ID: 1091811887

View in Genome Browser
Species Human (GRCh38)
Location 12:3406228-3406250
Sequence TCTGGGGCTACACACAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 2, 2: 15, 3: 88, 4: 521}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811872_1091811887 23 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811887 12:3406228-3406250 TCTGGGGCTACACACAGCAGGGG 0: 1
1: 2
2: 15
3: 88
4: 521
1091811877_1091811887 13 Left 1091811877 12:3406192-3406214 CCAAGGATGGAGCAGCTGGGATT 0: 1
1: 0
2: 13
3: 150
4: 669
Right 1091811887 12:3406228-3406250 TCTGGGGCTACACACAGCAGGGG 0: 1
1: 2
2: 15
3: 88
4: 521
1091811874_1091811887 21 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811887 12:3406228-3406250 TCTGGGGCTACACACAGCAGGGG 0: 1
1: 2
2: 15
3: 88
4: 521
1091811873_1091811887 22 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811887 12:3406228-3406250 TCTGGGGCTACACACAGCAGGGG 0: 1
1: 2
2: 15
3: 88
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811887 Original CRISPR TCTGGGGCTACACACAGCAG GGG Intronic
900352282 1:2240906-2240928 TCAGGGGCTGAACACAGCTGAGG - Intronic
900360272 1:2284899-2284921 TTTGGTGCCACACACAGCACAGG + Intronic
900521059 1:3105790-3105812 GAAGGGGCTGCACACAGCAGTGG - Intronic
900602664 1:3509721-3509743 TCTGGGCCAACACACCTCAGAGG - Intronic
900738347 1:4314441-4314463 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
901230804 1:7640853-7640875 TCCGGGGCCACAGACAGGAGTGG + Intronic
902823143 1:18955829-18955851 TCTGGAGCTACACGCAGGTGCGG - Exonic
903191992 1:21662095-21662117 TCTGGGGCTGCACCCTGCATTGG - Intronic
905325145 1:37146515-37146537 TCTGGAGCCAGGCACAGCAGTGG + Intergenic
906647076 1:47482989-47483011 TCTGGGGCCACAGAGAACAGAGG - Intergenic
907862960 1:58371700-58371722 CCTGAGGCTTCACAGAGCAGGGG - Intronic
908006890 1:59736965-59736987 CTTGAGGCTGCACACAGCAGGGG - Intronic
908329598 1:63058034-63058056 TCTGGGTATATACTCAGCAGTGG - Intergenic
908773031 1:67613324-67613346 TCTGGGGCTCCTCAGAGAAGTGG - Intergenic
908963547 1:69730097-69730119 CCTGAAGCTGCACACAGCAGGGG + Intronic
909269205 1:73601143-73601165 CCTGAGGCTACACACAGCAGGGG + Intergenic
911040371 1:93586549-93586571 TCTGGGTATATACCCAGCAGTGG + Intronic
911666100 1:100554472-100554494 TCTGGGTAGACACACAGTAGAGG + Intergenic
911812085 1:102295827-102295849 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
911817157 1:102368185-102368207 CTTGGGGCTGCACAGAGCAGTGG - Intergenic
912135509 1:106656237-106656259 TCCTAGGCTACACACAGCATGGG + Intergenic
912387582 1:109279827-109279849 TCTGGGGCTGACCACAACAGTGG + Exonic
912735901 1:112149399-112149421 TCTGAGGCTACACAGAGTAGTGG - Intergenic
914351651 1:146845105-146845127 CCTTAGGCTGCACACAGCAGGGG + Intergenic
915579368 1:156804282-156804304 TCTGTGGCTCCACAGAGCATGGG - Intergenic
915885648 1:159718237-159718259 TCCTGGGCTGCACAGAGCAGCGG - Intergenic
915983207 1:160436087-160436109 TTTGGGCGTACACCCAGCAGTGG - Intergenic
917036307 1:170750741-170750763 CCTAGAGGTACACACAGCAGGGG - Intergenic
917432894 1:174989179-174989201 TCTCAGGGTAGACACAGCAGAGG - Intronic
918180415 1:182082130-182082152 TCTAGGGCTAAACACAGAAGGGG - Intergenic
918591532 1:186246098-186246120 CCTGAGGCTGCACACAGCAGGGG + Intergenic
918935144 1:190912245-190912267 TCTTAGGCTGCACAAAGCAGAGG + Intergenic
919418390 1:197340335-197340357 ACTGGTGCCACCCACAGCAGTGG - Intronic
921416449 1:214893381-214893403 TTTTGGTATACACACAGCAGTGG - Intergenic
922725758 1:227922300-227922322 TCAGGGGCTGCCCTCAGCAGGGG + Intronic
923519988 1:234727948-234727970 TCAGCGGCTGCACACATCAGTGG + Intergenic
923729166 1:236533892-236533914 TCTGGGGTCAGAGACAGCAGTGG - Intronic
923878398 1:238075631-238075653 CCTGGGGCTGCACAGAGCAGTGG + Intergenic
923890965 1:238214576-238214598 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
1063055068 10:2495765-2495787 CCTCAGGCTGCACACAGCAGAGG + Intergenic
1063428223 10:5966022-5966044 TCTGAGGCTAAACACACCAGTGG - Intronic
1063682154 10:8199145-8199167 TCTGGAGGTACAGACATCAGGGG - Intergenic
1065508458 10:26453856-26453878 TTTGGGTATACACCCAGCAGTGG - Intronic
1065609076 10:27453052-27453074 TTTGGGTATATACACAGCAGTGG + Intergenic
1065889638 10:30110016-30110038 TCAGGAGCTTCACACATCAGTGG - Intronic
1066154251 10:32657577-32657599 CCTGAGGCTGCACAGAGCAGGGG + Intronic
1066514143 10:36137129-36137151 TTTGGGAATACACCCAGCAGTGG + Intergenic
1068002626 10:51353786-51353808 TTTGGGTATACACCCAGCAGTGG - Intronic
1068160207 10:53253515-53253537 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
1068215608 10:53978447-53978469 CCTGAGGCTATACACAGCAGGGG + Intronic
1068222085 10:54057539-54057561 CATGAGGATACACACAGCAGAGG + Intronic
1068264239 10:54626407-54626429 TCCCTGGCTGCACACAGCAGGGG - Intronic
1068805804 10:61192729-61192751 CCAGAGGCTGCACACAGCAGGGG + Intergenic
1069255798 10:66330571-66330593 TCTGGGTATACACCCAGCAATGG + Intronic
1069820438 10:71224213-71224235 TCTGTGTCTACATACAGAAGTGG - Intronic
1070758960 10:79011300-79011322 CCTGGGGCTAAAAACAGAAGGGG + Intergenic
1070946968 10:80400370-80400392 TGTGGCAATACACACAGCAGTGG + Intergenic
1071244879 10:83751764-83751786 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
1071550087 10:86560133-86560155 TCCTAGGCTACACACAGCATGGG + Intergenic
1071569031 10:86686405-86686427 TCTCCCACTACACACAGCAGGGG - Intronic
1073810984 10:107152027-107152049 CCTGAGGCTGCACAGAGCAGTGG - Intronic
1073875653 10:107918797-107918819 TCAGGGGCTTCACACTACAGGGG + Intergenic
1073910990 10:108344157-108344179 TTTGAAGCTACACACAGCAAAGG + Intergenic
1073993977 10:109294907-109294929 TCCTGGGCTACACACAGCACAGG - Intergenic
1074306970 10:112287986-112288008 TCGGGGGCTAAATACAGCATGGG + Intronic
1075291791 10:121237078-121237100 TCTGGGCCACCACAGAGCAGTGG + Intergenic
