ID: 1091812571

View in Genome Browser
Species Human (GRCh38)
Location 12:3411709-3411731
Sequence GGGCCCCATGATGAAACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 8, 3: 54, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091812563_1091812571 29 Left 1091812563 12:3411657-3411679 CCATTGGGAGATAACTAGAATTA 0: 1
1: 3
2: 43
3: 207
4: 764
Right 1091812571 12:3411709-3411731 GGGCCCCATGATGAAACTGGTGG 0: 1
1: 1
2: 8
3: 54
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091812571 Original CRISPR GGGCCCCATGATGAAACTGG TGG Intronic
901391183 1:8947288-8947310 GGGGCCCATGAGGAGGCTGGTGG + Intronic
903278098 1:22234109-22234131 TGGCCCCCTGGGGAAACTGGTGG - Intergenic
903507391 1:23847548-23847570 GGGCCCCATGATGGGACTGATGG + Intronic
903709614 1:25313148-25313170 GGCCCCTATGATGAGACTGGTGG + Intronic
903717502 1:25379237-25379259 GGCCCCTATGATGAGACTGGTGG - Intronic
904315854 1:29662502-29662524 GGAACCCATGATGGGACTGGTGG + Intergenic
905491544 1:38348118-38348140 GGGCCTCATGATGGGACTGGTGG - Intergenic
905536237 1:38724150-38724172 GGGCCCCATGATGAAATGGCAGG - Intergenic
907308934 1:53528486-53528508 GGTCACCAGGATGAAACTGGGGG + Intronic
911286462 1:95999741-95999763 GGCCCACATGATGGAACTGGTGG + Intergenic
911687895 1:100798019-100798041 GGCCCCTATGATGAGACTGGTGG + Intergenic
912268506 1:108185032-108185054 GGCCCCCATGATGGGACTAGTGG + Intronic
912836597 1:113001780-113001802 GGCCTCCATGATGTGACTGGTGG - Intergenic
918655096 1:187015530-187015552 TAGCTGCATGATGAAACTGGAGG - Intergenic
918712447 1:187748347-187748369 GACCCCCATGATGAGAATGGTGG + Intergenic
919130150 1:193440977-193440999 GGCCCCCATGATAGAACTGGTGG + Intergenic
919481861 1:198099895-198099917 GGCCCCCATGATGGCACAGGTGG + Intergenic
920974025 1:210768814-210768836 GAACCCCATGATGATGCTGGAGG - Intronic
921719679 1:218456597-218456619 GTGTCCCATGATGGGACTGGTGG + Intergenic
922995216 1:229951912-229951934 GGCCCCCATGATGGAACTGGAGG + Intergenic
924650867 1:245926116-245926138 GAACCCCATGATGAGATTGGTGG - Intronic
1063360139 10:5446769-5446791 GTGGCACATGATGAGACTGGAGG + Intronic
1064006008 10:11699699-11699721 GGAGCCCACGCTGAAACTGGAGG + Intergenic
1065714811 10:28555761-28555783 GGCCCCCATGATGGCATTGGTGG + Intronic
1067137485 10:43624277-43624299 GGGCCCCAACTTGAAGCTGGTGG - Intergenic
1068248866 10:54409787-54409809 GTCCCCCATGTTGAGACTGGTGG + Intronic
1068498221 10:57812525-57812547 GGAACCCATAATGAAACTAGGGG + Intergenic
1069526512 10:69176725-69176747 GTCCCCCATGATGTGACTGGTGG + Intergenic
1070855752 10:79606957-79606979 GGGCACCTTGATGATAATGGTGG + Intergenic
1071127970 10:82357647-82357669 GGCCCCCATGATGGAACTGTTGG - Intronic
1075733289 10:124648938-124648960 GGGAGACAGGATGAAACTGGTGG + Intronic
1076541697 10:131219196-131219218 GGGCCCCATGGGGAAGTTGGGGG - Intronic
1077430567 11:2513999-2514021 GGGCCCCACAGTGACACTGGGGG + Intronic
