ID: 1091818686

View in Genome Browser
Species Human (GRCh38)
Location 12:3458377-3458399
Sequence CAGCAGGTCCATGGGCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 4, 3: 47, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091818679_1091818686 12 Left 1091818679 12:3458342-3458364 CCAGAGAGCCAGGTGCTGATGGG 0: 1
1: 1
2: 1
3: 40
4: 265
Right 1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG 0: 1
1: 1
2: 4
3: 47
4: 349
1091818681_1091818686 4 Left 1091818681 12:3458350-3458372 CCAGGTGCTGATGGGCACAGAGC 0: 1
1: 0
2: 1
3: 42
4: 254
Right 1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG 0: 1
1: 1
2: 4
3: 47
4: 349
1091818676_1091818686 27 Left 1091818676 12:3458327-3458349 CCTTGGCGGTGAGGACCAGAGAG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG 0: 1
1: 1
2: 4
3: 47
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091818686 Original CRISPR CAGCAGGTCCATGGGCCCCA GGG Intronic
900497267 1:2981492-2981514 CAGCAGGTCCATGGTCACCTGGG - Intergenic
903059561 1:20660635-20660657 CAGCAGGGCCCTGGGTTCCACGG + Intronic
903219052 1:21858849-21858871 CTGCAGCTCCTTGGACCCCAGGG + Intronic
903663654 1:24994072-24994094 CAGCAGGTCCCAGAGCCCCAGGG - Intergenic
903996463 1:27307990-27308012 CAGCTGGTCCTTGGGCCCCAGGG - Exonic
904282997 1:29434362-29434384 CAGCTGGTCCATGGGGACCTAGG + Intergenic
905211722 1:36378963-36378985 CACCAGGCCCAAGGTCCCCAAGG + Intronic
905627073 1:39496098-39496120 CACCATCTCCGTGGGCCCCAGGG + Intronic
905669862 1:39784673-39784695 CACCATCTCCGTGGGCCCCAGGG - Intronic
907493423 1:54825724-54825746 CAGTAGGTCCTTGGGCCCCTGGG + Intronic
907493465 1:54825918-54825940 AGGCAGGTCCCTGGGCCCCTGGG + Intronic
907559679 1:55377060-55377082 CAGCAGGTGCAGAGGCTCCAAGG + Intergenic
907848187 1:58228702-58228724 CAGAAGGTCCAAGAACCCCAGGG - Intronic
908355388 1:63322313-63322335 CACCCGCTCCCTGGGCCCCAGGG + Intergenic
908756303 1:67471941-67471963 CAGCAGGTACAAGGACTCCAAGG + Intergenic
909649728 1:77960423-77960445 CAGGAGGTCCATGGGGGCCTGGG + Exonic
912093641 1:106113692-106113714 CAGGACGCCCATGGGCTCCATGG - Intergenic
915523488 1:156462481-156462503 CAGCCGCTCCATCTGCCCCAGGG + Intergenic
916530901 1:165655392-165655414 CAGGAGGGCGATGGACCCCAGGG - Exonic
917775882 1:178333664-178333686 CAACAGGTAAATGTGCCCCATGG - Intronic
918589505 1:186224459-186224481 CAGCAGGTCTATGGGGTCCTAGG - Intergenic
920560064 1:206932514-206932536 CACCAGGCCCAGGGGCACCAGGG + Exonic
920668200 1:207982121-207982143 CAGCTGGTCCATGGCCCACCAGG + Intergenic
922326136 1:224530142-224530164 CTGCAGTTCCCTGGGTCCCAAGG + Intronic
922752366 1:228076310-228076332 AAGCAGGACCCTGGGCTCCATGG - Exonic
922903560 1:229156931-229156953 TAGCAGGTCCATGTGCCGCATGG - Intergenic
1063977803 10:11430988-11431010 CAGCAGGTCCCACGGGCCCAGGG + Intergenic
1064013063 10:11751241-11751263 CAGCATAGCCATGGGCCACAGGG + Intronic
1067047550 10:42992996-42993018 CAGCAGGTCGATAGGCACCTCGG - Intergenic
1067064096 10:43093967-43093989 CAGCAGGGCCACGGGCTCCAGGG + Intronic
1067068706 10:43117608-43117630 CAGCAGGTGCCTGGGCCTGAAGG - Intronic
1067982886 10:51107144-51107166 GAGCAAGTCCAAGGGCCCTAAGG + Intronic
1070555620 10:77525571-77525593 CAGCTGGTGCCTGGGGCCCAGGG + Intronic
1070889829 10:79934919-79934941 CATCAGTGCCATGGGCCACAGGG - Intergenic
1071524449 10:86350088-86350110 CAGCATGTGCAAAGGCCCCAGGG + Intronic
1072691964 10:97577974-97577996 CTGCTGGTCCATGGGCCACGTGG - Intronic