1075579906 10:123609536-123609558 CCTGGGGCCACAGACAGAAGGGG - Intergenic
1075758449 10:124835732-124835754 TCTTGGAGGACACACAGCAGTGG + Exonic
1076230925 10:128819485-128819507 TCTGGGGGAACACCGAGCAGAGG + Intergenic
1076922810 10:133464415-133464437 TCTGGGTCTATACACAGCAGTGG + Intergenic
1077208731 11:1358176-1358198 CCTGGTGCTGCACAAAGCAGGGG - Intergenic
1077979591 11:7286385-7286407 CCTGAGGCTGCACACAGCAGGGG + Intronic
1078115253 11:8442379-8442401 ACTGGTGCAGCACACAGCAGGGG + Intronic
1078834867 11:15017554-15017576 ACTGAGGTTTCACACAGCAGGGG - Intronic
1079537007 11:21526798-21526820 CCTGAAGCTGCACACAGCAGAGG + Intronic
1080746020 11:35109437-35109459 CCTGGGGCTACATAGAGCAGGGG - Intergenic
1081402721 11:42661700-42661722 ACTGGGGGTACAGACGGCAGTGG + Intergenic
1081867553 11:46367839-46367861 CCTGGGGCGGCCCACAGCAGGGG - Intronic
1082948023 11:58780719-58780741 TCCAAGGCTGCACACAGCAGGGG + Intergenic
1083148297 11:60774507-60774529 TGTGGGGCTGCACAGAGCAGTGG - Intronic
1083506242 11:63160272-63160294 ACTAAGGCTGCACACAGCAGGGG - Intronic
1084085156 11:66851661-66851683 TCTGTGGCCACACGCAGCAGGGG - Intronic
1084677730 11:70646084-70646106 TCTGGGGGTCCACACAGCTCTGG - Intronic
1086503634 11:87479398-87479420 CCTAAGGCTGCACACAGCAGGGG - Intergenic
1086538923 11:87884509-87884531 TCTGGGCCTTCACATAGCAATGG + Intergenic
1086936132 11:92747397-92747419 CCTGAGGCTGCACAGAGCAGGGG + Intronic
1087385482 11:97463867-97463889 CCTGAGGCTACACACAGCAAGGG - Intergenic
1087474349 11:98618197-98618219 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
1087908311 11:103724716-103724738 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
1088447737 11:109950217-109950239 CCAGAGGCTCCACACAGCAGGGG + Intergenic
1088455399 11:110028096-110028118 TGTGGGGAAACACACAGGAGGGG + Intergenic
1089137739 11:116263178-116263200 TCTGAGGCTTCTCAGAGCAGGGG - Intergenic
1090360955 11:126172233-126172255 TCTGCTACTACTCACAGCAGAGG + Intergenic
1090596846 11:128329481-128329503 TCTGGGGCTAAAAATACCAGAGG + Intergenic
1090842749 11:130507183-130507205 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
1091025998 11:132141851-132141873 ACGGGGGCCACACACAGGAGGGG + Intronic
1091599655 12:1910059-1910081 TCTGGGCATACACCCAGGAGTGG - Intronic
1091811887 12:3406228-3406250 TCTGGGGCTACACACAGCAGGGG + Intronic
1093123422 12:15300118-15300140 TCTGAGGCTGTACACAACAGGGG + Intronic
1093604994 12:21078448-21078470 TTCTGGGCTACACACAGCAGGGG + Intronic
1094039696 12:26109965-26109987 TCTGGGGCTAGTTACATCAGGGG + Intergenic
1094421192 12:30272934-30272956 CCTGAGGCTACATAGAGCAGGGG + Intergenic
1095181158 12:39147761-39147783 TTTGGGTATATACACAGCAGTGG + Intergenic
1095640902 12:44483766-44483788 TCTGAGGCTGCACACAGCAGGGG + Intergenic
1096197622 12:49658693-49658715 TCTAGGGCAACAAGCAGCAGGGG + Intronic
1096435981 12:51591352-51591374 TCTGGGGCGACTTACGGCAGCGG - Exonic
1096963929 12:55609293-55609315 TCTGGGGAGACACCCAGTAGTGG + Intergenic
1097141946 12:56909340-56909362 TCTGAGGCTATGTACAGCAGCGG - Intergenic
1097377990 12:58860989-58861011 TCTGATGCTGCAGACAGCAGGGG + Intergenic
1097443950 12:59646289-59646311 CTTGAGGCTGCACACAGCAGGGG - Intronic
1098917411 12:76272020-76272042 TGTGGGGCTAGAAACATCAGGGG + Intergenic
1099390189 12:82070085-82070107 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
1099468747 12:83020245-83020267 TCTAGGGCTCAACACAGCACTGG + Intronic
1099524467 12:83702632-83702654 TTTGGGTATACACACAGTAGTGG - Intergenic
1099621250 12:85005312-85005334 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
1100032359 12:90208985-90209007 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
1100407137 12:94281410-94281432 CCTGGGACTACAGAAAGCAGTGG + Intronic
1101726117 12:107389713-107389735 GCTGGGGCTACAGATAGCCGGGG + Intronic
1102668917 12:114600796-114600818 CCTGAGGCTGCACACAGCTGTGG - Intergenic
1103179421 12:118896629-118896651 TTTGGGTATACACACAGCAATGG - Intergenic
1103263472 12:119609566-119609588 TCTGAGGCTGCACACAGCAGGGG - Intronic
1103264553 12:119618028-119618050 CCAGAGGCTGCACACAGCAGGGG - Intronic
1103545193 12:121695882-121695904 TTTGGTGCTACACCCAGAAGTGG + Intergenic
1103822849 12:123712417-123712439 TATGGGGCTCCAGACTGCAGCGG - Exonic
1104487367 12:129163096-129163118 TCTTGGGCAAGACACAGAAGGGG + Intronic
1104808085 12:131602166-131602188 CCTGAGGCTGCGCACAGCAGGGG + Intergenic
1104928275 12:132324961-132324983 ACTGGGGCTTCCCAAAGCAGGGG + Intronic
1105258561 13:18761563-18761585 CCTGAGGCTGCACACAGCAGTGG + Intergenic
1105259878 13:18771092-18771114 CCTGAGGCTGCACACAGAAGGGG + Intergenic
1105261229 13:18780864-18780886 CCTGAGGCTGCACACAGCAGTGG + Intergenic
1105262558 13:18790415-18790437 CCTGAGGCTGCACACAGAAGGGG + Intergenic
1105263554 13:18797459-18797481 CCTGAGGCTGCACACAGCAGTGG + Intergenic
1105528928 13:21200730-21200752 ACTGAGGCTGCACAGAGCAGAGG + Intergenic
1105644592 13:22303439-22303461 CCTGAGGCTGCACACAGTAGGGG + Intergenic
1106496848 13:30286330-30286352 CCCGAGGCTGCACACAGCAGAGG - Intronic
1106917321 13:34529572-34529594 CCTTAGGCTGCACACAGCAGAGG - Intergenic
1106942765 13:34795837-34795859 CCTGAGGCTACACACAGCAGCGG - Intergenic
1108154562 13:47572511-47572533 TCCCAGGCTGCACACAGCAGGGG - Intergenic
1108247510 13:48532783-48532805 TCCGGGGCTACACCCAGCCCAGG - Intronic
1108612393 13:52096934-52096956 CCTGAGGCTGCACAGAGCAGTGG - Intronic
1109407350 13:61919016-61919038 CCTTAGGCTGCACACAGCAGGGG + Intergenic
1109655716 13:65387967-65387989 CCTTAGGCTGCACACAGCAGGGG - Intergenic
1109718333 13:66245956-66245978 TGTGAGGCTACATAGAGCAGGGG - Intergenic
1110250705 13:73377475-73377497 TCCCAGGCTGCACACAGCAGGGG + Intergenic
1110388933 13:74949198-74949220 TTTGGGTATACACCCAGCAGTGG - Intergenic
1110489549 13:76087175-76087197 TCTGAGGCTGCACAGAGTAGTGG + Intergenic
