ID: 1091811888

View in Genome Browser
Species Human (GRCh38)
Location 12:3406229-3406251
Sequence CTGGGGCTACACACAGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 1, 1: 2, 2: 39, 3: 156, 4: 624}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091811874_1091811888 22 Left 1091811874 12:3406184-3406206 CCTTTTAGCCAAGGATGGAGCAG 0: 1
1: 1
2: 137
3: 745
4: 1448
Right 1091811888 12:3406229-3406251 CTGGGGCTACACACAGCAGGGGG 0: 1
1: 2
2: 39
3: 156
4: 624
1091811872_1091811888 24 Left 1091811872 12:3406182-3406204 CCCCTTTTAGCCAAGGATGGAGC 0: 2
1: 12
2: 344
3: 1029
4: 1747
Right 1091811888 12:3406229-3406251 CTGGGGCTACACACAGCAGGGGG 0: 1
1: 2
2: 39
3: 156
4: 624
1091811877_1091811888 14 Left 1091811877 12:3406192-3406214 CCAAGGATGGAGCAGCTGGGATT 0: 1
1: 0
2: 13
3: 150
4: 669
Right 1091811888 12:3406229-3406251 CTGGGGCTACACACAGCAGGGGG 0: 1
1: 2
2: 39
3: 156
4: 624
1091811873_1091811888 23 Left 1091811873 12:3406183-3406205 CCCTTTTAGCCAAGGATGGAGCA 0: 1
1: 2
2: 144
3: 803
4: 1486
Right 1091811888 12:3406229-3406251 CTGGGGCTACACACAGCAGGGGG 0: 1
1: 2
2: 39
3: 156
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091811888 Original CRISPR CTGGGGCTACACACAGCAGG GGG Intronic
900207168 1:1436475-1436497 CTGGGCATGCACACAGCAGCAGG - Intronic
900216900 1:1486456-1486478 CAGGGGCTCCACACTCCAGGTGG + Intronic
900323806 1:2097625-2097647 CTGGGGGTGCACACAACATGGGG - Intronic
900738348 1:4314442-4314464 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
901735532 1:11309934-11309956 CTAGGGCTGCCCACAGGAGGTGG + Intergenic
902389197 1:16092905-16092927 CTGGGAGTGCACAAAGCAGGAGG - Intergenic
902542244 1:17163577-17163599 CGGGGGTGACAGACAGCAGGAGG - Intergenic
903289130 1:22296889-22296911 CTTGGGCTTCCCACAGCAGGTGG + Intergenic
904550405 1:31311960-31311982 CTGTGTCTTCACACAGCAGAAGG - Intronic
906352814 1:45078702-45078724 CTGAGGCTCCAATCAGCAGGTGG + Intronic
906754105 1:48292504-48292526 CTAGGGGTGCACACAACAGGAGG + Intergenic
906937277 1:50225482-50225504 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
907650815 1:56293212-56293234 CTGGGGCCATACAGAGCAGTTGG - Intergenic
907862959 1:58371699-58371721 CTGAGGCTTCACAGAGCAGGGGG - Intronic
907890908 1:58635759-58635781 CTTAGACTGCACACAGCAGGGGG - Intergenic
908090987 1:60685683-60685705 CCTAGGCTGCACACAGCAGGGGG - Intergenic
908963548 1:69730098-69730120 CTGAAGCTGCACACAGCAGGGGG + Intronic
909068458 1:70963649-70963671 CCTGGCCTGCACACAGCAGGGGG + Intronic
909250206 1:73344132-73344154 CCTAGGCTGCACACAGCAGGGGG - Intergenic
910103080 1:83599207-83599229 CTGAGGCTACACAGAGCAGCAGG + Intergenic
910763686 1:90759652-90759674 CTGGGGCTCCACTGAGAAGGAGG + Intergenic
911812084 1:102295826-102295848 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
911817156 1:102368184-102368206 TTGGGGCTGCACAGAGCAGTGGG - Intergenic
912084001 1:105976750-105976772 CAGCTGCTACACAGAGCAGGGGG - Intergenic
912135511 1:106656238-106656260 CCTAGGCTACACACAGCATGGGG + Intergenic
912206033 1:107510570-107510592 CCTAGGCTGCACACAGCAGGGGG - Intergenic
912735293 1:112144968-112144990 CTGGGGCAGCTCAGAGCAGGAGG + Intergenic
912735900 1:112149398-112149420 CTGAGGCTACACAGAGTAGTGGG - Intergenic
913402195 1:118448752-118448774 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
914351652 1:146845106-146845128 CTTAGGCTGCACACAGCAGGGGG + Intergenic
914747641 1:150511516-150511538 CTGGTGCTGCACGCGGCAGGGGG + Exonic
915579367 1:156804281-156804303 CTGTGGCTCCACAGAGCATGGGG - Intergenic
916120739 1:161525865-161525887 CTGGGGCTGGAGACAGCAGGTGG + Exonic
916130506 1:161607498-161607520 CTGGGGCTGGAGACAGCAGGTGG + Intronic
916340084 1:163723782-163723804 CTGGGGCTACAAAAAACTGGAGG + Intergenic
916444015 1:164855307-164855329 CTGGGAATGAACACAGCAGGAGG - Intronic
916829218 1:168474270-168474292 CTGAGGCTGCACAGAGCAGCCGG - Intergenic
917488817 1:175479804-175479826 ATGCGGCTACCCACAGCAGCTGG - Intronic
918591533 1:186246099-186246121 CTGAGGCTGCACACAGCAGGGGG + Intergenic
918668246 1:187178736-187178758 CTGAGGCTGCACAAAGCAGCAGG + Intergenic
919388751 1:196954847-196954869 GTGAGGCTGCACACAGCAGCAGG + Intronic
919726412 1:200887635-200887657 GTGGGGCCACAGAAAGCAGGGGG + Intergenic
919835380 1:201569670-201569692 CTGGGGCTGCACACAGAGAGGGG + Intergenic
923088718 1:230722075-230722097 CAGAGGCTGCACAGAGCAGGCGG - Intergenic
923406555 1:233666752-233666774 CTGGGGCTTCTCCAAGCAGGTGG + Exonic
923878399 1:238075632-238075654 CTGGGGCTGCACAGAGCAGTGGG + Intergenic
923890966 1:238214577-238214599 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
924648687 1:245903818-245903840 CCGAGGCTGCACACTGCAGGGGG + Intronic
924936581 1:248777208-248777230 CTGAGGCTACACAGAACAGCTGG - Intergenic
1063055069 10:2495766-2495788 CTCAGGCTGCACACAGCAGAGGG + Intergenic
1063428222 10:5966021-5966043 CTGAGGCTAAACACACCAGTGGG - Intronic
1063682153 10:8199144-8199166 CTGGAGGTACAGACATCAGGGGG - Intergenic
1064881571 10:20060548-20060570 CTGGGCCTAGGCACAACAGGGGG - Intronic
1066047264 10:31604334-31604356 GTGGGGCTGCACACAGCAGCAGG + Intergenic
1068160206 10:53253514-53253536 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
1068215609 10:53978448-53978470 CTGAGGCTATACACAGCAGGGGG + Intronic
1068222086 10:54057540-54057562 ATGAGGATACACACAGCAGAGGG + Intronic
1068264237 10:54626406-54626428 CCCTGGCTGCACACAGCAGGGGG - Intronic
1068805805 10:61192730-61192752 CAGAGGCTGCACACAGCAGGGGG + Intergenic
1068908377 10:62351972-62351994 CTTAGGCTGCACACAGCATGGGG + Intergenic
1069980515 10:72249141-72249163 CGGGGGCCTCACCCAGCAGGAGG - Intergenic
1071107989 10:82121130-82121152 CTGGAGTTACACAGAGCAGATGG - Intronic
1071244878 10:83751763-83751785 CTGAGGCTGCACAGAGCAGGGGG - Intergenic
1071550089 10:86560134-86560156 CCTAGGCTACACACAGCATGGGG + Intergenic
1071873478 10:89819164-89819186 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1071990604 10:91097467-91097489 CCAAGGCTGCACACAGCAGGGGG + Intergenic
1073810983 10:107152026-107152048 CTGAGGCTGCACAGAGCAGTGGG - Intronic
1073942362 10:108713401-108713423 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1073993975 10:109294906-109294928 CCTGGGCTACACACAGCACAGGG - Intergenic
1075543705 10:123337475-123337497 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1075579905 10:123609535-123609557 CTGGGGCCACAGACAGAAGGGGG - Intergenic
1076534231 10:131166664-131166686 CTGCTGCTTCACACAGCAGATGG + Intronic
1076922811 10:133464416-133464438 CTGGGTCTATACACAGCAGTGGG + Intergenic
1077136552 11:1002349-1002371 CTGGGACTGCTCACAGCAGGCGG - Intronic
1077596657 11:3537759-3537781 CCGAGGCTGCTCACAGCAGGGGG + Intergenic
1077979592 11:7286386-7286408 CTGAGGCTGCACACAGCAGGGGG + Intronic
1078834866 11:15017553-15017575 CTGAGGTTTCACACAGCAGGGGG - Intronic
1078849504 11:15151122-15151144 CTGGGCCCCCACACAGCAGGAGG + Intronic
1079445910 11:20555944-20555966 CTCAGGCTGTACACAGCAGGGGG + Intergenic
1079465307 11:20724074-20724096 CTGAGGCTGCACAGAGCAGCTGG + Intronic
1079537008 11:21526799-21526821 CTGAAGCTGCACACAGCAGAGGG + Intronic
1080639302 11:34149479-34149501 CTGTGGCTGCTCATAGCAGGCGG + Intergenic
1080746019 11:35109436-35109458 CTGGGGCTACATAGAGCAGGGGG - Intergenic
1080966258 11:37217909-37217931 CTTAGGATTCACACAGCAGGGGG + Intergenic
1080997225 11:37618934-37618956 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1082641034 11:55661880-55661902 CAGGGGCTACTCCCAGCAGGTGG - Intergenic
1084252573 11:67911733-67911755 CCGAGGCTGCTCACAGCAGGGGG + Intergenic
1084319876 11:68367323-68367345 CTGGGGTTGCCCACAGCAGGTGG + Intronic