1073177055 10:101563058-101563080 CAGCAGGGACATGGAGCCCATGG + Intergenic
1073880541 10:107975016-107975038 CAGCAGGGTCAGGGGCCTCATGG - Intergenic
1075502185 10:122985222-122985244 CAGCAAGTACAAGGGCCCCAGGG - Intronic
1076124488 10:127963114-127963136 CTGCATTTCCATAGGCCCCAGGG - Intronic
1076587510 10:131559663-131559685 CCGCAGCTCCATGGGCCTCGAGG - Intergenic
1076679202 10:132163040-132163062 CAGAAGGACCAGGGGCCCCACGG - Intronic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1076742418 10:132493302-132493324 CAGCAGGCCCTGGGGGCCCATGG - Intergenic
1077433162 11:2526083-2526105 CAGCAGGTGCACGGGCCCTGAGG + Intronic
1077486505 11:2841184-2841206 CAGCGGGTGCAAAGGCCCCAGGG + Intronic
1078185696 11:9050516-9050538 CTGGAGGTCCATGGGGGCCAGGG - Intronic
1078842571 11:15092302-15092324 CAGTAGCTGCATGGGCCACAGGG + Intergenic
1078921728 11:15837018-15837040 CAGCAGGTGCAAAGGCCTCAGGG + Intergenic
1079088966 11:17467491-17467513 CAGCATGTGCAAAGGCCCCAAGG - Intronic
1079135231 11:17772735-17772757 CAGCATCTCCCTGGGCCCCCAGG - Intronic
1079523412 11:21355915-21355937 CAGCAAGTGCAAAGGCCCCAAGG - Intronic
1079710749 11:23680072-23680094 CAGGAGGTACATGGGCTCCTGGG - Intergenic
1081620192 11:44614825-44614847 CAGCAGGTGCAAAGGCCCCAAGG + Intronic
1081705235 11:45179078-45179100 CAGCAAGTTCACAGGCCCCATGG + Intronic
1081813286 11:45924926-45924948 CTGCTGGTCCTTGGGCCCCTGGG + Intronic
1082821688 11:57548279-57548301 CAGCAGGTGCAAGGGCCCCGAGG - Intronic
1083363580 11:62128175-62128197 CAGCAGGTGAATGGGCCCTGGGG - Exonic
1083631115 11:64095982-64096004 CTGCAGGCTCATGGGCCCCTGGG - Intronic
1084459491 11:69288461-69288483 CGGCAGCTACATGGGGCCCAAGG - Intergenic
1084691942 11:70732638-70732660 CAGCAGGTGCAAAGGCCCCATGG - Intronic
1085053085 11:73389674-73389696 CAGCAGAAAGATGGGCCCCAGGG - Intronic
1086072155 11:82811424-82811446 CAGCCACTGCATGGGCCCCAGGG - Intergenic
1087282452 11:96227074-96227096 TAGCAGGTACAAGGGCCCCGAGG - Intronic
1088585750 11:111358935-111358957 GAGAAGGACCATGGGCTCCAGGG - Intronic
1089617893 11:119705538-119705560 CAGCAGGTGCAAAGGCCCCGTGG + Intronic
1089957718 11:122587452-122587474 CATCATTTCCATGTGCCCCATGG + Intergenic
1090979885 11:131710394-131710416 AAGCGGGTCCATGTTCCCCATGG + Intronic
1091395207 12:150147-150169 CAGCAGGGCCATGGCCCACGTGG + Intronic
1091727760 12:2857427-2857449 CAGCAGGTCCAAAGGTCCCAAGG + Intronic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1092531727 12:9350644-9350666 CAGCAGGCCCATGGGCCCCAGGG - Intergenic
1094502594 12:31034457-31034479 CAGCAGGCCCATGGGCTCCAGGG - Intergenic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1096089629 12:48890266-48890288 CAGCTCATCCACGGGCCCCAGGG - Intergenic
1096341726 12:50806472-50806494 CAGCAGATCCATGGGGCTCAGGG + Intronic
1097265494 12:57742113-57742135 CTGTAGGGCCATGGGCCTCAGGG - Intronic
1097342156 12:58451334-58451356 TTCCAGGTCCATGGGACCCATGG + Intergenic
1097699650 12:62807053-62807075 CAGCAGGTGCAAGGGCCCTGCGG + Intronic
1098339607 12:69438336-69438358 ATGCAGGTTCCTGGGCCCCAGGG - Intergenic
1101004455 12:100388100-100388122 CAGCAAGTACAAGGGACCCAAGG - Intronic
1102443832 12:112986362-112986384 AGGCAGGTCCTTGGGCCCCCAGG + Intronic
1102471906 12:113164032-113164054 CCCCAGGTCCAGGGTCCCCAGGG + Intronic
1102789070 12:115629210-115629232 CAGCAGGTGCAAAGTCCCCAAGG + Intergenic
1104078718 12:125411955-125411977 AAACAGGTCCAGGGGACCCAAGG - Intronic