1110910881 13:80961364-80961386 TTTGGGTATATACACAGCAGTGG + Intergenic
1111339244 13:86862419-86862441 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
1111441299 13:88285564-88285586 CCTGAGGCTGCACACAGAAGGGG - Intergenic
1111606683 13:90547701-90547723 CCTGAGGCTGCACACAGCAGGGG + Intergenic
1111614350 13:90644150-90644172 CCTGAGGCTACACACAGCAGTGG + Intergenic
1111830565 13:93323930-93323952 TCTGGGTATATACCCAGCAGTGG - Intronic
1113388996 13:109877891-109877913 GCTGGGGCTACAATCATCAGAGG + Intergenic
1113452842 13:110424027-110424049 TCTGGGCATACAGAAAGCAGGGG - Intronic
1113693307 13:112327160-112327182 CCTGGGGGATCACACAGCAGTGG - Intergenic
1114134770 14:19834884-19834906 TCTGTGGCTACTCAGGGCAGGGG - Intergenic
1114210345 14:20608723-20608745 TCTGGGGTTGGACCCAGCAGTGG + Intronic
1114504962 14:23203421-23203443 TCTGGGTCTATACCCAGTAGTGG + Intronic
1115010568 14:28540205-28540227 TCCAAGGCTGCACACAGCAGGGG - Intergenic
1115623367 14:35164277-35164299 TTTGGGTATACACCCAGCAGTGG - Intronic
1115878753 14:37891729-37891751 TCCTAGGCTGCACACAGCAGGGG - Intronic
1115943047 14:38629557-38629579 CCTGAGGCTGCACACAGCAGGGG + Intergenic
1116119719 14:40706465-40706487 CCTCGGGCTGCACAGAGCAGCGG + Intergenic
1116263530 14:42660687-42660709 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
1117175181 14:53138778-53138800 GCTGGGGCTTCAGACACCAGAGG + Intronic
1117203659 14:53418395-53418417 TCTAAGGCTGCACTCAGCAGGGG - Intergenic
1117888724 14:60394103-60394125 TTTGGGTATACACCCAGCAGTGG + Intergenic
1117949958 14:61072880-61072902 TTTGGGTATACACTCAGCAGTGG + Intronic
1118037421 14:61883054-61883076 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
1118151404 14:63194740-63194762 CCTGAGGCTGCACACAGCAAGGG - Intergenic
1118956372 14:70486040-70486062 TCTGGGTATAAACTCAGCAGTGG - Intergenic
1119646838 14:76354306-76354328 TGTGGGGCTGCTGACAGCAGAGG + Intronic
1119903364 14:78280897-78280919 ACTCGGGCTACACACCTCAGAGG - Intronic
1120236626 14:81899177-81899199 TTTGGGTATACACCCAGCAGTGG + Intergenic
1120443649 14:84566861-84566883 TCAGAGGCTACTGACAGCAGAGG - Intergenic
1120654189 14:87169484-87169506 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
1120659061 14:87230887-87230909 CCTGAGGCTGCACACAGCAGGGG + Intergenic
1120818116 14:88884265-88884287 TCTGGAGCTACACACAGCAGAGG + Intergenic
1121237972 14:92406719-92406741 CCTGAGGCTGCACAGAGCAGTGG + Intronic
1122083044 14:99280137-99280159 TCAGGGGCTGCATACATCAGTGG - Intergenic
1122765544 14:104066893-104066915 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
1122851713 14:104536886-104536908 TCTGTGCCCACACACAGCTGTGG + Intronic
1202834882 14_GL000009v2_random:70581-70603 CCTGAGGCTGCACACAGCAGTGG - Intergenic
1123577820 15:21690457-21690479 TCTGTGGCTACTCAGGGCAGGGG - Intergenic
1123614444 15:22132938-22132960 TCTGTGGCTACTCAGGGCAGGGG - Intergenic
1124222207 15:27860801-27860823 TTTGGGTATACACTCAGCAGTGG + Intronic
1124658361 15:31526277-31526299 CCCAGGGCTACACACAGCATGGG - Intronic
1124843601 15:33268056-33268078 TTTGGGGCTGTACCCAGCAGTGG + Intergenic
1125304246 15:38291751-38291773 CCTTAGGCTACACACAGCACAGG + Intronic
1125360936 15:38864350-38864372 CCTGGAGCTACCCACACCAGGGG - Intergenic
1125395241 15:39240421-39240443 TCTGGGGGTCCACACAACATAGG - Intergenic
1126190576 15:45873840-45873862 CCTGAGGCTGCACACAGCAGGGG + Intergenic
1126825096 15:52540585-52540607 CCAGAGGCTGCACACAGCAGGGG + Intergenic
1127065851 15:55237353-55237375 TCTGAGGAAACACACTGCAGTGG - Intronic
1130038397 15:80382308-80382330 TTTGGGCTTACACCCAGCAGTGG - Intronic
1130092118 15:80829746-80829768 TCTGGGGCTGTGCACATCAGAGG + Intronic
1130126211 15:81096209-81096231 TCTGGGTCTCCACACACCTGAGG - Intronic
1130421856 15:83756077-83756099 TTTGGGTATATACACAGCAGTGG + Intronic
1131730507 15:95275009-95275031 ACTGGGTCTACACACTCCAGAGG + Intergenic
1132114175 15:99123797-99123819 TATGGGGCTGCACAGAGCAGTGG + Intronic
1202986689 15_KI270727v1_random:424702-424724 TCTGTGGCTACTCAGGGCAGGGG - Intergenic
1132973359 16:2699755-2699777 GCTGGGGCCACAGGCAGCAGTGG + Intronic
1133175548 16:4011359-4011381 TCTGGGGCCACGGGCAGCAGGGG + Intronic
1134228267 16:12408864-12408886 TCTGTGACTGCACATAGCAGGGG - Intronic
1136291854 16:29278133-29278155 TCTTGAGCTGCACACAGCTGGGG + Intergenic
1138039194 16:53643685-53643707 TCAGTGGCTATACACAGCAGAGG + Intronic
1138126549 16:54443463-54443485 GCTGGGGCTGCACACATCTGAGG - Intergenic
1138663873 16:58546028-58546050 TCTGGGACTTCACACAACAAAGG + Intronic
1138692056 16:58777381-58777403 TCGGGGGCTCCACCCACCAGTGG - Intergenic
1138798843 16:60001734-60001756 CCTGAGGCTGCACACAGCAGGGG - Intergenic
1138845563 16:60561201-60561223 TCTGGGTAGACACACAGTAGTGG + Intergenic
1139204400 16:65013226-65013248 TCTGGGGCTAGACAATGCAGAGG + Intronic
1139982383 16:70870430-70870452 CCTTAGGCTGCACACAGCAGGGG - Intronic
1140248272 16:73271048-73271070 TCTGGGGTGACATCCAGCAGGGG - Intergenic
1142097746 16:88252093-88252115 TCTTGAGCTGCACACAGCTGGGG + Intergenic
1142392891 16:89814388-89814410 TTTGCGACTACACACACCAGTGG + Intronic
1142831797 17:2554640-2554662 TTTGGGTCTACACCCAGAAGTGG + Intergenic
1143260513 17:5595142-5595164 CCTGGAGCACCACACAGCAGTGG - Intronic
1143683107 17:8492223-8492245 CCTGGGCCTTCACACAGGAGCGG - Intronic
1146303803 17:31714042-31714064 TTTGGGAATACACCCAGCAGTGG - Intergenic
1146817875 17:35958604-35958626 GCTGGGGCAACACACAGCTGGGG + Intergenic
1147215865 17:38898681-38898703 TCTGGGGGTACACAGAGAAGAGG - Intronic
1147417461 17:40303569-40303591 TCATGTGCTACACACACCAGTGG - Exonic
1148648432 17:49232432-49232454 CCTAGAGCTAAACACAGCAGGGG - Intergenic
1149339704 17:55672666-55672688 TCTGAGGCTGCACAGAGCAGGGG + Intergenic
1150198356 17:63325489-63325511 GCTAGGGCAACACACAGCTGGGG - Intronic