1084559355 11:69894056-69894078 CTGGGGGTGGTCACAGCAGGTGG - Intergenic
1084575943 11:69987984-69988006 CGGCTGCTACCCACAGCAGGGGG - Intergenic
1084960668 11:72714592-72714614 CTGGGTCTCCACACTGAAGGAGG + Intronic
1085158778 11:74321867-74321889 CTGGGGCCAAGCACAGCAGCTGG - Intergenic
1085374020 11:76041364-76041386 CTGGGGTTCCACGCAGCAGCTGG - Intronic
1086056542 11:82653902-82653924 CTAAGGCTGCACACAGCACGGGG - Intergenic
1086334104 11:85782320-85782342 TAGAGGCTGCACACAGCAGGGGG + Intronic
1086936133 11:92747398-92747420 CTGAGGCTGCACAGAGCAGGGGG + Intronic
1087385481 11:97463866-97463888 CTGAGGCTACACACAGCAAGGGG - Intergenic
1087474350 11:98618198-98618220 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
1087497571 11:98909995-98910017 CTGGGGCCACACAAAGCAGCAGG - Intergenic
1087908312 11:103724717-103724739 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
1088118724 11:106342227-106342249 CTGGGGCTACGTACAGAACGAGG + Intergenic
1088447738 11:109950218-109950240 CAGAGGCTCCACACAGCAGGGGG + Intergenic
1088500023 11:110473895-110473917 CTGGGCCAAGACAGAGCAGGAGG - Intergenic
1090228706 11:125086745-125086767 CTGAGGCTACACAGTGCTGGTGG + Intronic
1090439882 11:126716623-126716645 CTGGGCCTCCAAACACCAGGGGG + Intronic
1090504607 11:127297967-127297989 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1090692552 11:129199413-129199435 CCTAGGCTGCACACAGCAGGGGG - Intronic
1091086368 11:132725373-132725395 CTTAGGATGCACACAGCAGGGGG + Intronic
1091205007 11:133814732-133814754 CTGCTGCTACACACAGAAGCAGG - Intergenic
1091350684 11:134891824-134891846 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1091657034 12:2353504-2353526 CTGGGGCTCCCTGCAGCAGGAGG + Intronic
1091811888 12:3406229-3406251 CTGGGGCTACACACAGCAGGGGG + Intronic
1092342663 12:7689978-7690000 GTGGGGATACACACAGCCTGGGG + Exonic
1092422824 12:8346532-8346554 CCGAGGCTGCTCACAGCAGGGGG + Intergenic
1092936544 12:13369127-13369149 CTGTGTCCTCACACAGCAGGAGG + Intergenic
1093351034 12:18103401-18103423 CTGAGGCTGCACAGAGCAGCTGG + Intronic
1093353083 12:18128064-18128086 CCTGGGATGCACACAGCAGGAGG - Intronic
1093585834 12:20835174-20835196 ATGAGACTGCACACAGCAGGGGG + Intronic
1094421193 12:30272935-30272957 CTGAGGCTACATAGAGCAGGGGG + Intergenic
1095226749 12:39686503-39686525 CTGAGGCTGCACAGAGCAGCAGG + Intronic
1095395424 12:41757123-41757145 CTGAGGCTTCACAGAGCAGCAGG + Intergenic
1095640903 12:44483767-44483789 CTGAGGCTGCACACAGCAGGGGG + Intergenic
1095689303 12:45069298-45069320 CTGAGGCTGCACAGAGCAGGAGG + Intergenic
1096234704 12:49918240-49918262 CCAGGGTTACACACAGCAGGTGG - Intergenic
1096465923 12:51847869-51847891 CTGGGGCTACAGGCAACAAGGGG - Intergenic
1097377991 12:58860990-58861012 CTGATGCTGCAGACAGCAGGGGG + Intergenic
1097443949 12:59646288-59646310 TTGAGGCTGCACACAGCAGGGGG - Intronic
1097554031 12:61115373-61115395 TGGGGGCTGCACAAAGCAGGTGG - Intergenic
1097599259 12:61671066-61671088 TTGAGGCTGCACAGAGCAGGGGG + Intergenic
1098686934 12:73434054-73434076 CCTAGGCTACACAGAGCAGGGGG - Intergenic
1098917412 12:76272021-76272043 GTGGGGCTAGAAACATCAGGGGG + Intergenic
1099088605 12:78278178-78278200 CTAAGGCTGCACATAGCAGGGGG - Intergenic
1099096352 12:78379222-78379244 CCTAGGCTACACACAGCAAGGGG + Intergenic
1099105100 12:78486883-78486905 CCTGGGCTGCACACAGCATGGGG + Intergenic
1099390190 12:82070086-82070108 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
1099407427 12:82281533-82281555 CCAAGGCTACACATAGCAGGGGG - Intronic
1099621249 12:85005311-85005333 CTGAGGCTGCACAGAGCAGGGGG - Intergenic
1101083735 12:101214590-101214612 CCTAGGCTAGACACAGCAGGGGG - Intergenic
1101516413 12:105439579-105439601 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1101726118 12:107389714-107389736 CTGGGGCTACAGATAGCCGGGGG + Intronic
1102211757 12:111132286-111132308 CTTAGGCTGCACACAGCATGGGG + Intronic
1102493628 12:113304450-113304472 CTGGGGATGAACACAGTAGGAGG - Intronic
1102528634 12:113530187-113530209 CATAGGCTGCACACAGCAGGGGG - Intergenic
1102668916 12:114600795-114600817 CTGAGGCTGCACACAGCTGTGGG - Intergenic
1103263471 12:119609565-119609587 CTGAGGCTGCACACAGCAGGGGG - Intronic
1103264552 12:119618027-119618049 CAGAGGCTGCACACAGCAGGGGG - Intronic
1104038736 12:125115807-125115829 CTGGGACTGCACACAGATGGAGG + Intronic
1104257383 12:127151642-127151664 ACCGGGCCACACACAGCAGGAGG - Intergenic
1104442853 12:128808957-128808979 CTGGGGTGAAACACAGGAGGAGG + Intronic
1104808086 12:131602167-131602189 CTGAGGCTGCGCACAGCAGGGGG + Intergenic
1105257218 13:18751731-18751753 CTGAGGCTGCACACAGAGGGGGG + Intergenic
1105259879 13:18771093-18771115 CTGAGGCTGCACACAGAAGGGGG + Intergenic
1105261664 13:18784109-18784131 CTGAGGCTGCACACGGCAGCAGG + Intergenic
1105262559 13:18790416-18790438 CTGAGGCTGCACACAGAAGGGGG + Intergenic
1105264017 13:18800689-18800711 CTGAGGCTGCACACAGCAGCAGG + Intergenic
1105528929 13:21200731-21200753 CTGAGGCTGCACAGAGCAGAGGG + Intergenic
1105644593 13:22303440-22303462 CTGAGGCTGCACACAGTAGGGGG + Intergenic
1106496846 13:30286329-30286351 CCGAGGCTGCACACAGCAGAGGG - Intronic
1106917320 13:34529571-34529593 CTTAGGCTGCACACAGCAGAGGG - Intergenic
1106942764 13:34795836-34795858 CTGAGGCTACACACAGCAGCGGG - Intergenic
1108154560 13:47572510-47572532 CCCAGGCTGCACACAGCAGGGGG - Intergenic
1108612392 13:52096933-52096955 CTGAGGCTGCACAGAGCAGTGGG - Intronic
1108719673 13:53118034-53118056 CCTAGGCTACACACAGCATGGGG + Intergenic
1109036396 13:57267150-57267172 CTGGGGCTACAGACATGAGCTGG - Intergenic
1109109030 13:58292648-58292670 CTTACGCTGCACACAGCAGGGGG - Intergenic
1109276200 13:60306721-60306743 CTGAAGCTACACAGAGTAGGGGG + Intergenic
1109297553 13:60552910-60552932 CTGGGGCTGCACAGAGCAGCAGG + Intronic
1109324684 13:60853029-60853051 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1109334077 13:60970942-60970964 CCGAGACTGCACACAGCAGGGGG - Intergenic
1109655715 13:65387966-65387988 CTTAGGCTGCACACAGCAGGGGG - Intergenic
1109718332 13:66245955-66245977 GTGAGGCTACATAGAGCAGGGGG - Intergenic
1109823915 13:67692552-67692574 CCTAGGCTACACACAGCATGGGG + Intergenic
1110892961 13:80713086-80713108 CTGAGGCTGCACAGAGCAGTAGG + Intergenic
1110955362 13:81546730-81546752 CTGAGGCTGTACAGAGCAGGAGG + Intergenic
1111107753 13:83669106-83669128 CTGAGGCTGCACACAGCAGAAGG - Intergenic
1111339243 13:86862418-86862440 CTGAGGCTGCACAGAGCAGGGGG - Intergenic
1111358751 13:87146135-87146157 CTGAGGCTGCACACAGAAGAAGG - Intergenic
1111441298 13:88285563-88285585 CTGAGGCTGCACACAGAAGGGGG - Intergenic
1111441430 13:88286311-88286333 CCGAGGCTGCACAGAGCAGGGGG + Intergenic
1111606684 13:90547702-90547724 CTGAGGCTGCACACAGCAGGGGG + Intergenic
1111614351 13:90644151-90644173 CTGAGGCTACACACAGCAGTGGG + Intergenic
1112512213 13:100020052-100020074 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1112769669 13:102781807-102781829 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1113424988 13:110200382-110200404 CTGGGGCTGGGCACAGCAGCTGG + Intronic
1113693306 13:112327159-112327181 CTGGGGGATCACACAGCAGTGGG - Intergenic
1114134769 14:19834883-19834905 CTGTGGCTACTCAGGGCAGGGGG - Intergenic
1114687594 14:24548586-24548608 CTTAGGCTGCACACAGCATGGGG + Intergenic
1114778707 14:25514946-25514968 CTGAGACAGCACACAGCAGGGGG + Intergenic
1115010566 14:28540204-28540226 CCAAGGCTGCACACAGCAGGGGG - Intergenic
1115609089 14:35034647-35034669 CCAAGGCTGCACACAGCAGGGGG + Intergenic
1115878751 14:37891728-37891750 CCTAGGCTGCACACAGCAGGGGG - Intronic
1115893845 14:38061739-38061761 CCTGGGCTGCACACAGCAAGGGG + Intergenic
1115943048 14:38629558-38629580 CTGAGGCTGCACACAGCAGGGGG + Intergenic