1104226325 12:126837998-126838020 GAGCAGGTCCTGGTGCCCCATGG - Intergenic
1104348318 12:128022615-128022637 CTCCTTGTCCATGGGCCCCAAGG + Intergenic
1104426165 12:128679983-128680005 CAGCAAGTGCAAAGGCCCCAGGG + Intronic
1104647604 12:130508453-130508475 CAGCAGGTGCAGGGGCCCCGGGG - Intronic
1104880592 12:132067980-132068002 CAGCAGGGCACTGGGCTCCAAGG + Intronic
1104897379 12:132171052-132171074 CAACAGCTCCACGGGCCCCAGGG - Intergenic
1105587231 13:21756529-21756551 CAGCAGGCCCATCTCCCCCATGG + Intergenic
1105833084 13:24182928-24182950 CAGCAGGGCCTTGGTGCCCAGGG + Intronic
1106035169 13:26037620-26037642 CAGCTGGTCCTGGTGCCCCACGG - Intergenic
1106898411 13:34330073-34330095 CTGCAGGTCCATTTGACCCAGGG + Intergenic
1109277735 13:60321453-60321475 CAGAAGGTGCAAAGGCCCCACGG + Intergenic
1111784780 13:92772418-92772440 CAGCAAGTGCAAAGGCCCCATGG - Intronic
1113373946 13:109746471-109746493 CAGCAGGTGCAAAGGCCCCGGGG - Intergenic
1113933392 13:113980583-113980605 CAGCAGGTCCATCAACCTCATGG - Intronic
1115028659 14:28768569-28768591 CAGCACGTCCATGAGCGCCAGGG + Exonic
1118722557 14:68604627-68604649 CGGCAGCGCCATGGTCCCCAGGG + Intronic
1119138139 14:72239443-72239465 CAGCCAGTCCAAGGGCACCAGGG - Intronic
1119268428 14:73279314-73279336 CATCAGGGGCATGGGCCCAAGGG + Exonic
1121798642 14:96755521-96755543 CATCAGAACCACGGGCCCCAGGG - Intergenic
1122009811 14:98736795-98736817 CAGCAAGCCCAAGGGCTCCATGG - Intergenic
1122152382 14:99732030-99732052 CAGCAGGGGCAAGGGCCCCAGGG - Intergenic
1122691990 14:103535875-103535897 CGGCAGCTCCAAGGGCCCCATGG - Exonic
1124026419 15:25970910-25970932 GAGCAGGGCCATCGGCTCCAGGG - Intergenic
1124231179 15:27947553-27947575 CATCAGGGGCATGGGCTCCAGGG - Intronic
1124411861 15:29443505-29443527 CACCAGACCCGTGGGCCCCATGG - Intronic
1124625516 15:31305463-31305485 CAGAAGGTCCACTGGGCCCAGGG - Intergenic
1126446555 15:48752400-48752422 CAGCAGGTCCAGGGTCTCCTTGG + Exonic
1128768617 15:70265990-70266012 CCACAGGTCCGTGGGCCCCGTGG - Intergenic
1129268635 15:74408183-74408205 CAGCAGGTACATGGGACCAGGGG - Intergenic
1129378945 15:75153671-75153693 GGGCAGGTCCCTGGGCCCCCTGG + Intergenic
1129766687 15:78174099-78174121 CTGCAGGTACTTGGACCCCAGGG - Intronic
1129946207 15:79541264-79541286 CAGCAGGTCCACTGGATCCATGG + Intergenic
1130081863 15:80740754-80740776 CAGCTGGCCCTTGGGTCCCACGG - Intronic
1130563411 15:84976132-84976154 CAGCATGTCCCTGGGCCCCTGGG + Intergenic
1131091428 15:89627441-89627463 CAGCAGCTCAAGGGACCCCAGGG - Exonic
1131440307 15:92454729-92454751 CAGCAGAGCCAGGGGCCCCTGGG - Intronic
1132087687 15:98921601-98921623 AAGCAGTTCCACGGACCCCAGGG - Intronic
1132605644 16:792684-792706 CGGCAGGGCCAGGGACCCCAGGG - Intronic
1132891959 16:2208993-2209015 CAGCAGGTCAAGGCGCCACAGGG - Exonic
1133301883 16:4787634-4787656 CAGGGGGTCCATGGGGGCCAAGG + Exonic
1134791891 16:16996673-16996695 CAGCAGGTGCAAAGGCCCCTGGG + Intergenic
1135328433 16:21542639-21542661 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136338780 16:29628612-29628634 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1137724077 16:50645403-50645425 CAGCTGGTACAAGGGCCTCAAGG + Intergenic
1138302958 16:55947871-55947893 CAGCCCTTCCATGGCCCCCAAGG - Intronic
1138376117 16:56565119-56565141 CACCTGGACCATGGACCCCAGGG + Exonic
1140477778 16:75247553-75247575 CAGCACGTCCAGGGCTCCCAAGG - Intronic
1142041463 16:87897177-87897199 CACCAGGTCCAGGGGATCCAGGG - Intronic