1079492620 11:21006249-21006271 GGATCCCATGATGGGACTGGTGG + Intronic
1080375517 11:31705300-31705322 GGGCCCCATGATGGGACTGGTGG - Intronic
1080786055 11:35476195-35476217 GAGCCCCAAGTGGAAACTGGTGG - Intronic
1081572776 11:44301957-44301979 GGGCCCCAGGATGACGCGGGGGG + Intronic
1083713066 11:64560459-64560481 GGGCCCCAGGAGGAGGCTGGTGG - Intronic
1083733671 11:64667610-64667632 GGACCCCAAGATGAAGCTGCAGG - Exonic
1084490477 11:69475772-69475794 CGGCCCCGTGATGAAATTAGTGG - Intergenic
1084800758 11:71542331-71542353 TGGCCTCAGGATGAGACTGGTGG - Intronic
1087367714 11:97242255-97242277 TAGCAACATGATGAAACTGGAGG - Intergenic
1090065416 11:123499188-123499210 AGCCCCCATGATGGAACTGGTGG + Intergenic
1090102819 11:123818843-123818865 GGTCCTCATGATGAGACTGGTGG - Intergenic
1090148402 11:124354285-124354307 GACCCCCATGATGAGACTGTTGG + Intergenic
1091812571 12:3411709-3411731 GGGCCCCATGATGAAACTGGTGG + Intronic
1094470935 12:30800409-30800431 CACCCCCATGATGGAACTGGTGG + Intergenic
1094481254 12:30884009-30884031 TGGGCCCATGATGGGACTGGTGG - Intergenic
1094832638 12:34307468-34307490 GGGCCCCATGAAGGGACTGCTGG - Intergenic
1095205121 12:39430829-39430851 GGCCCCCATGATGAAACTAGTGG + Intronic
1096037646 12:48486608-48486630 GTGACACATTATGAAACTGGTGG - Intronic
1097863303 12:64539289-64539311 GGCCCCCATGATGAGACCGGTGG - Intergenic
1098012592 12:66070825-66070847 GGCCCCCATGATGGGACTGGAGG + Intergenic
1099810851 12:87580382-87580404 GGCCCCCATGATGAGATTAGAGG - Intergenic
1102892206 12:116568674-116568696 AGCCCCCATGATGGGACTGGTGG + Intergenic
1105425011 13:20286448-20286470 GGGCTCCATGAGGAAAATGGAGG - Intergenic
1106185211 13:27403939-27403961 AGGCCCCAGGAGTAAACTGGTGG - Intergenic
1106572366 13:30938534-30938556 GGTCCCCTTGATGGGACTGGTGG - Intronic
1107523491 13:41206188-41206210 GATCCCCATGATGGGACTGGTGG + Intergenic
1107851189 13:44575384-44575406 GGTGCCCATGATGAATCTGATGG + Exonic
1108341395 13:49501441-49501463 CTGCCCTAGGATGAAACTGGGGG - Intronic
1114328399 14:21612552-21612574 TGGCCACATGATGTCACTGGTGG + Intergenic
1114595362 14:23907501-23907523 GGCCCCCATGATAAGACTGGTGG - Intergenic
1115656003 14:35444413-35444435 GGCCACCATGATGGAACTGGTGG - Intergenic
1117559655 14:56923701-56923723 GGCCCCCATGATGGGACTGGCGG + Intergenic
1118359343 14:65043030-65043052 GGGACCCTTGATGGAAGTGGGGG - Intronic
1119530954 14:75361097-75361119 GGCCAACATGATGATACTGGTGG - Intergenic
1120255636 14:82115914-82115936 GGCCCCCATGATGGGACTGGTGG + Intergenic
1120257507 14:82139517-82139539 GACCCCCATGATGGAACTGGTGG - Intergenic
1120321838 14:82972667-82972689 TGGCAACATGATGAACCTGGAGG + Intergenic
1121078529 14:91089101-91089123 GGGAACCATGATGAGAATGGAGG - Intronic
1121178553 14:91909579-91909601 GGCCCCCATGATGGAATTGGTGG + Intronic
1124837589 15:33210130-33210152 GGTCCCCATGATGGGACTGGGGG + Intergenic
1126846760 15:52767183-52767205 GGGCCCCATGACAGCACTGGAGG + Intronic