1116130796 14:40854342-40854364 CTGGGCCTACACAGATGAGGGGG - Intergenic
1116263529 14:42660686-42660708 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
1116625122 14:47254056-47254078 CTGAGGCTGCATAGAGCAGGGGG + Intronic
1117084143 14:52181494-52181516 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1117085457 14:52196236-52196258 CTGAGGCTGCACAGAGCATGGGG - Intergenic
1117198533 14:53364432-53364454 CCTAGGCTACACACAGCATGGGG + Intergenic
1117203658 14:53418394-53418416 CTAAGGCTGCACTCAGCAGGGGG - Intergenic
1117427944 14:55620693-55620715 CCTAGGCTACATACAGCAGGGGG + Intronic
1117749205 14:58902945-58902967 CTGAGGCTGCACACAGCAGCTGG - Intergenic
1117783104 14:59255173-59255195 CTGGAACTTCACCCAGCAGGTGG - Intronic
1118151403 14:63194739-63194761 CTGAGGCTGCACACAGCAAGGGG - Intergenic
1118630007 14:67694276-67694298 CTGGAGCTACATACAGTAAGGGG - Intronic
1119433624 14:74584131-74584153 CTGGGTCTACAAGCAGCTGGGGG + Intronic
1119903363 14:78280896-78280918 CTCGGGCTACACACCTCAGAGGG - Intronic
1120378018 14:83733937-83733959 CCTAGGCTGCACACAGCAGGTGG - Intergenic
1120661626 14:87257666-87257688 CTGAGGCTACACAGAGCAGCAGG - Intergenic
1120818117 14:88884266-88884288 CTGGAGCTACACACAGCAGAGGG + Intergenic
1121237973 14:92406720-92406742 CTGAGGCTGCACAGAGCAGTGGG + Intronic
1121334553 14:93069423-93069445 CCAGGGCCACACACAGCAGCTGG - Intronic
1121655442 14:95592150-95592172 ATGAGGATACACACAGGAGGAGG + Intergenic
1122171098 14:99876405-99876427 CTGGTGCTGCACAGAGGAGGGGG - Intronic
1122765545 14:104066894-104066916 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
1122917948 14:104867425-104867447 CTGGGGCTCCCTTCAGCAGGGGG - Intronic
1202834428 14_GL000009v2_random:67326-67348 CTGAGGCTGCACACAGCAGCAGG - Intergenic
1124062341 15:26306030-26306052 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1124217215 15:27817333-27817355 CTGGGGCAACAGGCAGCAGATGG - Intronic
1124444944 15:29722304-29722326 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1124658359 15:31526276-31526298 CCAGGGCTACACACAGCATGGGG - Intronic
1125008710 15:34847169-34847191 CTGGGATTACAGGCAGCAGGGGG - Intergenic
1125304247 15:38291752-38291774 CTTAGGCTACACACAGCACAGGG + Intronic
1125360935 15:38864349-38864371 CTGGAGCTACCCACACCAGGGGG - Intergenic
1126190577 15:45873841-45873863 CTGAGGCTGCACACAGCAGGGGG + Intergenic
1126399855 15:48257687-48257709 CCTAGGCTGCACACAGCAGGGGG + Intronic
1126825097 15:52540586-52540608 CAGAGGCTGCACACAGCAGGGGG + Intergenic
1126942479 15:53781386-53781408 CCAAGGCTGCACACAGCAGGGGG + Intergenic
1127791048 15:62398985-62399007 CCAAGGCTGCACACAGCAGGGGG - Intronic
1128867489 15:71125656-71125678 CTGGGTCTGCACCCAGCTGGAGG - Intronic
1129900503 15:79144455-79144477 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1130422067 15:83757470-83757492 CCTAGGCTGCACACAGCAGGGGG + Intronic
1131651832 15:94408878-94408900 CTGGACCTACACACAAAAGGGGG - Intronic
1131849902 15:96527757-96527779 CTAGGGCTACACATAGCATTAGG - Intergenic
1131921410 15:97332711-97332733 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1132002519 15:98194257-98194279 CTCAGCCTGCACACAGCAGGAGG - Intergenic
1132121948 15:99183918-99183940 CCTAGGCTGCACACAGCAGGGGG - Intronic
1132973360 16:2699756-2699778 CTGGGGCCACAGGCAGCAGTGGG + Intronic
1133175549 16:4011360-4011382 CTGGGGCCACGGGCAGCAGGGGG + Intronic
1133755545 16:8759942-8759964 CTGCGATTACACACACCAGGAGG - Intronic
1134658207 16:15963715-15963737 CTAAGGCTGCACACATCAGGGGG + Intronic
1136366258 16:29810614-29810636 GAGGGGCTGCAGACAGCAGGGGG - Exonic
1137358695 16:47792253-47792275 CTGAGGCTTCACAGAGCAGCAGG + Intergenic
1137401549 16:48157579-48157601 CTGGGTGTACACACAGCTCGCGG + Intergenic
1137442309 16:48507835-48507857 CCGGGGCCACACAGAGCAGGAGG - Intergenic
1138126548 16:54443462-54443484 CTGGGGCTGCACACATCTGAGGG - Intergenic
1138798842 16:60001733-60001755 CTGAGGCTGCACACAGCAGGGGG - Intergenic
1139480955 16:67230463-67230485 CCTGGGCTACACCCCGCAGGCGG - Exonic
1139635356 16:68255319-68255341 CTGGGGCTACACACGGGGTGAGG + Exonic
1139982382 16:70870429-70870451 CTTAGGCTGCACACAGCAGGGGG - Intronic
1141313110 16:82934376-82934398 CTTAGGCTGCACACAGCTGGGGG + Intronic
1141426891 16:83949892-83949914 CTGGGGCTGCACCCTGCATGAGG - Intronic
1141665052 16:85461718-85461740 CTGGAGCTTCACGCAGCACGGGG - Intergenic
1141859801 16:86708760-86708782 CAGGGGCTTCCCACAGCAGATGG - Intergenic
1143260512 17:5595141-5595163 CTGGAGCACCACACAGCAGTGGG - Intronic
1143683106 17:8492222-8492244 CTGGGCCTTCACACAGGAGCGGG - Intronic
1144500163 17:15779265-15779287 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1145772207 17:27501553-27501575 CTGAGGCTACACACAGCAGCAGG - Intronic
1149143133 17:53458038-53458060 CCAAGGCTGCACACAGCAGGGGG - Intergenic
1149371007 17:55993259-55993281 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1150350200 17:64438348-64438370 CTGAGGCTGCACAGAGCAGAAGG + Intergenic
1150858856 17:68779819-68779841 CTGGATCTACACACAACAGGAGG - Intergenic
1151086654 17:71388184-71388206 CTGAGTCTGCACACAGCAAGGGG + Intergenic
1154424357 18:14260696-14260718 CTGAGGCTGCAAACAGCAGCAGG - Intergenic
1154427043 18:14280049-14280071 CTGGGGATGCACACAGCAGCAGG - Intergenic
1154429771 18:14299581-14299603 CTGAGGCTGCACACAGCAGCAGG - Intergenic
1154431155 18:14309637-14309659 CTGAGGCTGCACACAGAGGGGGG - Intergenic
1154432046 18:14315925-14315947 CTGAGGCTGCACACAGCAACAGG - Intergenic
1154433831 18:14328942-14328964 CTGAGGCTGCACACAGAGGGGGG - Intergenic
1154506610 18:15046308-15046330 CCTAGGCTGCACACAGCAGGTGG + Intergenic
1155515973 18:26624403-26624425 CTGAGGCTGCACAGAGCAAGGGG - Intronic
1155544789 18:26903849-26903871 CTGAGGCTGCATAGAGCAGGGGG + Intergenic
1155605987 18:27606470-27606492 CTGGGTCTTCACATAGCAGAGGG + Intergenic
1156169389 18:34463624-34463646 CTAAGGCTGCACACAGAAGGGGG + Intergenic
1156344312 18:36241934-36241956 CTGAGGCTACACACAGCAGTGGG + Intronic
1156892320 18:42204686-42204708 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1158020621 18:52837121-52837143 CCTAGGCTGCACACAGCAGGAGG + Intronic
1158299268 18:56033524-56033546 CTGAGGCTGCACAGAGCAGAGGG + Intergenic
1159138180 18:64361445-64361467 CTGAGGCTGCATAGAGCAGGGGG + Intergenic
1159288824 18:66390617-66390639 CTCAGGCTGCACAAAGCAGGGGG - Intergenic
1159461221 18:68724180-68724202 CTGAGGCTACATAGAGCTGGCGG + Intronic
1159803078 18:72924153-72924175 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1159805867 18:72957685-72957707 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1160177486 18:76607719-76607741 CTGTGGCTACACAAAGTAAGTGG + Intergenic
1161684541 19:5696372-5696394 CTGGGGCAGCAGACAGCAGGTGG + Intronic
1161942950 19:7417240-7417262 CTGGGGCTTCACTGAGAAGGTGG + Intronic
1162298305 19:9828310-9828332 CTGGAGCTACACAAAGCGGGGGG - Exonic
1162809623 19:13155999-13156021 CTGGAGCCCCACACCGCAGGCGG + Intergenic
1164210067 19:23091054-23091076 CTTAGGCTGCACACAGCATGGGG - Intronic
1164465155 19:28481639-28481661 CTGGGGGAACACACTGCAGCTGG - Intergenic
1164933109 19:32190449-32190471 CTGGGGAGAGACACAGCAGGTGG - Intergenic
1166535401 19:43570992-43571014 CAGGGGCCACACACAGGAGTGGG - Intronic
1168276809 19:55283506-55283528 CCGGGGGTACACACAGGTGGAGG - Intronic
1202638255 1_KI270706v1_random:60366-60388 CTGAGGCTGCATACAGCAGCAGG + Intergenic
925208201 2:2025214-2025236 CTTGGGCTTCACAGAGCAGTTGG + Intronic
925387359 2:3471522-3471544 CAGGGCCTCCACACAGCAAGGGG + Intronic
925474046 2:4192818-4192840 CTGAGGCTACACACAGCAGGAGG + Intergenic
925489468 2:4375769-4375791 CTGAGGCTGCACAGAGCATGAGG + Intergenic