1142144555 16:88487504-88487526 CAGCAGGTCCAAAGGCTCCAAGG + Intronic
1142145663 16:88491927-88491949 CAGCAGGGTCAGTGGCCCCAAGG + Intronic
1142365389 16:89647266-89647288 CTGCAGGTCCATGGTGCTCAGGG + Exonic
1142432583 16:90037984-90038006 AAGCTGGTCCAGGGGCCACAAGG - Intronic
1142490850 17:278495-278517 CAGCAGGTGCAAAGGCCCCGAGG - Intronic
1143026990 17:3946839-3946861 CAGCAGGCCCATGGGGCAGAAGG - Intronic
1143151424 17:4809417-4809439 GAGGAGGGCCAGGGGCCCCAGGG + Intronic
1143466082 17:7137690-7137712 CAGCAGGTCCCTGGAGGCCATGG - Intergenic
1144085194 17:11802142-11802164 CGAGAGGTCCATGAGCCCCAGGG - Intronic
1144154435 17:12485411-12485433 CTGGAGCTCCAAGGGCCCCAGGG + Intergenic
1144207174 17:12987532-12987554 GAGCAGGTGCATGTCCCCCAGGG - Intronic
1144487871 17:15682568-15682590 CAGCAGGGCCATGGACCCTGGGG + Intronic
1144673078 17:17143861-17143883 CAGCAGAACCAAGGGCTCCATGG + Intronic
1144726622 17:17505627-17505649 CGGCACGTCCAGGGTCCCCAAGG + Exonic
1144913152 17:18699722-18699744 CAGCAGGGCCATGGACCCTGGGG - Intronic
1145795387 17:27652552-27652574 CAGCAGGTACAAAGGCCCCGGGG - Intergenic
1145809821 17:27757883-27757905 CAGCAGGTACAAAGGCCCCGGGG - Intronic
1146978842 17:37140848-37140870 CAGCAGCTTCTTGGGCACCAGGG + Intronic
1147237501 17:39068729-39068751 CTGCAGATCCCTGGGCCACAGGG - Intronic
1147320464 17:39642847-39642869 CAGCAGGTGCAAGGGCCCTGGGG + Intronic
1147783814 17:42963648-42963670 TAGCAGGTGCAAAGGCCCCAAGG - Intronic
1148202390 17:45757934-45757956 CAGCAAGTGCAAAGGCCCCAGGG + Intergenic
1148777506 17:50104003-50104025 CTGCAGTGCCAAGGGCCCCAGGG - Intronic
1148794196 17:50189376-50189398 CAGCAGGACCATCAGCACCAGGG + Exonic
1148794209 17:50189412-50189434 CAGCAGGGCCAGGGGGACCAGGG + Exonic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1148910308 17:50938993-50939015 CAGCAGGTGCAAAGGCCCCAAGG + Intergenic
1149647730 17:58252370-58252392 CAGCAGCCCCCTGGGCCTCATGG + Exonic
1150209290 17:63433467-63433489 CAGCAGCTCCAGCAGCCCCAGGG + Exonic
1150651982 17:67016354-67016376 CTGAAGGTCCATGGGCCCTGGGG - Intronic
1151386014 17:73755881-73755903 CTGCAGGTCCACAGGCCACAGGG + Intergenic
1152228497 17:79103448-79103470 CAGGAGGGGTATGGGCCCCAGGG + Intronic
1152316431 17:79583346-79583368 CGGCAGGTCCTGGGACCCCACGG + Intergenic
1152373625 17:79906136-79906158 CAGCAGGTTCACTGGCACCAGGG - Intergenic
1152602319 17:81270607-81270629 CAGCAGGTCCATGGGCAATCAGG + Intronic
1152821667 17:82440819-82440841 CAGCAGGCCCATTTGCCCCCAGG + Intronic
1153485726 18:5595818-5595840 AAGCAGGTCCATGGGGATCATGG + Intronic
1153842184 18:9017061-9017083 CGGCAGGGCCCTGGGCCTCACGG - Intergenic
1155300734 18:24426738-24426760 GGGCAGGTCCAGGGGCCACATGG + Exonic
1156653278 18:39252457-39252479 GAGCATGTCCTTGGGCCCCTTGG - Intergenic
1156987202 18:43362091-43362113 CCGAAGGCCCAAGGGCCCCAGGG + Intergenic
1157332703 18:46715041-46715063 CATCAGGTTCATGGGACCAATGG + Intronic
1157600808 18:48892192-48892214 CGGCAGGGGAATGGGCCCCAGGG + Intergenic
1157973580 18:52299502-52299524 CATCACTGCCATGGGCCCCATGG + Intergenic
1158255249 18:55539171-55539193 TAGCAGATCTATGGGCCCTAAGG + Intronic
1158887399 18:61841057-61841079 CTGCTGCTCCATGTGCCCCATGG - Intronic
1159900633 18:74041552-74041574 CCTCAGGACCATGTGCCCCATGG + Intergenic
1160118872 18:76109158-76109180 CTGCAGCTCCTTGGGCCCCAAGG + Intergenic
1160705000 19:525480-525502 CAGCACGTCCAGGGGCCCTGAGG - Intergenic