1127872353 15:63083861-63083883 GGGCTCTACAATGAAACTGGAGG + Intergenic
1130570245 15:85036336-85036358 GGCTCCCATGATTAAAATGGGGG + Intronic
1132726722 16:1342100-1342122 GGGCCCCATGACCAAGCTGAGGG - Intronic
1132727412 16:1345004-1345026 GAGCCCCAAGATGACCCTGGAGG + Exonic
1133360598 16:5170859-5170881 GGGGCCCCAGATGAAAATGGGGG - Intergenic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1137572123 16:49573591-49573613 GGCCCAGATGATGGAACTGGTGG - Intronic
1138150283 16:54650460-54650482 TGGTCCCATGATGTAACTGAGGG - Intergenic
1142161852 16:88561898-88561920 GGGGGCCATGATGGAAGTGGGGG + Intergenic
1142162138 16:88563237-88563259 GGCCCCCATGATGGGACTAGTGG - Intergenic
1142864965 17:2785144-2785166 GGGGCCCAGGAAGAATCTGGGGG + Intronic
1143013958 17:3881866-3881888 GGGCCCCATGCTGATGCTGATGG - Intronic
1143371322 17:6441950-6441972 GGCCCCCATGATGGTACTGGTGG - Intergenic
1144749136 17:17636059-17636081 GGGCCCCATGATGGGACTTGTGG + Intergenic
1148635247 17:49144178-49144200 GGACCCCATGATGGGACTGGTGG - Intronic
1151253382 17:72855327-72855349 GGGCCCAATGATGGAATTGCAGG + Intronic
1152010719 17:77712182-77712204 AGCCCTCATGATGAGACTGGTGG + Intergenic
1152457680 17:80425539-80425561 GGGCCACAGGATGAGCCTGGAGG + Exonic
1155357631 18:24968874-24968896 GGGCCACATGAAGGACCTGGTGG + Intergenic
1156277411 18:35596846-35596868 GGGGCTCATGTTGGAACTGGAGG - Intronic
1156527650 18:37782118-37782140 AGACCCCATGATGGAACTGGGGG - Intergenic
1157161659 18:45319122-45319144 GGGGCTCATGGAGAAACTGGAGG - Intronic
1157294291 18:46431500-46431522 CAGCCCCAGGGTGAAACTGGGGG - Intronic
1159214296 18:65370371-65370393 GAGCCCCATGTTGGAAGTGGAGG - Intergenic
1161788453 19:6343439-6343461 AGGCCACATGTTGAAAGTGGAGG - Intergenic
1164500599 19:28816433-28816455 AGACCCCATGATGAGACTGGTGG - Intergenic
1165266167 19:34665007-34665029 CGGCCCCATCATGTACCTGGTGG + Intronic
1165450479 19:35879345-35879367 GGACCCCATGCTGACCCTGGAGG + Exonic
1166325933 19:42051250-42051272 AGGCCCCATGGGGAAGCTGGGGG - Intronic
1166683989 19:44784257-44784279 GGGCCGGAAGATGTAACTGGAGG - Exonic
1166848766 19:45747220-45747242 GGACCCCATGATGCAGCTGAGGG - Intronic
925749580 2:7075521-7075543 GGCCCTCATGATGCAACTGGTGG + Intergenic
926802331 2:16669516-16669538 GGGCCCCTTTATGTAACTAGGGG + Intergenic
927427531 2:22997315-22997337 GGCCCCCATGATGGGACTGGTGG + Intergenic
929537276 2:42791766-42791788 GGGCCCCGCCATGGAACTGGGGG + Intronic
929866023 2:45717964-45717986 GGGCCCCCTCAAGAAGCTGGTGG + Intronic
932893590 2:75617231-75617253 GGCCCCCATCATGGGACTGGTGG - Intergenic
935045874 2:99482021-99482043 AGGCCCCATCCTGAAACTAGGGG - Intronic
936044871 2:109179684-109179706 GGCCCCCATGATGGGACTTGTGG - Intronic
936445605 2:112592263-112592285 GGCCACCATGATGGGACTGGTGG + Intergenic
939072961 2:137565799-137565821 AGCCACCATGATGAGACTGGTGG - Intronic