926391929 2:12402692-12402714 CGGAGGCTGCACACAGCAGTGGG - Intergenic
926431064 2:12786084-12786106 CCTAGGCTGCACACAGCAGGTGG + Intergenic
926456549 2:13074265-13074287 CTGAGGCTTCACACAGCAGGGGG + Intergenic
926461073 2:13130439-13130461 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
926836744 2:17031699-17031721 CTGAGGCTGCACAGAGCAGGAGG + Intergenic
927389785 2:22582323-22582345 CTGTGTCTGCACACAGCAGGGGG - Intergenic
927892289 2:26759185-26759207 CTGGGGCAGCCCACAGCAGCAGG - Intergenic
928872533 2:35997559-35997581 CTGGGGATGCACATAGCAAGAGG + Intergenic
929211283 2:39359846-39359868 CCTAGGCTGCACACAGCAGGGGG + Intronic
929612796 2:43284325-43284347 CTGAGGCTGCACAGAGCAGCTGG - Intronic
929689207 2:44060474-44060496 CTAGGCTAACACACAGCAGGGGG + Intergenic
929782692 2:44967477-44967499 TTGGGGCTACACATGGCATGTGG - Intergenic
930028764 2:47045694-47045716 CTGGAGATACACAAAGAAGGCGG - Intronic
930427882 2:51234366-51234388 CCTAGGCTGCACACAGCAGGGGG + Intergenic
930481452 2:51952899-51952921 CTGAGGTTGCACACAGCAAGCGG + Intergenic
930762194 2:55049678-55049700 CTGGGGCTGCACACAAAAGAGGG + Intronic
930961501 2:57267278-57267300 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
931041400 2:58305063-58305085 CTAAGGCTGCACACAGCAGGGGG - Intergenic
931079417 2:58752733-58752755 CTGAGACTGCACACAGCAGGGGG - Intergenic
934054960 2:88243852-88243874 CCTAGGCTGCACACAGCAGGGGG - Intergenic
934493696 2:94779815-94779837 CTGAGGCTGCACACAGCAGCAGG + Intergenic
935323077 2:101907213-101907235 CTGAGGCTGCATAGAGCAGGGGG + Intergenic
936685543 2:114822360-114822382 CCTAGGCTGCACACAGCAGGGGG + Intronic
936728969 2:115357955-115357977 CCGAGGCTATACACAGCAGGGGG + Intronic
936753679 2:115678316-115678338 CCAAGGCTGCACACAGCAGGGGG - Intronic
936788814 2:116125744-116125766 CTGAGGCTAGACAGAGCAGCAGG + Intergenic
936850829 2:116895787-116895809 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
936921375 2:117692120-117692142 CTGGGGCCAGACAAAGCAAGGGG - Intergenic
937970445 2:127545333-127545355 CTGAGGCCACACACAGCAGCGGG + Intronic
938280133 2:130057923-130057945 CTGAGGATGCACACAGCAGCAGG + Intergenic
938331090 2:130448638-130448660 CTGAGGATGCACACAGCAGCAGG + Intergenic
938358858 2:130672865-130672887 CTGAGGATGCACACAGCAGCAGG - Intergenic
938435251 2:131279518-131279540 CTGAGGATGCACACAGCAGTAGG - Intronic
938503580 2:131851144-131851166 CTTAGGCTGCACACAGCAAGGGG + Intergenic
938718194 2:134040042-134040064 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
939092837 2:137799300-137799322 CTGAGGCTACACAGAGCAGCAGG - Intergenic
939784678 2:146494651-146494673 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
939835535 2:147125417-147125439 CTGAGGCTACACAGAGCAGCAGG - Intergenic
940143739 2:150523595-150523617 CTGAGGCTGCACACAGTAGTGGG - Intronic
940288891 2:152058878-152058900 AAGAGGCTACATACAGCAGGGGG - Intronic
940402371 2:153262360-153262382 CTGGGACTACAAAGAGGAGGTGG + Intergenic
940402909 2:153267593-153267615 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
940403102 2:153268908-153268930 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
940444768 2:153764797-153764819 CCTGGGCTGCACACAGCAGGGGG - Intergenic
940499625 2:154477944-154477966 CTGAGGCTGCATACAGCAGAGGG - Intergenic
940505312 2:154546500-154546522 CCTAGGCTGCACACAGCAGGGGG - Intergenic
940691309 2:156923986-156924008 CCAAGGCTGCACACAGCAGGAGG - Intergenic
941512982 2:166437175-166437197 CCTAGGCTGCACACAGCAGGGGG - Intronic
941682659 2:168415306-168415328 CCAAGGCTGCACACAGCAGGGGG + Intergenic
941888362 2:170552849-170552871 CTGAGGCTGCACAGAGCAGTGGG - Intronic
941967238 2:171312406-171312428 CCAAGGCTGCACACAGCAGGGGG - Intergenic
941977706 2:171423977-171423999 CTGAGGCTGCACACAGTAGGAGG - Intronic
942733392 2:179082952-179082974 CTGAGGCTGGACACAGTAGGGGG + Intergenic
942829689 2:180225081-180225103 CTGAGGCTGCATAGAGCAGGGGG - Intergenic
942904774 2:181167094-181167116 CCTAGGCTGCACACAGCAGGGGG + Intergenic
943448542 2:188019852-188019874 CTGAGGCTGAACACAGCATGGGG - Intergenic
944303911 2:198157537-198157559 CCTAGGCTGCACACAGCAGGGGG - Intronic
945739675 2:213644885-213644907 GTGGCTCTACACTCAGCAGGGGG + Intronic
945930973 2:215854533-215854555 CTGAGGCTGCATAGAGCAGGGGG - Intergenic
946562245 2:220926425-220926447 CTTAGGCTGCACACAGCAGGAGG + Intergenic
946874471 2:224114157-224114179 CTGAGGCTGCACAGAGCAGGGGG - Intergenic
947011544 2:225571622-225571644 CTGAGGTTTCACAGAGCAGGGGG + Intronic
947276318 2:228396161-228396183 CTGAGGCTATACACAGCAGTGGG + Intergenic
947311734 2:228810269-228810291 TTGGGTATACACCCAGCAGGGGG + Intergenic
947328059 2:228999551-228999573 CTGAGGCTGCACAGAGCAGTGGG - Intronic
947886548 2:233576561-233576583 CCTAGGCTGCACACAGCAGGGGG + Intergenic
947893466 2:233646201-233646223 CCTAGGCTGCACACAGCAGGGGG + Intronic
947903075 2:233738963-233738985 CTGAGGCTGCACACAGCAGTGGG - Intronic
947904489 2:233750628-233750650 CTGAGGCTGCACACAGCAGGGGG - Intronic
948150156 2:235738461-235738483 CTGGGGCCACACACAGAACAGGG + Intronic
948727574 2:239944341-239944363 CTGGGGCCACACTCAGCATGGGG - Intronic
948788509 2:240365344-240365366 TGTGGGGTACACACAGCAGGAGG - Intergenic
948878886 2:240845726-240845748 CCAAGGCTGCACACAGCAGGGGG - Intergenic
1169208964 20:3755118-3755140 CTGGAGCTACACACACCGTGTGG - Intronic
1169448197 20:5689632-5689654 CTGCGTCTACACACAGCAACTGG - Intergenic
1169592806 20:7163937-7163959 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1171163572 20:22950949-22950971 CTGTAGCTACACACGGCTGGGGG - Intergenic
1171884844 20:30644429-30644451 CTGAGGCTGCACTCAGCAGCAGG + Intergenic
1172679263 20:36699710-36699732 GTGTGGGTACACACAGGAGGTGG + Intronic
1173026160 20:39309486-39309508 GTGTGGCTACATTCAGCAGGGGG + Intergenic
1173323459 20:42010282-42010304 CTGGGGCTGCACACAGCAGGGGG + Intergenic
1173402879 20:42740442-42740464 CAGGGGCTGCACAGAGCAGGAGG - Intronic
1173491658 20:43487466-43487488 CCTAGGCTACACAGAGCAGGCGG + Intergenic
1174507051 20:51023494-51023516 CTGGAGCTTCACGCACCAGGCGG + Intergenic
1174531450 20:51217769-51217791 CTGAGGCTACCCACAGTAGCAGG + Intergenic
1175468285 20:59207917-59207939 CTGGAGCTACACAAAGGTGGAGG - Intronic
1175796731 20:61775958-61775980 GTGGGGCCACACACAGCTTGGGG - Intronic
1175991624 20:62792781-62792803 CAAGGCCAACACACAGCAGGTGG - Intergenic
1176301283 21:5100224-5100246 GGGGGGCTGGACACAGCAGGGGG - Intergenic
1176844990 21:13869830-13869852 CTGAGGCTGCACACAGCAGCAGG + Intergenic
1176845892 21:13876133-13876155 CTGAGGCTGCACACAGAGGGGGG + Intergenic
1176848625 21:13895676-13895698 CTGAGGCTGCACACAGAGGGGGG + Intergenic
1176936786 21:14876670-14876692 CTGGTACAACACACAGCATGCGG - Intergenic
1177306081 21:19317525-19317547 CTGGGGCTGCACAGAGCAGTGGG + Intergenic
1177401714 21:20613895-20613917 CTGAGGCTGAACACAGCAGCAGG - Intergenic
1177599199 21:23288981-23289003 CTGAGGCTGTACACAGCAGTGGG - Intergenic
1177605999 21:23378788-23378810 CTGTGGCTGCACACAGCAGGGGG - Intergenic
1177628752 21:23700226-23700248 CTGAGGCTGCACACAGCAGAGGG - Intergenic
1177742138 21:25167680-25167702 CCTAGGCTACACACAGCAAGGGG - Intergenic
1177761014 21:25402267-25402289 CCTAGGCTACACACAGCAGGGGG - Intergenic
1177881719 21:26702552-26702574 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1178011364 21:28290357-28290379 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1178634259 21:34288465-34288487 CATAGGCTGCACACAGCAGGGGG + Intergenic
1178682034 21:34680325-34680347 CCTAGGCTGCACACAGCAGGGGG + Intronic
1179088606 21:38242756-38242778 CTGGGGGAACACAGAGCAGGTGG - Intronic