1161047689 19:2144961-2144983 CAGCAGGTCAGTGGTCGCCAGGG + Intronic
1161128486 19:2573960-2573982 CAGCTGGTCCGTGGCACCCACGG - Intronic
1161162006 19:2767031-2767053 CCTCAGCTCCCTGGGCCCCAGGG + Intronic
1161162007 19:2767039-2767061 CAGCTGGTCCCTGGGGCCCAGGG - Intronic
1161233908 19:3188725-3188747 CAGCTGGTCCGTGGGCTCCCGGG + Intronic
1161516227 19:4698118-4698140 CAGCAGGTGCCTGGACCCAAAGG + Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1162854908 19:13460729-13460751 CAGCAGGTACAAAGGCCCCTGGG - Intronic
1162913900 19:13864389-13864411 CAGCAGGTCCCAGAGCCACAGGG - Intronic
1163518274 19:17778060-17778082 CAGCATGTGCAAAGGCCCCAGGG + Intronic
1164712429 19:30366985-30367007 CAGCAGGTGTAAAGGCCCCAGGG + Intronic
1165308105 19:35014307-35014329 CAGCAGATCCAAGGGGCCCAGGG - Exonic
1165412154 19:35668633-35668655 CCGCCGGTCCATGGTCCTCACGG + Exonic
1166281328 19:41796285-41796307 CACCAGGTTCAGGGACCCCAGGG + Intergenic
1166538303 19:43589917-43589939 CAGCAGGTGCATGGGTCCCCAGG + Exonic
1166808334 19:45499987-45500009 CAGAAGGCCTAGGGGCCCCAGGG - Exonic
1167096600 19:47377881-47377903 CAGCAGAGCCATGGGCCCCATGG + Intronic
1167112033 19:47468251-47468273 CAGCAGGTGCCAGGGCTCCAAGG - Intronic
1167281816 19:48573598-48573620 CAGCAGCTCCAGGGGCCCAGAGG + Intronic
1167419641 19:49395372-49395394 CAGTAGGTCCTTGGGCCTAAAGG - Intronic
1168353176 19:55687855-55687877 CACCGGGTCCAGGGGCCCCCAGG - Intronic
1168700680 19:58437585-58437607 TACCAGGGCCATGGGCCCAATGG + Intronic
925877964 2:8328363-8328385 CCTCAGGCCCATGGGCCCCGTGG - Intergenic
926373874 2:12207434-12207456 CGGCTGGACCATGGGCCACATGG - Intergenic
927176360 2:20411593-20411615 CAGTAGCTGCATGGGCCACACGG + Intergenic
927485322 2:23484878-23484900 CAGCGGGACCAAGTGCCCCAAGG - Intronic
927671565 2:25072792-25072814 CAGCAGTCCTGTGGGCCCCAAGG - Intronic
927688680 2:25191710-25191732 CAGAAGGTGCATGGGCCACAGGG - Intergenic
929562188 2:42962864-42962886 CAGCAGATACATGGTCCCTAGGG - Intergenic
931189175 2:59983043-59983065 CAGGAGGTCCATGGGCACTGTGG + Intergenic
932345841 2:70994737-70994759 CAGCAGGTACATGAACCACATGG + Exonic
932813491 2:74843596-74843618 CAGGAGGTGGGTGGGCCCCAAGG - Intronic
933762113 2:85679522-85679544 CAGCAGGTGCGTGGGCCCTGGGG - Intergenic
935638545 2:105269455-105269477 CAGCAGGTCCACGGCAGCCACGG + Exonic
936398905 2:112151086-112151108 CAGCCGGTGCAAAGGCCCCAAGG + Intronic
936527801 2:113253570-113253592 CAGCATGTGCAAGTGCCCCAAGG - Intronic
937317558 2:120941619-120941641 CAGCAGGTCAGTGGGCCCAGAGG + Intronic
937857671 2:126684364-126684386 CAGCAGGTCCCTGGAGCCCATGG + Intronic
937875613 2:126823218-126823240 GAGGAGGTCCATGGGGTCCAGGG - Intergenic
937999384 2:127719998-127720020 CAGGACATGCATGGGCCCCAAGG - Exonic
938748933 2:134310152-134310174 CAGCAAGTCCATGAGGCCCTTGG + Intronic
940457141 2:153915015-153915037 CAGGAGGAGCTTGGGCCCCATGG - Intronic
940757550 2:157699924-157699946 CAGCAGGTTCGTAGGCCCCTGGG - Intergenic
942198872 2:173551048-173551070 CAGCTGGTACAAAGGCCCCAAGG + Intergenic
942856475 2:180555465-180555487 CACCAGGGCCTTGGGTCCCAAGG + Intergenic
943524100 2:188995051-188995073 CAGCAGGTCCTCGGAACCCAGGG - Exonic
946578888 2:221105015-221105037 CTTCAGGTCCTTGAGCCCCATGG - Intergenic
947167013 2:227272999-227273021 CTGCAGGTCCTGGGGACCCAGGG - Exonic
947186593 2:227460853-227460875 CAGCAGGTCCAAAGGCTCTAGGG + Intergenic
947535970 2:230940657-230940679 CAGCAGCAGCATGGGCCCCCAGG - Intronic