940515317 2:154677149-154677171 TGCCCCCATGATGGGACTGGTGG + Intergenic
940859716 2:158759172-158759194 GGCCCCCATGATGGACCTGGTGG + Intergenic
940916576 2:159262958-159262980 CTGCCTCATGAGGAAACTGGGGG - Intronic
943734774 2:191342277-191342299 GGCCCTCAAGATGGAACTGGTGG - Intronic
944539293 2:200741191-200741213 GGAGCCCATGATGAGAATGGGGG - Intergenic
946379844 2:219339665-219339687 GGCCCGCATGATGGGACTGGTGG + Intergenic
947746935 2:232512667-232512689 GGGCCTCAGGATGAACCTGGGGG - Intergenic
948336718 2:237214078-237214100 GGTCCACATGATGGAACTGTGGG + Intergenic
948686848 2:239675391-239675413 GGGCCCCATTCTGAACCTGATGG + Intergenic
1168924205 20:1566199-1566221 GGGCCCCAAGCTGCTACTGGTGG - Exonic
1170428869 20:16259629-16259651 GGGCCCCGTGATGAGACTGCAGG - Intergenic
1170497223 20:16937651-16937673 GACCCCCATGATGAGACTGGTGG - Intergenic
1170574819 20:17654251-17654273 TGACCCCATGATGGAACTGGTGG + Intronic
1171100026 20:22374114-22374136 TGTCCCCATGATTAAAATGGGGG + Intergenic
1172483921 20:35287401-35287423 GGGCACCCCGATGGAACTGGAGG + Exonic
1172657811 20:36547820-36547842 AGGCCACAGGAGGAAACTGGTGG + Intronic
1173531462 20:43772793-43772815 GGCACCCATAATGGAACTGGTGG + Intergenic
1175175077 20:57106605-57106627 GAGCCACATCATGAAACTGGAGG + Intergenic
1176000266 20:62828492-62828514 GGGCACCATGATGTGCCTGGTGG + Intronic
1177689035 21:24479639-24479661 GGACAACATGATGAACCTGGAGG + Intergenic
1179243266 21:39610033-39610055 GTGCCCCATGATGGAGCTGCCGG - Intronic
1179587893 21:42385259-42385281 GGCCACCTTGATGAGACTGGTGG - Intronic
1179613180 21:42565453-42565475 GGGCCCCTTGCTGCCACTGGGGG + Intronic
1180703518 22:17794652-17794674 GGACCCCATGCTGCAGCTGGGGG + Intronic
1182368096 22:29792176-29792198 GGGCCTAATAATGAAGCTGGTGG + Intronic
1182817535 22:33179074-33179096 GGCCCCCATGATGGGACTGTTGG - Intronic
1183739502 22:39662174-39662196 GGGGCCCGTGATGAATGTGGTGG - Exonic
1184048642 22:41988342-41988364 GGGCCCCATGAAGGAAGTGCTGG + Intronic
951035549 3:17928122-17928144 TGGCCCCATTAAGGAACTGGGGG - Intronic
953404937 3:42655341-42655363 AGGCCCCATGATGAAACCTGGGG - Intronic
954396627 3:50296679-50296701 GGGGGCCCTGATGGAACTGGGGG + Exonic
954687401 3:52378339-52378361 GGGACTCATCATGGAACTGGGGG - Intronic
956108471 3:65846519-65846541 GGGCCCTATTATGACTCTGGTGG - Intronic
959272534 3:104231384-104231406 GGCCCCAATGATGGGACTGGTGG - Intergenic
961000230 3:123369131-123369153 GGCCCCCATGATGAAACTGGTGG + Intronic
962045087 3:131750055-131750077 AGGCCCCATGATGAGACTGGTGG - Intronic
965869301 3:173247432-173247454 GGGTTCCATGAGGAAAATGGAGG + Intergenic
966716086 3:183014083-183014105 GGCCCCCATGATGGGACTGGTGG - Intergenic
967701249 3:192594648-192594670 GGCCCCCATGATGGGATTGGTGG + Intronic
967839110 3:193990407-193990429 GGCCCCCATGATGTGGCTGGTGG - Intergenic
967930500 3:194687141-194687163 GGGCACCAAGATGAAGCTGACGG + Exonic