1179271983 21:39858589-39858611 TCGAGGCTGCACACAGCAGGGGG + Intergenic
1179654853 21:42838538-42838560 CTGGGACTACACACACCACCAGG + Intergenic
1179855747 21:44161675-44161697 GGGGGGCTGGACACAGCAGGGGG + Intergenic
1180363711 22:11921513-11921535 CTGAGGCTGCACACAGCAGCAGG - Intergenic
1180685724 22:17664862-17664884 CAGAGGCTGCACACAGCAGGAGG + Intronic
1180702742 22:17790561-17790583 CTGGGGCTCCCCACTGCACGCGG + Exonic
1180800194 22:18628173-18628195 CTAGGGCCCCACACACCAGGAGG + Intergenic
1181068044 22:20315851-20315873 TTGGGCCTCCACAGAGCAGGTGG - Intronic
1181221522 22:21367093-21367115 CTAGGGCCCCACACACCAGGAGG - Intergenic
1181404194 22:22670566-22670588 CTGGGACCACACAAAACAGGTGG + Intergenic
1181805545 22:25372542-25372564 CTGGGGTTGCCCATAGCAGGTGG - Intronic
1182020320 22:27076177-27076199 CCGGGGCTGAAGACAGCAGGTGG - Intergenic
1182999559 22:34843960-34843982 CTGAGGCTGCACACAGCAAGGGG - Intergenic
1183375657 22:37463441-37463463 CTGTGTCTACACAAAGCAGAAGG - Intergenic
1184338848 22:43874385-43874407 CTAAGGCTGCACACAGCAGGGGG - Intergenic
1184392587 22:44213046-44213068 CTGGGCCTGCACACAGTAGGTGG - Intronic
1184426295 22:44411014-44411036 CAGGTGCTGCCCACAGCAGGAGG - Intergenic
949611719 3:5709823-5709845 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
950661463 3:14469352-14469374 CTAGGGCCAGACACAGCCGGAGG + Intronic
951127290 3:18998530-18998552 ATGAGGCTACATAAAGCAGGTGG + Intergenic
952198521 3:31101379-31101401 CTGAGGCTGCATACAGCAGCAGG + Intergenic
952504559 3:33996035-33996057 CTGAGGCTGCACAGAACAGGGGG + Intergenic
952575797 3:34773086-34773108 CCTAGGCTGCACACAGCAGGAGG - Intergenic
953359165 3:42280013-42280035 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
954484650 3:50836544-50836566 CTTAGGCTGCACACAGCAGTGGG + Intronic
954643135 3:52114288-52114310 CTGGGGCTGGGCACAGCATGGGG - Intronic
955395540 3:58554532-58554554 CTGAGCCTACACAGAGCAGTAGG + Intergenic
955826263 3:62951266-62951288 CCTAGGCTGCACACAGCAGGGGG - Intergenic
956149466 3:66225445-66225467 CTGAGGCTGCACACAGCAAGGGG + Intronic
956327549 3:68070391-68070413 CCTAGGCTGCACACAGCAGGGGG + Intronic
956911360 3:73821428-73821450 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
957040126 3:75329881-75329903 CTGGGGGCACTCACTGCAGGAGG + Intergenic
957444062 3:80292020-80292042 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
957471805 3:80668322-80668344 CAGAGGCTGCACACAGCAGGGGG - Intergenic
957783487 3:84849462-84849484 CTGGGGCTGCACAGAGAAGCAGG + Intergenic
957949499 3:87107021-87107043 CTGAGGCTGCTCACAGCAGGAGG - Intergenic
957956549 3:87195893-87195915 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
958157341 3:89771589-89771611 CTTAGGCTGCACACAGCAGAGGG + Intergenic
958582556 3:96045246-96045268 CAGAGGCTACACACAGCAGTGGG + Intergenic
958583883 3:96061415-96061437 CTGAGGCTGCGCACAGCAGCGGG - Intergenic
958911158 3:99995847-99995869 CCTGGGCTGCACACAGCATGGGG + Intronic
959142706 3:102505744-102505766 CCGAGGCTGCACACAGTAGGGGG - Intergenic
959507889 3:107176071-107176093 CCAAGGCTACACACAGCAGCGGG - Intergenic
959609603 3:108278585-108278607 CCTAGGATACACACAGCAGGTGG + Intergenic
959846565 3:111040388-111040410 CCTAGGCTGCACACAGCAGGGGG - Intergenic
959862235 3:111229496-111229518 CCGAGGCTACACAGAGCAGCAGG - Intronic
959893690 3:111583767-111583789 CCGAGGCTGCACACAGCAAGGGG + Intronic
960362850 3:116735242-116735264 TTAAGGCTGCACACAGCAGGAGG - Intronic
960478349 3:118158491-118158513 CTGAGGCTGCACACAGCAGAAGG + Intergenic
960930503 3:122843908-122843930 CTAGGTGTACACACAGCAGCAGG - Intronic
961410230 3:126715092-126715114 CTGGGGCTCCATAAAGCAGTCGG + Intronic
961900259 3:130203088-130203110 CCGAGGCTGCTCACAGCAGGGGG + Intergenic
962066972 3:131991795-131991817 CTAAGGCTGCACAGAGCAGGAGG - Intronic
962471412 3:135712430-135712452 CTGGGGCTACAAGCAGAATGAGG + Intergenic
962883238 3:139598945-139598967 TTGGGGCTACACATAGATGGAGG - Intronic
963297079 3:143558055-143558077 CTGAGGCTGCACAGAGCAGGGGG - Intronic
963363255 3:144303417-144303439 CTTAGGCTACACACAGCAGGGGG + Intergenic
964728110 3:159836303-159836325 CTGTGTCTTCACACAGCAGAAGG + Intronic
965092860 3:164183847-164183869 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
965189210 3:165506602-165506624 CTGAGGCAGCACACAGCAGCAGG + Intergenic
966164824 3:177005958-177005980 CTGAGGCTACACATGGCAGTGGG - Intergenic
966972783 3:185060857-185060879 CTGAGGCTGCACAGAGCAGGGGG - Intergenic
967266402 3:187695974-187695996 CTGTGGAGACAGACAGCAGGTGG + Intergenic
967453328 3:189651772-189651794 CCGAGGCTGCACAGAGCAGGGGG - Intronic
967609117 3:191483098-191483120 CCTGGGCTGCACACAGCATGGGG - Intergenic
968175893 3:196549285-196549307 CCTAGGCTGCACACAGCAGGGGG - Intergenic
968464297 4:742788-742810 CTGTGGCCACAGACACCAGGGGG + Intronic
968875935 4:3268013-3268035 AGGAGGCTGCACACAGCAGGAGG - Intronic
969298206 4:6281720-6281742 CTGGGGACAGGCACAGCAGGAGG + Intronic
970756810 4:19437190-19437212 CCAAGGCTGCACACAGCAGGGGG - Intergenic
971119612 4:23689332-23689354 CCGAGGCAACACACAGCAGAGGG - Intergenic
971277940 4:25215684-25215706 CTGAGGCTGCACAGAGCAGCAGG + Intronic
971440420 4:26679250-26679272 CTGAGGCTGCACAGAGCAGGGGG - Intronic
971681520 4:29706847-29706869 CCTAGGCTGCACACAGCAGGAGG + Intergenic
971710587 4:30105933-30105955 CTGAGGCTACATAGAGTAGGGGG + Intergenic
972012822 4:34205927-34205949 CTGAGGCTTCACAGAGCAGGGGG - Intergenic
972051702 4:34743215-34743237 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
972236988 4:37146442-37146464 CTGAGGCCACACACAGCAGCGGG - Intergenic
972301202 4:37787317-37787339 CCTAGGCTGCACACAGCAGGCGG - Intergenic
972872102 4:43312961-43312983 CTTAGGCTACACACAGCAGGGGG - Intergenic
972879491 4:43406582-43406604 CTGAGGCTGCACACAGCAGGGGG - Intergenic
972887536 4:43510478-43510500 CCTAGGCTGCACACAGCAGGTGG + Intergenic
973258509 4:48137131-48137153 CTGGGGCTACACACAGTGCCTGG + Exonic
973368491 4:49226711-49226733 CTGAGGCTGCACACAGCAGCAGG + Intergenic
973392087 4:49565543-49565565 CTGCGGCTGAACACAGCAGCAGG - Intergenic
973392558 4:49568714-49568736 CTGAGGCTGCACACAGCAGCAGG - Intergenic
974171230 4:58269955-58269977 CCTAGGCTGCACACAGCAGGGGG - Intergenic
974666580 4:64969710-64969732 CTGAGGCTGCACATAGCAGGGGG + Intergenic
974924243 4:68277826-68277848 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
975204082 4:71624240-71624262 CCTGGGCTGCACACAGTAGGGGG + Intergenic
975230206 4:71924036-71924058 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
975361342 4:73475302-73475324 CCAAGGCTTCACACAGCAGGGGG + Intergenic
976365783 4:84230735-84230757 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
976442241 4:85089004-85089026 CCAAGGCTGCACACAGCAGGGGG - Intergenic
977041483 4:92024632-92024654 CCTAGGCTGCACACAGCAGGGGG + Intergenic
977070329 4:92376882-92376904 CCTAGGCTACACACAGCATGGGG + Intronic
977396528 4:96478551-96478573 CTGAGGCTGCACAAAGCAGCGGG - Intergenic
977435423 4:96989181-96989203 CTTAGGCTACACACAGCAGGGGG - Intergenic
977702543 4:100036334-100036356 CCTAGGCTGCACACAGCAGGGGG + Intergenic
978492480 4:109323534-109323556 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
978591545 4:110329722-110329744 CTGGGGCTGCATAGGGCAGGGGG - Intergenic
978904026 4:113985323-113985345 CTGAGGCTGCACACAGAAAGGGG - Intergenic
978920991 4:114183100-114183122 CCTAGGCTACACACAGCAGGAGG - Intergenic
979060919 4:116059380-116059402 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
979125650 4:116968956-116968978 ATGAGGCTGCACAGAGCAGGGGG + Intergenic
979356490 4:119712112-119712134 CATAGGCTGCACACAGCAGGGGG - Intergenic