1151922381 17:77166967-77166989 TCTGGGGAGAAACACATCAGAGG - Intronic
1152186920 17:78863055-78863077 TTTGGGTATACACCCAGCAGTGG + Intronic
1153385024 18:4483270-4483292 TCTGAGGATACACAAAGGAGAGG + Intergenic
1153423010 18:4929677-4929699 TCAGGGGCAAAACACAGCTGGGG + Intergenic
1153837096 18:8973204-8973226 TTTGGGAATACACCCAGCAGTGG + Intergenic
1154424796 18:14263944-14263966 CCTGAGGCTGCACACAGCAGTGG - Intergenic
1154427479 18:14283279-14283301 CCTGAGGCTGTACACAGCAGTGG - Intergenic
1154430205 18:14302815-14302837 CCTGAGGCTGCACACAGCAGTGG - Intergenic
1154432486 18:14319167-14319189 CCTGAGGCTGCACACAGCAGTGG - Intergenic
1155116347 18:22772118-22772140 TTTGGGTATATACACAGCAGTGG - Intergenic
1155605986 18:27606469-27606491 GCTGGGTCTTCACATAGCAGAGG + Intergenic
1155892148 18:31283599-31283621 TCTGGGTATATACACAGCAATGG + Intergenic
1156169388 18:34463623-34463645 TCTAAGGCTGCACACAGAAGGGG + Intergenic
1156344311 18:36241933-36241955 CCTGAGGCTACACACAGCAGTGG + Intronic
1157485536 18:48084424-48084446 TCTGGGTTGACTCACAGCAGTGG + Intronic
1157760355 18:50259090-50259112 TTTGGGCCTATACTCAGCAGTGG - Intronic
1158299267 18:56033523-56033545 CCTGAGGCTGCACAGAGCAGAGG + Intergenic
1159288825 18:66390618-66390640 TCTCAGGCTGCACAAAGCAGGGG - Intergenic
1160042472 18:75358478-75358500 GCTGGGCCTACACACAGGAGCGG - Intergenic
1160057849 18:75502226-75502248 TTTGGGTTTATACACAGCAGTGG + Intergenic
1160062257 18:75542758-75542780 TCTGGGGTTAGATACGGCAGGGG + Intergenic
1160976269 19:1794227-1794249 GCTTGGGCTTGACACAGCAGAGG + Intronic
1161106620 19:2446792-2446814 TCTGGGTCCACACCCAGGAGTGG - Intronic
1162298306 19:9828311-9828333 GCTGGAGCTACACAAAGCGGGGG - Exonic
1162517552 19:11158157-11158179 TTTGGGGCTATACCCAGAAGTGG - Intergenic
1163072713 19:14857947-14857969 TTTGGGTATACACCCAGCAGTGG + Intergenic
1164456823 19:28414873-28414895 TTTGGGTCTATACCCAGCAGTGG + Intergenic
1166535402 19:43570993-43571015 GCAGGGGCCACACACAGGAGTGG - Intronic
1166793376 19:45411294-45411316 TTTGGGGATATACCCAGCAGTGG + Intronic
1202637821 1_KI270706v1_random:57111-57133 CCTGAGGCTGCACACAGCAGTGG + Intergenic
925022039 2:578500-578522 TCTCAGGCTACACATAGCAGTGG - Intergenic
926391930 2:12402693-12402715 CCGGAGGCTGCACACAGCAGTGG - Intergenic
926456548 2:13074264-13074286 CCTGAGGCTTCACACAGCAGGGG + Intergenic
926461074 2:13130440-13130462 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
927341919 2:21992517-21992539 TCAAGGACTGCACACAGCAGTGG + Intergenic
927389786 2:22582324-22582346 CCTGTGTCTGCACACAGCAGGGG - Intergenic
927473155 2:23391390-23391412 TCTGGGTCTATACCCAGAAGTGG + Intronic
930611587 2:53550282-53550304 TCAGTGGCTACACACAGTGGGGG + Intronic
930762193 2:55049677-55049699 TCTGGGGCTGCACACAAAAGAGG + Intronic
931041401 2:58305064-58305086 CCTAAGGCTGCACACAGCAGGGG - Intergenic
931079418 2:58752734-58752756 CCTGAGACTGCACACAGCAGGGG - Intergenic
933070868 2:77856936-77856958 CCTGAGGCTCCACAGAGCAGTGG - Intergenic
933451161 2:82453867-82453889 TGTGGGTATATACACAGCAGTGG - Intergenic
933906134 2:86895040-86895062 CCTGGTGCTATACACAGGAGTGG + Intergenic
934932052 2:98434759-98434781 TCAAGGGCTACTGACAGCAGGGG + Intergenic
935323076 2:101907212-101907234 TCTGAGGCTGCATAGAGCAGGGG + Intergenic
935417167 2:102831207-102831229 TTTGGGTATACACCCAGCAGTGG + Intronic
935766978 2:106378218-106378240 CCTGGTGCTATACACAGGAGTGG + Intergenic
935911754 2:107904214-107904236 CCTGGTGCTATACACAGGAGTGG + Intergenic
936366028 2:111856619-111856641 CCTGGTGCTATACACAGGAGTGG - Exonic
936728967 2:115357954-115357976 ACCGAGGCTATACACAGCAGGGG + Intronic
936921376 2:117692121-117692143 TCTGGGGCCAGACAAAGCAAGGG - Intergenic
936937737 2:117854164-117854186 TCTGGGGCCAGTCACAGCAGGGG + Intergenic
937356270 2:121199992-121200014 TCCGGGGCTCCACATAGCCGAGG + Intergenic
937970444 2:127545332-127545354 TCTGAGGCCACACACAGCAGCGG + Intronic
938139871 2:128786741-128786763 TCTGGGGATAGACCCAGAAGTGG + Intergenic
938718193 2:134040041-134040063 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
939077976 2:137626060-137626082 TCTGAGGCAACACAGGGCAGTGG + Intronic
939256703 2:139753050-139753072 TCTGGGTATATACCCAGCAGTGG + Intergenic
939263475 2:139840193-139840215 TCTGGGTATACACCCAGTAGTGG + Intergenic
939724560 2:145700529-145700551 TTTGGGTATACACTCAGCAGCGG + Intergenic
939784677 2:146494650-146494672 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
939830389 2:147064248-147064270 CCTGAGGTTGCACACAGCAGGGG - Intergenic
939985868 2:148829487-148829509 TCTGTGGCTTCACAGAGCTGAGG + Intergenic
940143740 2:150523596-150523618 GCTGAGGCTGCACACAGTAGTGG - Intronic
940402908 2:153267592-153267614 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
940444770 2:153764798-153764820 CCCTGGGCTGCACACAGCAGGGG - Intergenic
940499626 2:154477945-154477967 CCTGAGGCTGCATACAGCAGAGG - Intergenic
941535492 2:166718267-166718289 TCTGGGGCTGCCCAAAGAAGTGG - Intergenic
941888363 2:170552850-170552872 CCTGAGGCTGCACAGAGCAGTGG - Intronic
942313880 2:174681653-174681675 TCTGGGGCTACACGCAGCCAGGG + Intronic
943037951 2:182769326-182769348 TCTGGGTCTATACCCAGTAGTGG + Intronic
943448543 2:188019853-188019875 TCTGAGGCTGAACACAGCATGGG - Intergenic
945739674 2:213644884-213644906 TGTGGCTCTACACTCAGCAGGGG + Intronic
945930974 2:215854534-215854556 TCTGAGGCTGCATAGAGCAGGGG - Intergenic
946373326 2:219293878-219293900 TCTGGGGCTAGGAAAAGCAGGGG + Intronic
946874472 2:224114158-224114180 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
947276317 2:228396160-228396182 CCTGAGGCTATACACAGCAGTGG + Intergenic
947311733 2:228810268-228810290 TTTGGGTATACACCCAGCAGGGG + Intergenic
947328060 2:228999552-228999574 CCTGAGGCTGCACAGAGCAGTGG - Intronic
947903076 2:233738964-233738986 CCTGAGGCTGCACACAGCAGTGG - Intronic