947875414 2:233464499-233464521 CAACAGGTCCCTGGTCCTCAAGG - Intronic
1169764186 20:9130976-9130998 TTGCATGTCCATGGGCCTCATGG + Intronic
1170621428 20:17999706-17999728 CAGCATGTTCAAAGGCCCCAGGG + Intronic
1170763781 20:19273601-19273623 CAGCAGATCCCTGGGCACCCTGG - Intronic
1171455693 20:25270890-25270912 CCGCAGTACCAGGGGCCCCAAGG - Intronic
1171464454 20:25317853-25317875 CAGCAGGGACATGGGCCACCTGG + Intronic
1171465360 20:25324150-25324172 CTCCAGGTCTAAGGGCCCCATGG - Intronic
1172098171 20:32470742-32470764 CCGCATGGCCCTGGGCCCCAAGG + Intronic
1172274189 20:33670856-33670878 CACCAGGTCCAGGGTCCCAAAGG + Intronic
1172795940 20:37537629-37537651 CAGCAGGACCTTGGGGCTCATGG + Intergenic
1172938832 20:38640731-38640753 CAGCAAGTGCAGAGGCCCCAGGG - Intronic
1173737987 20:45375201-45375223 CAGCTGCTTCATGTGCCCCATGG + Exonic
1173920208 20:46738802-46738824 CAGCACGTGCAGAGGCCCCAAGG + Intergenic
1173923087 20:46760563-46760585 CAGCAGGTGCAAAGGCCCCCAGG + Intergenic
1174082795 20:47983021-47983043 CAGCAGGTGCACAGGCCCCGGGG + Intergenic
1174112261 20:48204984-48205006 CAGCAGCTCCAGGGGGCTCACGG - Intergenic
1174133160 20:48359961-48359983 CAGCAGGTGCACAGGCCCCGGGG - Intergenic
1174177030 20:48651681-48651703 CAGCAAGTGCAAAGGCCCCAGGG + Intronic
1175892818 20:62322930-62322952 CTGCAGGTCCCTCGGGCCCAGGG - Intronic
1175952439 20:62590675-62590697 CAGCAAGTCCCTGGGCCCCCAGG - Intergenic
1175977418 20:62718029-62718051 CAGCAGGTGCAAAGACCCCAGGG + Intronic
1176012750 20:62908396-62908418 CAGCAGGTCCAGGCTTCCCATGG + Intronic
1176715627 21:10346909-10346931 CAGCAGGTACAAGGATCCCAAGG - Intergenic
1177604468 21:23360104-23360126 CTGCAGGTACAGGGCCCCCATGG - Intergenic
1178357298 21:31919711-31919733 CCGCACGTCCATGAGACCCACGG - Intronic
1178507238 21:33171876-33171898 CAGCAGGTGCCAGGGACCCAAGG + Intergenic
1179319479 21:40276103-40276125 CAGCAAGTCCATGTACCTCACGG - Exonic
1180184095 21:46131056-46131078 CAGCTGGTACATGGACCCCCAGG - Intronic
1180602720 22:17033044-17033066 CAGCAGGTACAAGGATCCCAAGG + Intergenic
1180834133 22:18921408-18921430 CAGCAGGTCCATGGTGCTGAGGG + Exonic
1180990569 22:19933347-19933369 CAGCAGGTTCATGCTCCCCGGGG - Intronic
1181609587 22:24003728-24003750 CAGATGGTGCAAGGGCCCCAGGG + Intergenic
1181614951 22:24047623-24047645 CAGCAGGGCCACACGCCCCAAGG - Intronic
1183713083 22:39518018-39518040 CAGCAGGTCTCTGGGCCTCAGGG - Exonic
1183988030 22:41579989-41580011 CAGCAGGTAGGTGGGCCCCAGGG + Intronic
1184171387 22:42761713-42761735 CTGCTGGGCAATGGGCCCCAGGG + Intergenic
1184426183 22:44410532-44410554 CAGCAGGTCCCTGGGACGCCTGG - Intergenic
1184479911 22:44740323-44740345 CGGCAGGCCCACGGACCCCAAGG - Intronic
1184570826 22:45323921-45323943 CACCAGACCCATCGGCCCCAGGG - Intronic
1203284221 22_KI270734v1_random:146706-146728 CAGCAGGTCCATGGTGCTGAGGG + Intergenic
950427373 3:12931745-12931767 CAGCAGGTGGATGGGACCCGAGG + Intronic
950502980 3:13376198-13376220 CAGGAGGGCCATGAGTCCCAGGG - Intronic
952446476 3:33385609-33385631 CAGCAGCTGCCTGGGCCCAAGGG + Exonic
952958710 3:38576578-38576600 CAGCAGCTCCTTGGAGCCCAGGG - Intronic
954452396 3:50578842-50578864 AATCAGGTCCATGGGGCCCCAGG - Exonic
956786537 3:72647518-72647540 CAGCAGGTGCAGGGGTCCCAAGG + Intergenic
961244561 3:125440350-125440372 CAGCAGGTCTGAGGGCCCCTAGG + Intergenic
961506638 3:127374732-127374754 CAGCAGGTCCTGGGGGCCCTGGG - Intergenic
961536406 3:127573455-127573477 CAGCAGGCCCAGAGTCCCCAGGG - Exonic