979700046 4:123656895-123656917 CCTAGGCTGCACACAGCAGGGGG + Intergenic
979867625 4:125776366-125776388 CCTAGGCTGCACACAGCAGGGGG - Intergenic
979885595 4:126024312-126024334 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
980006825 4:127552253-127552275 CTGAAGCTGCACACAGCATGGGG - Intergenic
980280112 4:130707672-130707694 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
980430194 4:132684125-132684147 CTGAGGCTGCACACAGCAGGGGG + Intergenic
980523212 4:133957896-133957918 CTGAGGCTGCGCAGAGCAGGGGG + Intergenic
980586064 4:134817332-134817354 CTCAGGCTTCACACAGTAGGGGG + Intergenic
980742775 4:136973625-136973647 CTGGGGCCAAACAGAGCAGGGGG + Intergenic
981200418 4:141973116-141973138 CTTAGTCTACACACAGCAGGGGG + Intergenic
981356901 4:143799352-143799374 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981368432 4:143929949-143929971 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981378229 4:144040234-144040256 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981407237 4:144385698-144385720 CTGAGGCTGCACATAGCAGAGGG + Intergenic
981412013 4:144442844-144442866 CCGAGGCTGCACAGAGCAGGGGG + Intergenic
982240692 4:153296555-153296577 CTCCAGCTACACACAGCTGGAGG - Intronic
983379087 4:166968439-166968461 CTGAGGCTACACACAGCAGCAGG - Intronic
983419258 4:167496605-167496627 CTGAGGCTGCACACTGCAGCAGG + Intergenic
983657536 4:170098368-170098390 CTTAGGCTGCACACAGCAGGGGG + Intergenic
983785880 4:171729089-171729111 CTTAGGCTGCACACAGCACGGGG - Intergenic
983825104 4:172249609-172249631 CTGAGACTGCACAGAGCAGGGGG - Intronic
983889453 4:173015930-173015952 CTGAGGCCACACAGAGCAGGGGG - Intronic
984026296 4:174547449-174547471 CTGAGGTTGCAAACAGCAGGGGG - Intergenic
984057044 4:174942598-174942620 CTGAGGCTTCACAGAGCAGTTGG + Intronic
984065560 4:175043730-175043752 CTGAGGCTGCACAGGGCAGGGGG - Intergenic
985047792 4:185957826-185957848 TTGGGGCTAAAAACAGCAGGTGG + Intergenic
1202765594 4_GL000008v2_random:146224-146246 CTGAGGCTGCACACAGCAGCAGG + Intergenic
985933872 5:3079990-3080012 CTGGGGCTGTTCTCAGCAGGTGG - Intergenic
986557641 5:9027294-9027316 CTGAGGCTTCATAGAGCAGGGGG - Intergenic
986565050 5:9104739-9104761 CTGTGGCTTCACAGAGCGGGTGG - Intronic
986582307 5:9278649-9278671 CTGAGGCTGCACAGAGCAGCAGG - Intronic
987016686 5:13827422-13827444 CCATGCCTACACACAGCAGGGGG - Intronic
987169576 5:15240347-15240369 CTGAGGCTGCACAGAGCAGGTGG - Intergenic
987201744 5:15584126-15584148 TTGGGGCTGCACAGAGCAGCTGG + Intronic
987260425 5:16196641-16196663 CCTAGGCTACACACAGCATGAGG + Intergenic
987404666 5:17512480-17512502 CTAGGTCTACACACAGCAGTGGG + Intergenic
987412277 5:17626203-17626225 CTCGGTCTACACACAGCAGTGGG + Intergenic
987562416 5:19540757-19540779 CCTAGGCTGCACACAGCAGGGGG + Intronic
987610646 5:20198785-20198807 CCTGGGCTGCACACAGCAGGCGG - Intronic
987659531 5:20854829-20854851 CCTAGGCTGCACACAGCAGGGGG - Intergenic
987709075 5:21486159-21486181 CCTAGGCTGCACACAGCAGGGGG + Intergenic
987861991 5:23500631-23500653 CTGGGGCTTCACAGAACAGTGGG + Intergenic
987881470 5:23750879-23750901 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
988074808 5:26338870-26338892 TTGAGGCTACACAGAGCAGTAGG + Intergenic
988199953 5:28054871-28054893 CATAGGTTACACACAGCAGGGGG + Intergenic
988473914 5:31565849-31565871 CTGAGGCTACACAGAGCAGGGGG + Intergenic
988750537 5:34187994-34188016 CCTAGGCTGCACACAGCAGGGGG - Intergenic
988764114 5:34350817-34350839 CCTAGGCTGCACACAGCAGGGGG + Intergenic
989154283 5:38329534-38329556 CTTGGGCAACACAGAGAAGGAGG - Intronic
989389161 5:40882501-40882523 CCGAGGCTACACACAGCATGGGG - Intergenic
990108470 5:52293380-52293402 CTGAGGCTGCACACAGCAGGGGG + Intergenic
990143343 5:52730968-52730990 CTGAGGCTGCACATAGCAGGAGG - Intergenic
990213746 5:53508259-53508281 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
990943274 5:61225648-61225670 CTGGACCTATCCACAGCAGGTGG + Intergenic
991039152 5:62158592-62158614 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991122514 5:63032528-63032550 CTGAGGCTGCACAGAGCAGCTGG - Intergenic
991735677 5:69629908-69629930 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991738802 5:69651192-69651214 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991759395 5:69905235-69905257 CCTAGGCTGCACACAGCAGGGGG + Intergenic
991787940 5:70212883-70212905 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991790377 5:70230933-70230955 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991812168 5:70485547-70485569 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991815126 5:70506024-70506046 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991818262 5:70527309-70527331 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991838623 5:70780301-70780323 CCTAGGCTGCACACAGCAGGGGG + Intergenic
991880386 5:71213247-71213269 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991882827 5:71231273-71231295 CCTAGGCTGCACACAGCAGGGGG - Intergenic
991940843 5:71850532-71850554 CTGAGGATGCACACAGCAGGGGG + Intergenic
992012141 5:72539587-72539609 TTGGGGCTAACCACTGCAGGGGG + Intergenic
993015695 5:82532238-82532260 CCTAGGCTGCACACAGCAGGGGG + Intergenic
993776964 5:92012041-92012063 CCTAGGCTGCACACAGCAGGAGG - Intergenic
994485843 5:100386812-100386834 CCTAGGCTGCACACAGCAGGGGG - Intergenic
994590733 5:101768891-101768913 CTGAGACTACACACAGCAGGAGG - Intergenic
994590800 5:101769306-101769328 CTGAGGCTGCACACAGCAGGGGG + Intergenic
994592337 5:101789053-101789075 CTGAGGCTGCACAGAGCAGCGGG - Intergenic
994831209 5:104785980-104786002 CTTAGGCTGCACACAGCACGGGG - Intergenic
995212025 5:109551465-109551487 CCTAGGCTGCACACAGCAGGAGG - Intergenic
995389713 5:111626987-111627009 CAGAGGCTGCACACAGCAGGGGG - Intergenic
995390948 5:111639862-111639884 CTGAGGCTGCACAGAGAAGGGGG - Intergenic
995393200 5:111661346-111661368 CCTAGGCTGCACACAGCAGGGGG + Intergenic
995724164 5:115167169-115167191 CCGAGGCTGCACACAGCAGCAGG + Intronic
996046779 5:118882775-118882797 CTGAGGCTGCACAGAGCAGCAGG + Intronic
996251020 5:121332022-121332044 CTGAAGCTGCACACAGCAGGTGG - Intergenic
996467975 5:123825609-123825631 TGGAGGCTACACACAGCAAGGGG - Intergenic
996617369 5:125457829-125457851 CTAAGGCTGCACACAGCACGGGG - Intergenic
996734729 5:126748188-126748210 TTGGGTCTAAAAACAGCAGGGGG + Intergenic
997159585 5:131594126-131594148 CTGAGGCTACACAGAGTAGCAGG - Intronic
997624164 5:135320344-135320366 CTGTGTCTTCTCACAGCAGGTGG - Intronic
998759067 5:145411999-145412021 CTGAGGCTGCACACAGCAGGGGG + Intergenic
999281562 5:150369665-150369687 CTGGGGCTTCAGACACCAGTGGG + Intronic
1000103092 5:158035494-158035516 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1000548880 5:162634349-162634371 CTGAGACTGCACAGAGCAGGAGG + Intergenic
1000575386 5:162969674-162969696 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
1000718623 5:164678783-164678805 CTGTGGCTGCACACAGAAGCAGG - Intergenic
1001451239 5:171826184-171826206 CTGGGCCAACACACTGCAGTGGG + Intergenic
1001943806 5:175761085-175761107 CTGAGGCTGCACACAGTAGAGGG - Intergenic
1001994221 5:176142650-176142672 TTGAGGCTGCACAGAGCAGGAGG - Intergenic
1002094870 5:176824790-176824812 TAGGGGGTACACAGAGCAGGGGG - Intronic
1002757094 6:172477-172499 CTTGGGCTGCACACAGCAGTGGG - Intergenic
1003230066 6:4243707-4243729 CTGAGACTACACAGAGCTGGGGG + Intergenic
1004401269 6:15290961-15290983 CTGGGCTTACACACAGCACCTGG - Intronic
1005548609 6:26894299-26894321 CCTGGGCTGCACACAGCAGGGGG - Intergenic
1007223440 6:40296531-40296553 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1007381996 6:41496164-41496186 CTGGCGCTCCACACAGAAGTTGG - Intergenic