947904490 2:233750629-233750651 CCTGAGGCTGCACACAGCAGGGG - Intronic
948150155 2:235738460-235738482 CCTGGGGCCACACACAGAACAGG + Intronic
948363287 2:237437645-237437667 TCTGGGGCTGCCCACAGAAATGG - Intergenic
948554473 2:238797865-238797887 TCTGGGTCTGCACCCACCAGGGG + Intergenic
948727575 2:239944342-239944364 CCTGGGGCCACACTCAGCATGGG - Intronic
948878888 2:240845727-240845749 TCCAAGGCTGCACACAGCAGGGG - Intergenic
1170176915 20:13481422-13481444 TTTGGGGATATACATAGCAGTGG + Intronic
1171163573 20:22950950-22950972 TCTGTAGCTACACACGGCTGGGG - Intergenic
1171884393 20:30641203-30641225 CCTGAGGCTGCACACAGCAGTGG + Intergenic
1173024870 20:39298626-39298648 TCCGGGGCAACAAACACCAGAGG + Intergenic
1173026159 20:39309485-39309507 TGTGTGGCTACATTCAGCAGGGG + Intergenic
1173323458 20:42010281-42010303 CCTGGGGCTGCACACAGCAGGGG + Intergenic
1174538520 20:51271315-51271337 TCTGGGTATATACCCAGCAGTGG - Intergenic
1175248986 20:57597568-57597590 CCTGGGATTACACACACCAGGGG + Intergenic
1175796732 20:61775959-61775981 TGTGGGGCCACACACAGCTTGGG - Intronic
1176092392 20:63325065-63325087 TCTGGGAGAACCCACAGCAGGGG - Intronic
1176103958 20:63377018-63377040 TCTGGGTGTAGACACAGCAGGGG + Intronic
1176231725 20:64036377-64036399 GCTGGGGGTACACACAGCTCAGG + Intronic
1176844552 21:13866582-13866604 CCTGAGGCTGCACACAGCAGTGG + Intergenic
1176847285 21:13886145-13886167 CCTGAGGCTGCACACAGCAGTGG + Intergenic
1177306080 21:19317524-19317546 CCTGGGGCTGCACAGAGCAGTGG + Intergenic
1177599200 21:23288982-23289004 CCTGAGGCTGTACACAGCAGTGG - Intergenic
1177606000 21:23378789-23378811 CCTGTGGCTGCACACAGCAGGGG - Intergenic
1177628753 21:23700227-23700249 CCTGAGGCTGCACACAGCAGAGG - Intergenic
1177761016 21:25402268-25402290 CCCTAGGCTACACACAGCAGGGG - Intergenic
1178046214 21:28696962-28696984 CCGGAGGCTGCACACAGCAGGGG + Intergenic
1178247372 21:30967050-30967072 CCTGGGGATCCACACATCAGTGG - Intergenic
1180880185 22:19197966-19197988 TCTGGAGCTCCACAGAGGAGGGG - Intronic
1182896857 22:33866110-33866132 TCTGGGCCTACCCAGAGCTGAGG - Intronic
1182999560 22:34843961-34843983 CCTGAGGCTGCACACAGCAAGGG - Intergenic
1183318732 22:37151076-37151098 TCTGGGTATATACTCAGCAGTGG + Intronic
1183358755 22:37372695-37372717 TCTGGGGCTAGAAACAGGTGTGG - Exonic
1183699483 22:39442638-39442660 TCTGGGTGTATACACAGAAGTGG - Intergenic
1184139398 22:42569622-42569644 TTTGGGCCTGCACACAGGAGGGG - Intronic
1184288201 22:43483804-43483826 TCTGTGGGCACACCCAGCAGGGG + Intronic
1184338849 22:43874386-43874408 CCTAAGGCTGCACACAGCAGGGG - Intergenic
1184656747 22:45945798-45945820 TCCTGGGCTGCACACAGCAGGGG - Intronic
1185011781 22:48318689-48318711 TGTGGGTATACACCCAGCAGTGG + Intergenic
949611718 3:5709822-5709844 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
950999355 3:17539843-17539865 TTTGGGGATACACCCAGAAGTGG + Intronic
952188173 3:30993169-30993191 TCCCTGGCTGCACACAGCAGGGG + Intergenic
952344323 3:32469768-32469790 TCTGGGGCAAACGACAGCAGAGG + Intronic
952368583 3:32697264-32697286 TCTGGGGTTGCTAACAGCAGTGG + Intronic
952538802 3:34344470-34344492 TCTGGGTATATACGCAGCAGTGG - Intergenic
953035057 3:39203911-39203933 TCTGGGGCTACACAGAGTTGTGG + Intergenic
953232715 3:41078782-41078804 TCTGGAGCTAGACACAGGAAGGG + Intergenic
954370786 3:50168685-50168707 TCTGGGGCTCCTCACAGCTTTGG + Intronic
954484649 3:50836543-50836565 CCTTAGGCTGCACACAGCAGTGG + Intronic
956149465 3:66225444-66225466 CCTGAGGCTGCACACAGCAAGGG + Intronic
957471806 3:80668323-80668345 CCAGAGGCTGCACACAGCAGGGG - Intergenic
957524104 3:81358018-81358040 CCCGGGGCTACACAGAGTAGTGG - Intergenic
958157340 3:89771588-89771610 CCTTAGGCTGCACACAGCAGAGG + Intergenic
958474896 3:94568658-94568680 CCTGAGGCTACAAAGAGCAGTGG - Intergenic
958582555 3:96045245-96045267 TCAGAGGCTACACACAGCAGTGG + Intergenic
958583884 3:96061416-96061438 CCTGAGGCTGCGCACAGCAGCGG - Intergenic
958955185 3:100458979-100459001 TCCAAGGCTGCACACAGCAGGGG + Intergenic
959507891 3:107176072-107176094 CCCAAGGCTACACACAGCAGCGG - Intergenic
961199430 3:125032557-125032579 ACTGGGGTTACAGACAACAGTGG + Intronic
961519850 3:127460722-127460744 TTTGGGGCTAAACATACCAGTGG - Intergenic
962609082 3:137058033-137058055 TGTAGGGCTTCACACAGCAAGGG - Intergenic
962689161 3:137876341-137876363 TTTGGATATACACACAGCAGTGG - Intergenic
963058159 3:141204458-141204480 TCTGGGGCTGCAGACAGCCAGGG - Intergenic
963068871 3:141286034-141286056 ACTGGGCCTTCAGACAGCAGGGG + Intronic
963124109 3:141799076-141799098 TCGGCTGCTCCACACAGCAGAGG - Intronic
963297080 3:143558056-143558078 CCTGAGGCTGCACAGAGCAGGGG - Intronic
963363254 3:144303416-144303438 CCTTAGGCTACACACAGCAGGGG + Intergenic
963433758 3:145242062-145242084 CCTGAAGCTGCACACAGCAGGGG + Intergenic
965092859 3:164183846-164183868 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
965251514 3:166349702-166349724 TCTTAGACTGCACACAGCAGAGG - Intergenic
965321467 3:167256974-167256996 TTTGGGTATACACCCAGCAGTGG + Intronic
965392761 3:168125355-168125377 TATGGGTATATACACAGCAGAGG + Intergenic
966164825 3:177005959-177005981 TCTGAGGCTACACATGGCAGTGG - Intergenic
966972784 3:185060858-185060880 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
967564631 3:190959351-190959373 TCTGAGGCTGCAAAGAGCAGAGG - Intergenic
967622590 3:191651082-191651104 CCCTGGGCTTCACACAGCAGGGG + Intergenic
968345177 3:197998082-197998104 TCTTGGGCTCCACATAGCAGTGG + Intronic
969083671 4:4639705-4639727 TTTGGGGATACACCCAGAAGTGG - Intergenic
971119614 4:23689333-23689355 CCCGAGGCAACACACAGCAGAGG - Intergenic
971440421 4:26679251-26679273 CCTGAGGCTGCACAGAGCAGGGG - Intronic
971598976 4:28568633-28568655 TCTGAGGCTGCACATAGGAGTGG + Intergenic
972012823 4:34205928-34205950 CCTGAGGCTTCACAGAGCAGGGG - Intergenic