961558844 3:127714984-127715006 CAGCAGCGCCAGGGGCTCCAGGG + Intronic
968628324 4:1637863-1637885 AAGCAGGTCCCAGGGACCCAGGG + Intronic
968933769 4:3598434-3598456 CAGCAGGTGCATGTGCCCTGTGG - Intergenic
970430373 4:15983570-15983592 CGGCATGTGCATGGGCCCTAAGG + Intronic
970745338 4:19287735-19287757 CAACAGGTACATGGTGCCCATGG - Intergenic
974329814 4:60463900-60463922 GAGCAGGTCCTGGTGCCCCAAGG + Intergenic
975212919 4:71722129-71722151 AAGCAGGTCCCTGACCCCCAGGG - Intergenic
976492986 4:85693519-85693541 CAGCAGGTCCCTGTGCCCCAGGG - Intronic
978033732 4:103969672-103969694 CAGCAGTTCTATGGGCACCCTGG - Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
981146576 4:141332459-141332481 CAGCAAGACCACGAGCCCCAGGG - Intergenic
982305403 4:153925151-153925173 TAGCAGGTACAAGGGCCCCAAGG - Intergenic
982315330 4:154025523-154025545 CAGCAGGGCCAGTGCCCCCAGGG - Intergenic
985555700 5:556925-556947 CGGCAGCTCCTTGGGTCCCACGG - Intergenic
985888444 5:2697956-2697978 CAGCAGCTCGAGGGGCCACAGGG + Intergenic
986178155 5:5369512-5369534 AAGCAGAACCATGGTCCCCAGGG + Intergenic
997422112 5:133778046-133778068 CAGCTGGTCAGTGGGCCCCAAGG + Intergenic
997458806 5:134038321-134038343 CAGCAGGTTCAGAGGCCCCTGGG + Intergenic
997663662 5:135609348-135609370 CAGCAGCTCCATGAGGGCCAAGG - Intergenic
997675207 5:135707561-135707583 CAGCAGGTGCAAAGGCTCCAGGG - Intergenic
997976430 5:138444272-138444294 GAGCAGTCCCATGAGCCCCATGG + Intronic
999574785 5:152963545-152963567 CAGCAAGTCCATAGGCCTTAAGG - Intergenic
999772348 5:154785168-154785190 CAGGAGGCACCTGGGCCCCAGGG - Intronic
1000037521 5:157460310-157460332 CCGCAGCTCCATGGGGCCCGGGG - Exonic
1001221184 5:169902428-169902450 CAGCAGGGCCTTGTGCTCCAGGG + Intronic
1001225525 5:169941476-169941498 CTGCAGGTGCAAAGGCCCCATGG + Intronic
1001236029 5:170030355-170030377 GAGCAGGCACAGGGGCCCCATGG - Intronic
1001651253 5:173317900-173317922 CGGAAGGTCCCTGAGCCCCAAGG + Exonic
1001856255 5:175013245-175013267 CAGGAGGTGCATGGGCCTCTGGG - Intergenic
1002066661 5:176655231-176655253 CAGCAGGACCCTGGGGCACAGGG + Intronic
1002100442 5:176855093-176855115 CTCCAGGTCCATGGGACCCCAGG + Intronic
1002280076 5:178124667-178124689 CAGCAGCTCCCTGGGCCTCTTGG + Exonic
1002505859 5:179678712-179678734 CAGCAAGTGCATGCGCGCCATGG + Exonic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1003403678 6:5811018-5811040 CAGCAGGTGCAAAGGCCCCGGGG + Intergenic
1004064102 6:12226158-12226180 CATAAGGTCCATGCTCCCCAGGG + Intergenic
1004170993 6:13295528-13295550 CCCCAGGACCATGGACCCCAGGG - Intronic
1004917205 6:20342991-20343013 CATCAGGTGCTTGAGCCCCAAGG - Intergenic
1005880757 6:30058264-30058286 CAGCAGGGCCATTTCCCCCATGG + Intergenic
1005943344 6:30577908-30577930 CAGCAGGTACAAGTGCCACAGGG + Exonic
1006318524 6:33305099-33305121 TTTCCGGTCCATGGGCCCCATGG + Exonic
1006335623 6:33419025-33419047 CAGGATGTGCTTGGGCCCCAGGG - Intergenic
1007309553 6:40934658-40934680 CAGCAGGGCCAGGGATCCCAAGG + Intergenic
1007764689 6:44153670-44153692 CAGCATGTACATGAGCCCTAAGG - Exonic
1008858801 6:56124238-56124260 CAGCAGGTCCAGGGAGGCCAGGG + Exonic
1010545690 6:77152418-77152440 CAGCAGGTCCATGGCCACTCTGG + Intergenic
1011836320 6:91435800-91435822 CAGAAGTTCCATGTGACCCAAGG - Intergenic
1015858710 6:137653065-137653087 CAGCAGCTGCCTGAGCCCCAAGG + Intergenic
1016359237 6:143250140-143250162 TAGCAGGTGCATGGGCCCTAGGG + Intronic