1008332770 6:50262690-50262712 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1008382258 6:50849017-50849039 CTGGGATTATACAAAGCAGGTGG + Intergenic
1009377961 6:62994669-62994691 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1009631735 6:66209001-66209023 CCTAGGCTGCACACAGCAGGAGG + Intergenic
1009732953 6:67634180-67634202 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
1009946541 6:70347480-70347502 TGGGGGCTACACAGTGCAGGAGG + Intergenic
1009982441 6:70741992-70742014 CCTAGGCTGCACACAGCAGGGGG + Intronic
1010344962 6:74800475-74800497 CTGAGGCTGCACAGAGCAGCTGG - Intergenic
1010473813 6:76262447-76262469 CTGAGGTTGCACACAGCAGCAGG - Intergenic
1010819400 6:80395813-80395835 CTAAGGCTGCACACAGCAGGAGG - Intergenic
1010906798 6:81501244-81501266 CTGAGGCTGCATAGAGCAGGTGG - Intronic
1010981753 6:82376775-82376797 CTGAGGCTGCACACAGCAGGGGG + Intergenic
1011347671 6:86389686-86389708 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1011382695 6:86759902-86759924 CTGAGGCTGCACACAGCATGTGG - Intergenic
1011699109 6:89939306-89939328 CTGGGGCTACACTCAACTGAAGG - Intronic
1011870434 6:91886131-91886153 CTGAGGCTGCACACAGCAGGGGG - Intergenic
1012478239 6:99637788-99637810 CTGAGGCTGCATAGAGCAGGGGG + Intergenic
1012617394 6:101293596-101293618 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
1012706524 6:102538761-102538783 CCAAGGCTGCACACAGCAGGGGG - Intergenic
1013213707 6:108008515-108008537 CTGAGGCTGCATAGAGCAGGGGG + Intergenic
1013219061 6:108060581-108060603 CTGGGGCTACAGGCAGCACGAGG - Intronic
1013549233 6:111190784-111190806 CAGGGGGGCCACACAGCAGGGGG + Intronic
1013910664 6:115272500-115272522 CAGAGACTGCACACAGCAGGGGG - Intergenic
1013928574 6:115502640-115502662 CTGAGGCTGCACAGAGCAAGGGG - Intergenic
1014374804 6:120659394-120659416 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1014562994 6:122913762-122913784 CTGAGGCTGCACAGAGCAGGGGG - Intergenic
1014771763 6:125465523-125465545 CTTCGGCTGCACACAGCATGGGG - Intergenic
1014883099 6:126746749-126746771 CTGACGCTGCACAGAGCAGGGGG + Intergenic
1015969644 6:138730993-138731015 CCTGGGCTACACACAGCACAGGG + Intergenic
1015995740 6:138994012-138994034 CTTACGCTGCACACAGCAGGGGG - Intergenic
1016175201 6:141071514-141071536 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1016512928 6:144863832-144863854 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
1016540552 6:145159454-145159476 CTGAGGCTGCACACAGCAGGGGG - Intergenic
1016987863 6:149908699-149908721 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1017763664 6:157590380-157590402 CATAGGCTGCACACAGCAGGGGG - Intronic
1017975467 6:159353183-159353205 CTGGGGCTACAGACAACCTGGGG - Intergenic
1018239631 6:161760519-161760541 CTCGGGTTCCACACAGGAGGAGG - Intronic
1019150904 6:170005004-170005026 CTGAGGCAGCACAGAGCAGGAGG + Intergenic
1019612200 7:1942230-1942252 CTGGGCCAACACTCAGCAAGTGG + Intronic
1020388283 7:7631734-7631756 CTGAGGCTGCACATAGCAGCGGG - Intergenic
1020407716 7:7855562-7855584 CCAAGGCTGCACACAGCAGGGGG + Intronic
1020958759 7:14776469-14776491 CCTAGGCTGCACACAGCAGGTGG - Intronic
1021001764 7:15340517-15340539 CTGAGGCTGCACACAGCAGGAGG - Intronic
1021096300 7:16539661-16539683 CTGAGGCTGCACAGAGCAGCGGG - Intronic
1021323515 7:19239993-19240015 CTGAGGCTGCACATAGCAGGGGG + Intergenic
1021326350 7:19273711-19273733 CCTAGGCTGCACACAGCAGGAGG + Intergenic
1022607819 7:31833971-31833993 CCTAGGCTGCACACAGCAGGGGG - Intronic
1023125736 7:36952314-36952336 CAGGGGCCAAACACAGCACGTGG + Intronic
1023208390 7:37776146-37776168 CCTAGGCTGCACACAGCAGGGGG - Intronic
1023236828 7:38098989-38099011 CTGAGGCTGCACAGAGCAGGGGG - Intergenic
1023795605 7:43789536-43789558 CTGGGACCACACACAGCACTTGG + Intronic
1024561790 7:50650687-50650709 CAGGTGGTAGACACAGCAGGTGG + Intronic
1024865853 7:53904480-53904502 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
1025748697 7:64271573-64271595 CTGAGGCTTCACAGAGCAGTGGG - Intergenic
1026190739 7:68124007-68124029 CTGGGCCTGCCCACAACAGGTGG - Intergenic
1026829581 7:73602790-73602812 CTGGGGCCAGGCACAGCATGAGG - Intronic
1028048360 7:86152133-86152155 CCTAGGCTGCACACAGCAGGAGG - Intergenic
1028084212 7:86616776-86616798 CTGAGGCTGCACACAGCAGAAGG - Intergenic
1028708091 7:93874392-93874414 CCTAGGCTGCACACAGCAGGGGG - Intronic
1028745333 7:94320643-94320665 CCTGGGCTGCACACAGCATGGGG + Intergenic
1028957751 7:96713024-96713046 CTGAGGCTGCATACAGCAGGGGG - Intergenic
1028961072 7:96750217-96750239 CTGAGGCTGCACAGAGCAGTAGG + Intergenic
1030269529 7:107655365-107655387 ATGGAGCAACACACAGCAAGGGG - Intergenic
1030469001 7:109939328-109939350 CTGAGGCTACACAGAGCAGCAGG + Intergenic
1030851084 7:114487338-114487360 CCTAGGCTGCACACAGCAGGGGG + Intronic
1031288969 7:119908288-119908310 CTCAGGCTGCACACAGCATGGGG + Intergenic
1031396950 7:121285238-121285260 CTGAGGCTGCACAGAGCATGAGG + Intronic
1031668880 7:124518869-124518891 CTGAGGCTCCACAGAGCAGTGGG - Intergenic
1031722420 7:125193580-125193602 CTGAGGCTGCACAGATCAGGGGG - Intergenic
1033235700 7:139636293-139636315 CTTGGCCAACACACAGCAGTTGG - Intronic
1033953300 7:146812837-146812859 CCGAGGCTGCACAGAGCAGGGGG - Intronic
1034040771 7:147874523-147874545 CCTAGGCTGCACACAGCAGGGGG + Intronic
1034742874 7:153495011-153495033 CTGAGGCTGCATAGAGCAGGGGG - Intergenic
1034996988 7:155583917-155583939 CTGGGGCTGCACACTGCTGCTGG - Intergenic
1035149932 7:156861367-156861389 CTGAGGCTGCACAGAGCAGGGGG + Intronic
1036706144 8:11048735-11048757 CTGGGGCTTCACAGGACAGGGGG - Intronic
1036917644 8:12820203-12820225 CTGGGTCTTCACATGGCAGGAGG + Intergenic
1039136045 8:34323606-34323628 CTCTCGCTACACACTGCAGGAGG - Intergenic
1039278214 8:35955158-35955180 CTGGGACAACCCACAGCAGTCGG + Intergenic
1039511340 8:38094587-38094609 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1040102894 8:43520939-43520961 CTGAGGCTGCACACAGCAGCAGG - Intergenic
1040407037 8:47115568-47115590 CTGAGGCTGCACACAGTAGCAGG + Intergenic
1040835990 8:51731860-51731882 CTGAGACTGCACACAGCAAGGGG + Intronic
1040873567 8:52126002-52126024 CAGGGTCTACACCCTGCAGGAGG + Intronic
1040945933 8:52883928-52883950 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1041497534 8:58503348-58503370 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1041568239 8:59305040-59305062 CTGGAGATGTACACAGCAGGAGG + Intergenic
1042412151 8:68477915-68477937 CTGAGGCTGCACAGAGCAGCAGG + Intronic
1042622092 8:70717586-70717608 CTGAGGCTGCATAGAGCAGGGGG + Intronic
1043201222 8:77372327-77372349 CTGTGGCTTCACAGAGCAGTGGG - Intergenic
1043426077 8:80150085-80150107 CCTAGGCTGCACACAGCAGGAGG - Intronic
1043492528 8:80763528-80763550 CCTAGGCTGCACACAGCAGGGGG + Intronic
1043518524 8:81019438-81019460 CCGGGGCTGCACAGAACAGGGGG - Intronic
1043805929 8:84671712-84671734 CCAAGGCTACACACAGCAGTGGG + Intronic
1044220470 8:89663617-89663639 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
1044295101 8:90518610-90518632 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1044326884 8:90868974-90868996 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1044395671 8:91708194-91708216 CTGAGGCTGCATAGAGCAGGGGG - Intergenic
1044922559 8:97181291-97181313 CTGGGGAAACAAACAGAAGGAGG + Intergenic
1044929441 8:97237873-97237895 CTGGGGCTGCACTCAGCTGAAGG + Intergenic
1045438946 8:102191017-102191039 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1046170347 8:110497760-110497782 CCAAGGCTTCACACAGCAGGGGG - Intergenic
1046607533 8:116388328-116388350 CCAAGGCTGCACACAGCAGGAGG - Intergenic
1046640157 8:116721144-116721166 CCTAGGCTACACACAGCAGAAGG - Intronic