972051701 4:34743214-34743236 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
972236989 4:37146443-37146465 GCTGAGGCCACACACAGCAGCGG - Intergenic
972393629 4:38636735-38636757 TCTTGTTCTACACATAGCAGGGG + Intergenic
972468099 4:39377324-39377346 TTTGGGTATACACTCAGCAGTGG + Intergenic
972857305 4:43121971-43121993 TTTGGGCATATACACAGCAGTGG - Intergenic
972872103 4:43312962-43312984 CCTTAGGCTACACACAGCAGGGG - Intergenic
972879492 4:43406583-43406605 CCTGAGGCTGCACACAGCAGGGG - Intergenic
973368049 4:49223476-49223498 CCTGAGGCTGCACACAGCAGTGG + Intergenic
973393001 4:49571950-49571972 CCTGAGGCTGCACACAGCAGTGG - Intergenic
974666579 4:64969709-64969731 CCTGAGGCTGCACATAGCAGGGG + Intergenic
975230207 4:71924037-71924059 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
975517756 4:75265806-75265828 TCTGGGTAGACACCCAGCAGTGG - Intergenic
976365782 4:84230734-84230756 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
977041481 4:92024631-92024653 TCCTAGGCTGCACACAGCAGGGG + Intergenic
977396529 4:96478552-96478574 CCTGAGGCTGCACAAAGCAGCGG - Intergenic
977435424 4:96989182-96989204 ACTTAGGCTACACACAGCAGGGG - Intergenic
977471347 4:97447506-97447528 ACTGAGGCTGCACAGAGCAGTGG - Intronic
978676653 4:111326669-111326691 TCTGGGGCTACAAATAACAAAGG + Intergenic
979885596 4:126024313-126024335 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
980280111 4:130707671-130707693 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
980430193 4:132684124-132684146 CCTGAGGCTGCACACAGCAGGGG + Intergenic
980586063 4:134817331-134817353 TCTCAGGCTTCACACAGTAGGGG + Intergenic
980742774 4:136973624-136973646 TCTGGGGCCAAACAGAGCAGGGG + Intergenic
981200417 4:141973115-141973137 CCTTAGTCTACACACAGCAGGGG + Intergenic
981359597 4:143831436-143831458 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
981370356 4:143952504-143952526 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
981380115 4:144062428-144062450 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
981407236 4:144385697-144385719 CCTGAGGCTGCACATAGCAGAGG + Intergenic
983657535 4:170098367-170098389 CCTTAGGCTGCACACAGCAGGGG + Intergenic
983888862 4:173010514-173010536 TTTGGGTATACACCCAGCAGTGG + Intronic
983889454 4:173015931-173015953 CCTGAGGCCACACAGAGCAGGGG - Intronic
984627645 4:182025521-182025543 TTTGGGTATACACCCAGCAGTGG + Intergenic
985350734 4:189058655-189058677 TCTGGGACGACAGACAACAGCGG - Intergenic
1202765143 4_GL000008v2_random:142968-142990 CCTGAGGCTGCACACAGCAGTGG + Intergenic
985489829 5:172624-172646 TCTGGGCCCACACACAGGGGAGG - Intronic
985945082 5:3175626-3175648 TCTGGGGCTCCACACCCCTGCGG - Intergenic
986560310 5:9054114-9054136 CCTGGGGCTGCACACAGAAGAGG - Exonic
987404665 5:17512479-17512501 CCTAGGTCTACACACAGCAGTGG + Intergenic
987412276 5:17626202-17626224 CCTCGGTCTACACACAGCAGTGG + Intergenic
987659533 5:20854830-20854852 TCCTAGGCTGCACACAGCAGGGG - Intergenic
987709073 5:21486158-21486180 TCCTAGGCTGCACACAGCAGGGG + Intergenic
987861990 5:23500630-23500652 TCTGGGGCTTCACAGAACAGTGG + Intergenic
987869083 5:23589468-23589490 TCTGGGTATATACCCAGCAGTGG - Intergenic
987881469 5:23750878-23750900 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
988014065 5:25530354-25530376 TCCTCGGCTGCACACAGCAGAGG - Intergenic
988113720 5:26855726-26855748 TCTGAGGCAACACAGGGCAGTGG + Intergenic
988353282 5:30140708-30140730 TGTGGGTATACACCCAGCAGTGG + Intergenic
988473913 5:31565848-31565870 CCTGAGGCTACACAGAGCAGGGG + Intergenic
988561494 5:32285656-32285678 TGTGGGGGTAGACACAGCTGTGG - Intronic
988750539 5:34187995-34188017 TCCTAGGCTGCACACAGCAGGGG - Intergenic
988764112 5:34350816-34350838 TCCTAGGCTGCACACAGCAGGGG + Intergenic
989389163 5:40882502-40882524 CCCGAGGCTACACACAGCATGGG - Intergenic
990108469 5:52293379-52293401 CCTGAGGCTGCACACAGCAGGGG + Intergenic
991136228 5:63185626-63185648 TCTGAGGCTGCATAGAGCAGCGG - Intergenic
991735679 5:69629909-69629931 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991738804 5:69651193-69651215 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991759393 5:69905234-69905256 TCCTAGGCTGCACACAGCAGGGG + Intergenic
991787942 5:70212884-70212906 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991790379 5:70230934-70230956 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991812170 5:70485548-70485570 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991815128 5:70506025-70506047 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991818264 5:70527310-70527332 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991838621 5:70780300-70780322 TCCTAGGCTGCACACAGCAGGGG + Intergenic
991880388 5:71213248-71213270 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991882829 5:71231274-71231296 TCCTAGGCTGCACACAGCAGGGG - Intergenic
991940842 5:71850531-71850553 CCTGAGGATGCACACAGCAGGGG + Intergenic
994421198 5:99527501-99527523 TCCTAGGCTGCACACAGCAGGGG + Intergenic
994485845 5:100386813-100386835 TCCTAGGCTGCACACAGCAGGGG - Intergenic
994590799 5:101769305-101769327 CCTGAGGCTGCACACAGCAGGGG + Intergenic
994592338 5:101789054-101789076 CCTGAGGCTGCACAGAGCAGCGG - Intergenic
994749577 5:103721374-103721396 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
995337655 5:111019486-111019508 TCTGGGTCTGGACACAGGAGAGG + Intergenic
995389714 5:111626988-111627010 CCAGAGGCTGCACACAGCAGGGG - Intergenic
995390949 5:111639863-111639885 TCTGAGGCTGCACAGAGAAGGGG - Intergenic
998339036 5:141399969-141399991 CCTGGGGCTGCGCACAGGAGAGG + Exonic
998678702 5:144439692-144439714 TCTGGGGTCACACTCAGCTGAGG - Intronic
998759066 5:145411998-145412020 CCTGAGGCTGCACACAGCAGGGG + Intergenic
999281561 5:150369664-150369686 TCTGGGGCTTCAGACACCAGTGG + Intronic
