880 X:89600305-89600327 TCCTGAGGCTGCACACTGCAGGG + Intergenic
1194542413 X:95190559-95190581 TTCCTGGGCTGCACACAGCAGGG + Intergenic
1194554249 X:95337767-95337789 TCCTGAGGCTGCACAGAGCAGGG + Intergenic
1194893251 X:99406587-99406609 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
1195154516 X:102109877-102109899 TCCTTAGGCAACACACAGCAGGG - Intergenic
1195554892 X:106210623-106210645 ATCCTGGGCTGCACACAGCACGG + Intergenic
1196543662 X:116937842-116937864 TTCTGAGGCTACACAGAGCAAGG + Intergenic
1197057059 X:122134528-122134550 TCTTGAGGCTGCACACAGCAGGG - Intergenic
1197088695 X:122510459-122510481 TCCTGAGGCTGCACACAGAAAGG + Intergenic
1197109592 X:122756654-122756676 TTCCGGGGCTGCACAGAGCAGGG + Intergenic
1197160598 X:123318141-123318163 TCCCTGGGCTGCACACAGCACGG + Intronic
1197301733 X:124789216-124789238 TTCCTAGGCTGCACACAGCAGGG + Intronic
1197340996 X:125266372-125266394 TCCCTAGGCTACACACAGCATGG - Intergenic
1197499068 X:127222046-127222068 TTCCTAGGCTGCACACAGCACGG - Intergenic
1197858736 X:130947327-130947349 ATCTGGGGCTACACACTGCAGGG + Intergenic
1198090401 X:133323041-133323063 TTCTTTGACTTCACACAGCAGGG - Intronic
1198274644 X:135089336-135089358 TCCTGAGGCTGCACAGAGCAGGG - Intergenic
1198734590 X:139772087-139772109 TCCCTAGGCTACACACAGCACGG - Intronic
1198775254 X:140172635-140172657 TCCTGAGGCTACACAGACCACGG - Intergenic
1199033039 X:143023125-143023147 TTCTGTGGCTACAAACAGCAAGG - Intergenic
1199206978 X:145160242-145160264 TCCTGAGACTGCACACAGCAGGG + Intergenic
1199309559 X:146307303-146307325 TTCTGAGGCTGCACAGAGCAGGG - Intergenic
1200354313 X:155532008-155532030 ATCAGTGGCTACACACTGCAGGG + Intronic
1200445519 Y:3256408-3256430 TCCTGAGGCTTCACACTGCAGGG + Intergenic
1202091357 Y:21194244-21194266 TTCCTAGGCTGCACACAGCATGG - Intergenic