1046839477 8:118841234-118841256 CTGGGGCTACACAGAGCAGTGGG - Intergenic
1046917368 8:119691948-119691970 CCAAGGCTGCACACAGCAGGGGG - Intergenic
1047309947 8:123683539-123683561 ATGGGGCCACAGACAGAAGGTGG - Intronic
1047397020 8:124510346-124510368 CTCTGACTACACACAGCAGGCGG + Intronic
1047924472 8:129669479-129669501 CCTGGGCTGCACACAGCAGGGGG - Intergenic
1048069770 8:131009267-131009289 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1048137382 8:131759590-131759612 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1048189287 8:132273414-132273436 CTTAGGCTGCACACAGCATGGGG + Intronic
1048537712 8:135312986-135313008 CTGAGACTGCACAAAGCAGGGGG + Intergenic
1048658550 8:136571237-136571259 CCAAGGCTGCACACAGCAGGGGG - Intergenic
1048933977 8:139340150-139340172 CTGGGAGCACACACAGCAGAGGG - Intergenic
1050255584 9:3789241-3789263 CTGAGGCTGCACACAGCATGGGG - Intergenic
1050643369 9:7692981-7693003 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1050976860 9:11949783-11949805 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1051990419 9:23145685-23145707 CTGAGGCTGCACAGAGCAGTGGG + Intergenic
1052124232 9:24755777-24755799 CCTAGGCTACACAAAGCAGGGGG - Intergenic
1052878635 9:33586348-33586370 CTGAGGCTGCACATAGCAGTGGG - Intergenic
1052969452 9:34368161-34368183 CCTGGGCTGCACACAGCAAGGGG + Exonic
1053020333 9:34689983-34690005 CTGGGGGTGCACAGAGCTGGCGG + Exonic
1053264279 9:36699140-36699162 CTGAGGCTGCACAGAGCAGCGGG + Intergenic
1053663389 9:40300217-40300239 CTGAGGCTACACACAGCAGCAGG - Intronic
1053664856 9:40310316-40310338 CTGAGGCTGCACACAGCAGCAGG - Intronic
1053913900 9:42930758-42930780 CTGAGGCTACACACAGCAGCAGG - Intergenic
1053930078 9:43108862-43108884 CAGGGCCTGCACACAGTAGGTGG + Intergenic
1054375512 9:64446451-64446473 CTGAGGCTACACACAGCAGCAGG - Intergenic
1054519759 9:66065968-66065990 CTGAGGCTGCACACAGCAGCAGG + Intergenic
1054521225 9:66076068-66076090 CTGAGGCTACACACAGCAGCAGG + Intergenic
1055701248 9:78948010-78948032 CTGAGGCTGCACACAGGAGGTGG - Intergenic
1056092184 9:83216354-83216376 CCTAGGCTACACACAGCAAGGGG - Intergenic
1056331723 9:85526607-85526629 CTGTGTCTTCACACAGCAGAAGG - Intergenic
1056811930 9:89771750-89771772 ATGGGGCTACACACTGCTGAGGG + Intergenic
1057221274 9:93259200-93259222 GTGGGGCTACGGCCAGCAGGGGG - Exonic
1057285378 9:93749270-93749292 CCAAGGCTGCACACAGCAGGGGG + Intergenic
1057325744 9:94061750-94061772 CTGGGGCTGCACAGGGCAGCAGG + Intronic
1057677255 9:97145440-97145462 CTGAGGCTGCACACAGCAGCAGG + Intergenic
1058100788 9:100915876-100915898 CTGCGGCCAGACACAGCAGCAGG - Intergenic
1059069533 9:111120662-111120684 CCGAGGCTGCACACAGCAGGGGG + Intergenic
1059082623 9:111266177-111266199 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1059735630 9:117096935-117096957 CTGGGAAGACACACAGCGGGAGG + Intronic
1061195834 9:129106689-129106711 GTGGGGCTGCACACAGGAGGTGG - Intronic
1061258800 9:129467836-129467858 CTGGGGCTGCACTGAGGAGGTGG - Intergenic
1061294245 9:129668126-129668148 CTGGGTCTACAGGCAGAAGGTGG + Intronic
1061299255 9:129695335-129695357 CTGGGGCTAAAGACAGCTGGTGG - Intronic
1062591464 9:137276631-137276653 CGGGGGCCGCACACACCAGGTGG - Intergenic
1203546339 Un_KI270743v1:131114-131136 CTGAGGCTGCACACAGCAGCAGG + Intergenic
1185452208 X:288662-288684 GTGGAGCGACTCACAGCAGGTGG + Intronic
1186324020 X:8459154-8459176 CCTAGGCTACACACAGCACGGGG + Intergenic
1186980798 X:14955434-14955456 CCTAGGCTACACACAGCAGAAGG + Intergenic
1187097395 X:16162563-16162585 CCTGGGCTGCACACAGCAGGGGG + Intergenic
1188187334 X:27130980-27131002 CCTAGGCTGCACACAGCAGGAGG + Intergenic
1188305798 X:28558609-28558631 CTGAGGCTGAACACAGCAGCTGG + Intergenic
1188686299 X:33074683-33074705 CTGGGGCATCACATGGCAGGAGG - Intronic
1188857043 X:35209316-35209338 CTTAGGCTCCACACAGCAGGAGG + Intergenic
1188862474 X:35273192-35273214 CTAAGGCTACTGACAGCAGGTGG - Intergenic
1188889665 X:35594931-35594953 CATAGGCTGCACACAGCAGGGGG - Intergenic
1190756382 X:53405386-53405408 CACTGTCTACACACAGCAGGGGG + Exonic
1190950582 X:55139536-55139558 CTGAGGCTGCACAGAGCAGGGGG - Intronic
1191606934 X:63072305-63072327 CCTGGGCTGCACACTGCAGGAGG + Intergenic
1192131918 X:68559558-68559580 CTGAGGCTCCACACAGCAGTGGG + Intergenic
1193271756 X:79537229-79537251 CCCAGGCTACACAGAGCAGGAGG - Intergenic
1193283503 X:79684175-79684197 CCTAGGCTACACACAACAGGGGG - Intergenic
1193320369 X:80114737-80114759 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1193501120 X:82276009-82276031 CTTAGGCTGCACACAGCAAGAGG + Intergenic
1193796908 X:85888190-85888212 CTTAGGCTTCACACAGCAGGGGG - Intronic
1193865098 X:86721054-86721076 CCTAGGCTGCACACAGCAGGGGG + Intronic
1194043361 X:88970760-88970782 CTGAGGCTGCACGCAGCAGCAGG + Intergenic
1194054720 X:89117398-89117420 CTGAGGCTGCACACAGCAGCAGG + Intergenic
1194092883 X:89600307-89600329 CTGAGGCTGCACACTGCAGGGGG + Intergenic
1194169454 X:90564080-90564102 CTGGGGCTGCACAGAGTAGCAGG - Intergenic
1194254001 X:91613864-91613886 CCTAGGCTGCACACAGCAGGAGG + Intergenic
1194542416 X:95190561-95190583 CCTGGGCTGCACACAGCAGGGGG + Intergenic
1194554252 X:95337769-95337791 CTGAGGCTGCACAGAGCAGGGGG + Intergenic
1194756279 X:97743191-97743213 ATGAGGCTGCATACAGCAGGGGG - Intergenic
1194843586 X:98775924-98775946 CTCAGGCTGCACACAGCAGAGGG - Intergenic
1195536279 X:106012647-106012669 CTGAGGCTGCACAGAGTAGGGGG - Intergenic
1195608390 X:106835362-106835384 CTGAGGCTGCATAGAGCAGGGGG + Intronic
1195822051 X:108956411-108956433 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1196543664 X:116937844-116937866 CTGAGGCTACACAGAGCAAGGGG + Intergenic
1196565183 X:117196718-117196740 CCTAGGCTGCACACAGCAGGGGG - Intergenic
1196582574 X:117394178-117394200 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1197057057 X:122134526-122134548 TTGAGGCTGCACACAGCAGGGGG - Intergenic
1197058895 X:122153706-122153728 CCGAGGCTGCACACAGCAGAGGG - Intergenic
1197160602 X:123318143-123318165 CCTGGGCTGCACACAGCACGGGG + Intronic
1197301736 X:124789218-124789240 CCTAGGCTGCACACAGCAGGGGG + Intronic
1197349819 X:125370046-125370068 CATAGGCTGCACACAGCAGGGGG + Intergenic
1197720550 X:129742115-129742137 CTGGGGCCACACAAAGCCAGTGG + Exonic
1198734586 X:139772085-139772107 CCTAGGCTACACACAGCACGGGG - Intronic
1198775251 X:140172633-140172655 CTGAGGCTACACAGACCACGGGG - Intergenic
1198803934 X:140475236-140475258 CCAAGGCTCCACACAGCAGGGGG - Intergenic
1198912795 X:141633456-141633478 AAGAGGCTACACACAGCAGAGGG - Intronic
1198913428 X:141638690-141638712 TTGATGCTGCACACAGCAGGGGG + Intronic
1198948413 X:142041025-142041047 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1198966850 X:142236828-142236850 CTGAGGCTGCATAGAGCAGGGGG - Intergenic
1199139200 X:144289942-144289964 CTGAGGCTGCACAGAGCAGTGGG - Intergenic
1199309557 X:146307301-146307323 CTGAGGCTGCACAGAGCAGGGGG - Intergenic
1199357144 X:146875639-146875661 CAGAGTCTGCACACAGCAGGGGG - Intergenic
1199686935 X:150273313-150273335 CAGAGGCTGCACACAGCAGGGGG - Intergenic
1200086574 X:153610150-153610172 CTGGGGCTCCCAGCAGCAGGGGG - Intergenic
1200445522 Y:3256410-3256432 CTGAGGCTTCACACTGCAGGGGG + Intergenic
1200459769 Y:3440876-3440898 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1200515696 Y:4141854-4141876 CTGGGGCTGCACAGAGTAGCAGG - Intergenic
1200538257 Y:4425737-4425759 CTGGGTGGATACACAGCAGGGGG + Intergenic
1200572787 Y:4853441-4853463 CCTAGGCTGCACACAGCAGGGGG + Intergenic
1201921563 Y:19239571-19239593 CTGAGGCTTCACAGAGCAGTGGG - Intergenic
1201947486 Y:19527291-19527313 GTGGGGCTACCTGCAGCAGGTGG - Intergenic