1000049767 5:157552331-157552353 TTTGGGTCTATACTCAGCAGTGG - Intronic
1000575387 5:162969675-162969697 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
1001171070 5:169419486-169419508 TCTGGGGAGAGACACAGCTGTGG + Intergenic
1001451238 5:171826183-171826205 GCTGGGCCAACACACTGCAGTGG + Intergenic
1001554424 5:172626261-172626283 GCTGTGGCCACACACAACAGGGG + Intergenic
1001696419 5:173673648-173673670 TCTGGCGCTGCACACCGCACAGG + Intergenic
1001943807 5:175761086-175761108 TCTGAGGCTGCACACAGTAGAGG - Intergenic
1002420285 5:179142750-179142772 TCAGTGGCTGCACACTGCAGGGG + Intronic
1002757095 6:172478-172500 CCTTGGGCTGCACACAGCAGTGG - Intergenic
1005548611 6:26894300-26894322 TCCTGGGCTGCACACAGCAGGGG - Intergenic
1006305003 6:33213531-33213553 GCTGGGGGTACCCAGAGCAGAGG - Intergenic
1006345799 6:33481390-33481412 TCTGGGCGTATACCCAGCAGAGG - Intergenic
1007807706 6:44462864-44462886 TTTGCTGCTCCACACAGCAGGGG + Intergenic
1008337518 6:50324862-50324884 CCCTAGGCTACACACAGCAGGGG + Intergenic
1008546044 6:52584555-52584577 CCTGAGGCTGCACACATCAGGGG - Intergenic
1009019367 6:57935407-57935429 TCCTAGGCTGCACACAGCAGGGG - Intergenic
1009732954 6:67634181-67634203 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
1010014989 6:71094381-71094403 TTTGGGTGTACACCCAGCAGTGG - Intergenic
1010458231 6:76083069-76083091 TCTGAGGCTGCACAGAGCAGGGG + Intergenic
1010596839 6:77774150-77774172 TCTGGGTATACACCTAGCAGTGG - Intronic
1010981752 6:82376774-82376796 TCTGAGGCTGCACACAGCAGGGG + Intergenic
1011663861 6:89616822-89616844 CCTGGGGCTGCTCAGAGCAGGGG - Intronic
1011870435 6:91886132-91886154 CCTGAGGCTGCACACAGCAGGGG - Intergenic
1012617393 6:101293595-101293617 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
1012768257 6:103396958-103396980 CCTGAGGCTTCACACAGCAGAGG - Intergenic
1013213706 6:108008514-108008536 TCTGAGGCTGCATAGAGCAGGGG + Intergenic
1013910665 6:115272501-115272523 TCAGAGACTGCACACAGCAGGGG - Intergenic
1014143643 6:117971800-117971822 TCTGGGGCTACATAGAGGACAGG + Intronic
1014475982 6:121872530-121872552 TCCTAGGCTGCACACAGCAGGGG + Intergenic
1014562995 6:122913763-122913785 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
1015969642 6:138730992-138731014 CCCTGGGCTACACACAGCACAGG + Intergenic
1016187976 6:141221390-141221412 CCAGGGGCAGCACACAGCAGGGG + Intergenic
1016512929 6:144863833-144863855 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
1016540553 6:145159455-145159477 CCTGAGGCTGCACACAGCAGGGG - Intergenic
1016790250 6:148060271-148060293 CCTAAGGCTGCACACAGCAGGGG + Intergenic
1017535606 6:155344951-155344973 TCTGGGTATATACACAGCAATGG + Intergenic
1017975468 6:159353184-159353206 TCTGGGGCTACAGACAACCTGGG - Intergenic
1018924956 6:168199422-168199444 TTTGGGTCTACGCCCAGCAGTGG - Intergenic
1020388284 7:7631735-7631757 TCTGAGGCTGCACATAGCAGCGG - Intergenic
1020394167 7:7694888-7694910 TTTGGGGATACACCTAGCAGTGG + Intronic
1020696506 7:11420309-11420331 CCTGAGGCTGCACAGAGCAGTGG - Intronic
1020729657 7:11865883-11865905 CTTGAGGCTGCACACAGCAGGGG - Intergenic
1021096301 7:16539662-16539684 CCTGAGGCTGCACAGAGCAGCGG - Intronic
1021323514 7:19239992-19240014 CCTGAGGCTGCACATAGCAGGGG + Intergenic
1022023473 7:26423791-26423813 TTTGGGGCCACTCACTGCAGTGG - Intergenic
1022214877 7:28249079-28249101 TCTAGGTGTACACACAGAAGTGG - Intergenic
1022495701 7:30851782-30851804 TCTTGGGCTACACACCCCTGGGG + Intronic
1022728827 7:33004215-33004237 TCCCGGGTCACACACAGCAGTGG + Intronic
1023236829 7:38098990-38099012 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
1024865852 7:53904479-53904501 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
1025748698 7:64271574-64271596 CCTGAGGCTTCACAGAGCAGTGG - Intergenic
1026905804 7:74062090-74062112 TCAGGGGCTACAGACAGCGTGGG - Intronic
1027996945 7:85436098-85436120 TTTGGGTATACACCCAGCAGTGG - Intergenic
1028745331 7:94320642-94320664 TCCTGGGCTGCACACAGCATGGG + Intergenic
1028957752 7:96713025-96713047 CCTGAGGCTGCATACAGCAGGGG - Intergenic
1031668881 7:124518870-124518892 CCTGAGGCTCCACAGAGCAGTGG - Intergenic
1031768618 7:125812733-125812755 TCCAGGACTACACTCAGCAGAGG - Intergenic
1034967321 7:155399290-155399312 GCTGGGTCTCCACGCAGCAGGGG - Intergenic
1035149931 7:156861366-156861388 CCTGAGGCTGCACAGAGCAGGGG + Intronic
1036706145 8:11048736-11048758 TCTGGGGCTTCACAGGACAGGGG - Intronic
1040103342 8:43524290-43524312 ACTGAGGCTGCACACAGCAGTGG - Intergenic
1040632882 8:49237029-49237051 TCTGTAGCTACAAACAGCAAAGG - Intergenic
1042886159 8:73554418-73554440 TCTGGGGCTACCCAGAGGACTGG - Intronic
1043201223 8:77372328-77372350 CCTGTGGCTTCACAGAGCAGTGG - Intergenic
1043480159 8:80644696-80644718 TCTGGGGTCACACTCAGCTGAGG + Intronic
1043805927 8:84671711-84671733 ACCAAGGCTACACACAGCAGTGG + Intronic
1044009898 8:86981914-86981936 TCTGGGTTAACACACAGAAGTGG + Intronic
1044220469 8:89663616-89663638 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
1045426133 8:102067685-102067707 TCTGGGGCTACAAATTCCAGAGG - Intronic
1045562163 8:103274987-103275009 TCAGAGGCTGCACACTGCAGGGG - Intergenic
1046107407 8:109682823-109682845 CCTGAGGCTGAACACAGCAGGGG - Intronic
1046309422 8:112415212-112415234 CCTGAGGCTGCACAGAGCAGGGG - Intronic
1046839478 8:118841235-118841257 CCTGGGGCTACACAGAGCAGTGG - Intergenic
1047502910 8:125455838-125455860 TCTGTGGGAACACACAGGAGGGG + Intergenic
1047924474 8:129669480-129669502 CCCTGGGCTGCACACAGCAGGGG - Intergenic
1048537711 8:135312985-135313007 TCTGAGACTGCACAAAGCAGGGG + Intergenic
1048933978 8:139340151-139340173 GCTGGGAGCACACACAGCAGAGG - Intergenic
1050255585 9:3789242-3789264 CCTGAGGCTGCACACAGCATGGG - Intergenic
1050356681 9:4790545-4790567 TTTGGGTATACACGCAGCAGTGG - Intergenic
1051986571 9:23096470-23096492 CCTGAGGCTTCACTCAGCAGGGG - Intergenic