967934163 3:194713383-194713405 GGGCCCCAAAACGAAGCTGGCGG + Intergenic
968234398 3:197023171-197023193 GGGCCCCCTGCTGACCCTGGGGG - Intronic
970483280 4:16499296-16499318 GGTCCCTATGTTGAAACTGATGG + Intergenic
970705409 4:18795596-18795618 GGCTCCCATGATGGGACTGGTGG - Intergenic
976635309 4:87281434-87281456 GGCCCTCATGATGGAACTGGCGG + Intergenic
976759754 4:88535707-88535729 GACCCCCATGATGGGACTGGTGG - Intronic
977780577 4:100976555-100976577 GGCCCCCTTGATAAGACTGGTGG - Intergenic
978651827 4:111014838-111014860 GGGCTCCCTGAGGAACCTGGAGG - Intergenic
980899771 4:138893728-138893750 GGACCTCATGATGAGGCTGGCGG - Intergenic
983279676 4:165664856-165664878 GAGCCACATGCTGGAACTGGAGG + Intergenic
983827229 4:172278483-172278505 GGGACCCAGGATGAAACAGTAGG - Intronic
984274360 4:177591791-177591813 GGGCCACATTATGGAACTGCTGG + Intergenic
986874329 5:12088872-12088894 GCCCCCTATGATGGAACTGGTGG - Intergenic
989700267 5:44255609-44255631 GAGCCCCATGATGGGACTGGTGG + Intergenic
992162810 5:74018871-74018893 GGGCCACATGAAGATACTGTTGG + Intergenic
992942878 5:81780115-81780137 GAGACCCAGGATGGAACTGGTGG - Intergenic
993390549 5:87315386-87315408 GGCCCCCATGATGGGATTGGTGG - Intronic
995845682 5:116491274-116491296 CGACCTCATGATGAGACTGGTGG - Intronic
1001716407 5:173819844-173819866 GGCCCCCATGATGGGACTGGTGG - Intergenic
1002788458 6:421510-421532 GGCCCCCATGATGGGACTGGTGG - Intergenic
1003394308 6:5740189-5740211 GGGACCCATGATAAGCCTGGAGG - Intronic
1005011173 6:21337040-21337062 GGGACCCATGATGAGACTGGTGG + Intergenic
1007465373 6:42048114-42048136 GTGCACCGGGATGAAACTGGAGG - Intronic
1008504702 6:52218585-52218607 GGCCCCCATGATGGTACTGGTGG + Intergenic
1011304394 6:85910654-85910676 GGCCCTCATGATTGAACTGGTGG + Intergenic
1013057704 6:106600353-106600375 GGGCCCCATCATGTTTCTGGAGG + Intronic
1015439829 6:133234936-133234958 GGCTCCCATGATGGAACTAGTGG - Intergenic
1015522291 6:134143796-134143818 GGGTCCCATGATGGGACTGATGG + Intergenic
1015570410 6:134615259-134615281 GCGCCCAGAGATGAAACTGGAGG + Intergenic
1016574600 6:145554710-145554732 GGCCCGCATGATGAGACTGGTGG - Intronic
1017079402 6:150653354-150653376 GGGCCCCATGATGACTTTTGTGG - Intronic
1017090314 6:150753409-150753431 AAGCCCCATTATGAAACTGAAGG - Intronic
1017344477 6:153364423-153364445 GGCCTCCATGATGGGACTGGTGG + Intergenic
1017468186 6:154714537-154714559 GGGCCCCATGATGCAACTGATGG + Intergenic
1017976821 6:159365511-159365533 GGCACCCATGATGGGACTGGTGG + Intergenic
1018296114 6:162345952-162345974 GGCCCTCATAATGAGACTGGTGG + Intronic
1019831009 7:3330480-3330502 GGCCTCCATGATGAGACTGTTGG + Intronic
1021267158 7:18539006-18539028 AGGCCCCATGGTGGAACTTGTGG - Intronic
1023100985 7:36717995-36718017 GGACACCATTATGAAAGTGGGGG + Intronic
1023388369 7:39683030-39683052 GGCCCCCATGATGAGACTGGTGG + Intronic
1028104260 7:86858440-86858462 GGCCCCCATGATGGGACTGATGG + Intronic