1051990418 9:23145684-23145706 CCTGAGGCTGCACAGAGCAGTGG + Intergenic
1052124234 9:24755778-24755800 TCCTAGGCTACACAAAGCAGGGG - Intergenic
1052878636 9:33586349-33586371 CCTGAGGCTGCACATAGCAGTGG - Intergenic
1052879068 9:33589440-33589462 CCTGAGGCTACACACAGCAGGGG - Intergenic
1052915802 9:33923616-33923638 GCTGGATCTAAACACAGCAGGGG + Intronic
1053264278 9:36699139-36699161 TCTGAGGCTGCACAGAGCAGCGG + Intergenic
1053496908 9:38554779-38554801 CCTGAGGCTACACACAGCAGGGG + Intronic
1053665736 9:40316352-40316374 TCTGAGGCTGCACATAGAAGAGG - Intronic
1056806513 9:89733146-89733168 ACTGGCTCTACACAGAGCAGAGG + Intergenic
1056811929 9:89771749-89771771 GATGGGGCTACACACTGCTGAGG + Intergenic
1057676818 9:97142336-97142358 CCTGAGGCTGCACACTGCAGGGG + Intergenic
1058527209 9:105871689-105871711 TCTGTGGGAGCACACAGCAGGGG + Intergenic
1058670985 9:107360199-107360221 TCAGGGGATACCGACAGCAGTGG + Intergenic
1058834090 9:108845704-108845726 TTTGGGGCTGTACACATCAGTGG - Intergenic
1059069531 9:111120661-111120683 CCCGAGGCTGCACACAGCAGGGG + Intergenic
1059300469 9:113308458-113308480 TCAGATGCTGCACACAGCAGAGG - Intergenic
1059601384 9:115783171-115783193 CCTGAGGCTGCACACAACAGGGG - Intergenic
1059809330 9:117838367-117838389 TCTTCAGCTACACAGAGCAGTGG + Intergenic
1061922491 9:133789644-133789666 CTTGGGGCTCCACACAGCGGCGG - Intronic
1203545891 Un_KI270743v1:127857-127879 CCTGAGGCTGCACACAGCAGTGG + Intergenic
1185797703 X:2981195-2981217 TCCAAGGCTGCACACAGCAGGGG - Intergenic
1186324018 X:8459153-8459175 TCCTAGGCTACACACAGCACGGG + Intergenic
1186401857 X:9267650-9267672 TCAAGGTCTAAACACAGCAGTGG - Intergenic
1186456597 X:9714644-9714666 TCTGAGGCTGCACCCAGCTGAGG - Intronic
1187097393 X:16162562-16162584 CCCTGGGCTGCACACAGCAGGGG + Intergenic
1188062521 X:25618398-25618420 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
1188202599 X:27309469-27309491 TCAGAAGCTACACACTGCAGTGG + Intergenic
1188478962 X:30617907-30617929 TCTGGGGTCACACTCAGCTGAGG - Intergenic
1188633543 X:32399721-32399743 TTTGGGTATATACACAGCAGTGG - Intronic
1188807868 X:34613944-34613966 TCGTAGGCTGCACACAGCAGTGG + Intergenic
1188833427 X:34928595-34928617 CCTGAGGCTTCACAGAGCAGCGG + Intergenic
1189592062 X:42524058-42524080 TCAGGGGATTCACACTGCAGAGG - Intergenic
1189815748 X:44822884-44822906 CCTGAGGCTACATAGAGCAGGGG - Intergenic
1190493170 X:51002981-51003003 GCAGGGGCTACACAGAGCAGAGG - Intergenic
1190511328 X:51176684-51176706 GCAGGGGCCACACAGAGCAGAGG + Intergenic
1190950583 X:55139537-55139559 TCTGAGGCTGCACAGAGCAGGGG - Intronic
1191656529 X:63604798-63604820 TCTGAGGCTGCACAAAGCATTGG - Intergenic
1192131917 X:68559557-68559579 CCTGAGGCTCCACACAGCAGTGG + Intergenic
1192335596 X:70216825-70216847 TCTTAGACTGCACACAGCAGTGG - Intergenic
1192821065 X:74646105-74646127 TTTGGGTATACACCCAGCAGTGG + Intergenic
1192842421 X:74870957-74870979 TTTGGGTATACACCCAGCAGTGG - Intronic
1193256456 X:79354831-79354853 TCTGAGGCTGCACAGAGCAAGGG - Intergenic
1193421855 X:81292419-81292441 CCTGAGGCTGCACAGAGCAGTGG + Intronic
1193530728 X:82651024-82651046 GCTGGGGCTACACACTTCTGTGG - Intergenic
1193674035 X:84425455-84425477 TTTGGATATACACACAGCAGTGG - Intronic
1193682660 X:84541302-84541324 CCTCAGGCTGCACACAGCAGGGG - Intergenic
1193795263 X:85866196-85866218 TCCAGGGCTGCACAGAGCAGTGG - Intronic
1193796909 X:85888191-85888213 CCTTAGGCTTCACACAGCAGGGG - Intronic
1193883397 X:86955097-86955119 TCTGGGTATATACCCAGCAGTGG - Intergenic
1194049668 X:89053387-89053409 CCTGAGGCTACACACAGCAGGGG + Intergenic
1194092882 X:89600306-89600328 CCTGAGGCTGCACACTGCAGGGG + Intergenic
1194218340 X:91160666-91160688 TTTGGGTATACACCCAGCAGTGG + Intergenic
1194471796 X:94305822-94305844 TTTGGGTATACACCCAGCAGTGG - Intergenic
1194514577 X:94836003-94836025 TTTGGGTATACACCCAGCAGTGG + Intergenic
1194542414 X:95190560-95190582 TCCTGGGCTGCACACAGCAGGGG + Intergenic
1194554251 X:95337768-95337790 CCTGAGGCTGCACAGAGCAGGGG + Intergenic
1194756280 X:97743192-97743214 TATGAGGCTGCATACAGCAGGGG - Intergenic
1194843587 X:98775925-98775947 CCTCAGGCTGCACACAGCAGAGG - Intergenic
1194893249 X:99406586-99406608 CCTGAGGCTGCACAGAGCAGGGG - Intergenic
1195083525 X:101392689-101392711 TCTGGGTATATACCCAGCAGTGG - Intronic
1195154514 X:102109876-102109898 CCTTAGGCAACACACAGCAGGGG - Intergenic
1195542531 X:106079125-106079147 TTTGGGTCTATACCCAGCAGTGG + Intergenic
1196543663 X:116937843-116937865 TCTGAGGCTACACAGAGCAAGGG + Intergenic
1197057058 X:122134527-122134549 CTTGAGGCTGCACACAGCAGGGG - Intergenic
1197058897 X:122153707-122153729 CCCGAGGCTGCACACAGCAGAGG - Intergenic
1197301734 X:124789217-124789239 TCCTAGGCTGCACACAGCAGGGG + Intronic
1197858737 X:130947328-130947350 TCTGGGGCTACACACTGCAGGGG + Intergenic
1198076616 X:133199400-133199422 TCTGGGGATATACCCAGCAATGG + Intergenic
1198912796 X:141633457-141633479 CAAGAGGCTACACACAGCAGAGG - Intronic
1199139201 X:144289943-144289965 CCTGAGGCTGCACAGAGCAGTGG - Intergenic
1199153556 X:144519082-144519104 TTTGGGGATATACACAGCAATGG + Intergenic
1199206980 X:145160243-145160265 CCTGAGACTGCACACAGCAGGGG + Intergenic
1199309558 X:146307302-146307324 TCTGAGGCTGCACAGAGCAGGGG - Intergenic
1199686936 X:150273314-150273336 CCAGAGGCTGCACACAGCAGGGG - Intergenic
1200082289 X:153583785-153583807 TTTGGGCCTATACCCAGCAGTGG + Intergenic
1200433768 Y:3122325-3122347 TCTGGGTAGATACACAGCAGTGG - Intergenic
1200445521 Y:3256409-3256431 CCTGAGGCTTCACACTGCAGGGG + Intergenic
1200538256 Y:4425736-4425758 TCTGGGTGGATACACAGCAGGGG + Intergenic
1200554853 Y:4624454-4624476 TTTGGGTATACACCCAGCAGTGG + Intergenic
1200783993 Y:7242945-7242967 TCAGCTGCTACAGACAGCAGGGG - Intergenic
1201921564 Y:19239572-19239594 CCTGAGGCTTCACAGAGCAGTGG - Intergenic