1028452279 7:90999071-90999093 CTCCCCCATGATGGAACTGGTGG - Intronic
1029196583 7:98809762-98809784 GGCCCCCGTGATGGAACTGGTGG + Intergenic
1029449266 7:100631860-100631882 AGGCCTGATGATGCAACTGGAGG + Exonic
1030685395 7:112481161-112481183 AAGCCCCAGGATGAAACTGTTGG - Exonic
1031967871 7:128041036-128041058 GGGACCCATGATGGAAATGTGGG + Intronic
1035098049 7:156372598-156372620 GAACCCCATGATGGGACTGGTGG - Intergenic
1036461284 8:8955125-8955147 GGACCCCATGATGAGACTAGTGG + Intergenic
1037333916 8:17773659-17773681 GGACCCCATGATGGGACTGGTGG - Intronic
1042061606 8:64824244-64824266 GGCCCCCATGATGAGATTAGTGG - Intergenic
1042935462 8:74053830-74053852 GACCCCCATGGTGAGACTGGTGG + Intergenic
1044858527 8:96498956-96498978 GGGCAACATGATCAAAGTGGTGG - Intronic
1045035264 8:98171780-98171802 GGGCCCCATGATGAGATTAGTGG - Intergenic
1047491962 8:125382537-125382559 GGTGCCCATGATGGAACTAGCGG - Intergenic
1047610175 8:126513139-126513161 GGGCCCCATGATGGGATTAGGGG - Intergenic
1047799338 8:128292739-128292761 GTGCTCCATGATAGAACTGGTGG - Intergenic
1047851105 8:128858599-128858621 GGTCCCCATGATGGAACTAGAGG + Intergenic
1048293878 8:133200278-133200300 AGTCCCCATGCTGAAGCTGGTGG - Intronic
1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG + Intronic
1052053838 9:23881903-23881925 GGTCCCCCTGATGACACTTGGGG + Intergenic
1052672544 9:31576808-31576830 GGGCCCCATGATGGTACTGGTGG - Intergenic
1056125385 9:83531666-83531688 AGGCCCCATGATGATCCTGCTGG - Intronic
1060048858 9:120362516-120362538 GGTCCCCATGATGAGATTTGTGG + Intergenic
1060812994 9:126620368-126620390 GGGCCTCATCAACAAACTGGGGG + Intronic
1061231042 9:129315945-129315967 GGTCCCCATGAGGCAACTGGGGG - Intergenic
1061890833 9:133618266-133618288 GGGTCCCAGGAGGAAACTGATGG - Intergenic
1062300408 9:135864482-135864504 GGGCCCAATAATGACACTGAAGG + Intronic
1062346553 9:136117972-136117994 GGGCCCCAGGCTGAATCTGAAGG - Intronic
1186140852 X:6571930-6571952 GGGACCCATGATGAAACATTGGG - Intergenic
1187245755 X:17551631-17551653 GGGCCCCTTGATGAAGCTGCCGG + Intronic
1188179605 X:27038312-27038334 GGCCCCCATAATGGGACTGGTGG + Intergenic
1188380373 X:29484338-29484360 AGCCCCCATGATGGGACTGGTGG - Intronic
1188512866 X:30955795-30955817 GGGACCCATGATGCAACTCGGGG - Intronic
1189079728 X:37958410-37958432 GGCCCCCATGATGGTACTGGAGG - Intronic
1195113603 X:101672626-101672648 GGGCCAAATGATGAAAAAGGTGG + Intergenic
1196896307 X:120340135-120340157 GGCCCCCATGATGGAATTGGTGG + Intergenic
1197271071 X:124425455-124425477 GGTCCCCATGATGGGACTGGTGG + Intronic
1197707085 X:129641759-129641781 TGCCCCTATGATGGAACTGGTGG - Intergenic
1198455693 X:136815629-136815651 GGCCCCCATGATGGGACGGGTGG - Intergenic
1200204284 X:154304602-154304624 GGTCCCCATTAAGAAAATGGGGG + Intronic
1201364710 Y:13190953-13190975 GGTCCCCATTAGGAAAATGGGGG - Intergenic
1202109437 Y:21405560-21405582 GGGCCCCATGGTGAGTGTGGCGG + Intergenic