1017718700 6:157229879-157229901 CAGCAGGTGCAGAGGCCCCGCGG + Intergenic
1018123435 6:160659216-160659238 CAGCAGGGGCAGGGGCCTCAGGG + Intronic
1019344888 7:524746-524768 AAGCAGGTGCAAAGGCCCCAGGG + Intergenic
1019523892 7:1472213-1472235 CCGCAGCCCCATGGGACCCAGGG + Intronic
1021630993 7:22647250-22647272 CAGAACGGCCATGGGCCCCAAGG - Intergenic
1022162065 7:27720921-27720943 CAGCATGTGCATAGGCCCTAAGG + Intergenic
1022967081 7:35483779-35483801 CAGCAGGTGCAAAGGCCCCAAGG + Intergenic
1023519940 7:41039861-41039883 CAGGAGGTCCATGGGAGCCTGGG - Intergenic
1028508794 7:91598995-91599017 CAGCTGGTGCAGAGGCCCCAAGG + Intergenic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029379621 7:100204642-100204664 CTGCAGGAGCATGGGCCCCAGGG + Exonic
1030756722 7:113294945-113294967 CAGCAGCTGCATGTGCCACAGGG + Intergenic
1031038030 7:116809137-116809159 AAGCATGTCCATGGGCACGAAGG - Intergenic
1033214398 7:139483268-139483290 CTGCAGCTCCATGGGCGCCCAGG + Exonic
1034536587 7:151729350-151729372 CAGCAGAACAATGGGCACCAGGG + Intronic
1035583838 8:757058-757080 CAGCATGTGCAAAGGCCCCATGG - Intergenic
1035635460 8:1140476-1140498 GAGCAGGTGCATGGGACCCAGGG - Intergenic
1036286011 8:7444752-7444774 CAGGAGGTGCTTGGGCCCCTGGG + Intronic
1036335462 8:7866777-7866799 CAGGAGGTGCTTGGGCCCCTGGG - Intronic
1036752957 8:11454874-11454896 CAGCAGCTCTGTGGGGCCCAGGG - Intronic
1037734671 8:21556518-21556540 AGGCAGGTCCATGGTCCCAAAGG + Intergenic
1039005179 8:33028386-33028408 CAGCGAGTCCATGGGCCCCTGGG - Intergenic
1039577048 8:38632115-38632137 CAGCAGAGCCCTGGGGCCCACGG - Intergenic
1041439398 8:57877726-57877748 CAGCTGGTCCTGGGGCCCAAAGG - Intergenic
1042608953 8:70577099-70577121 CAGCAGGTCCAAAGTTCCCAAGG + Intronic
1044574519 8:93753634-93753656 CAGGAGGTCAATGAGCCCAAAGG - Intergenic
1048445924 8:134493295-134493317 CACCAGGTCCCTGGGCCTGAGGG + Intronic
1048517967 8:135127615-135127637 CAGCATGTGCATGGGCCGCAGGG - Intergenic
1048592873 8:135837704-135837726 CAGCAAGTGCAAAGGCCCCAAGG - Intergenic
1049546746 8:143235595-143235617 CAGCAGGTCCCTCGGGCTCAGGG + Intergenic
1049662173 8:143824380-143824402 CAGCAGGTCAATGGCCAGCAAGG - Exonic
1049751485 8:144286383-144286405 GGGCAGGTGCATGGGCGCCACGG + Intronic
1049751502 8:144286448-144286470 GGGCAGGTGCATGGGCGCCACGG + Intronic
1049751519 8:144286513-144286535 GGGCAGGTGCATGGGCGCCACGG + Intronic
1049913646 9:295254-295276 AAACAGGTCCATGGTTCCCAGGG + Intronic
1050358311 9:4804218-4804240 CAGCAGTTCCTTGGGACCCAGGG + Intronic
1050391554 9:5148720-5148742 GAGCAGGTCCTGGTGCCCCAGGG - Intronic
1052084398 9:24246994-24247016 CAGCAAGTGCAAAGGCCCCAAGG + Intergenic
1053351813 9:37418216-37418238 CAGCAAGTCCCTGGGCCACCTGG + Intergenic
1054456375 9:65433382-65433404 CAGCAGGTGCATGTGCCCTGTGG + Intergenic
1055206508 9:73737348-73737370 CAGCTTGTACATGAGCCCCATGG + Intergenic
1057067210 9:92066482-92066504 GAGCATGTGCGTGGGCCCCAAGG + Intronic
1057606024 9:96498331-96498353 CAGCAGATCAAGGGTCCCCAAGG + Intronic
1057719852 9:97523324-97523346 CAGCAGGACCCTGGGGACCAGGG - Intronic
1058694473 9:107547792-107547814 CAGCAGGCTCCTGGCCCCCATGG - Intergenic
1059440510 9:114304227-114304249 CAGCATGTGCAAAGGCCCCATGG + Intronic
1059657372 9:116368774-116368796 CAGTAGCTCCCTGGGCTCCATGG - Intronic
1060410301 9:123395646-123395668 CAGCTGGGCCCTCGGCCCCAGGG - Intronic
1061185128 9:129048545-129048567 CAGCAGGTGCCAGGGCTCCAGGG + Intronic
1061319056 9:129816175-129816197 CAGCACGTCCAGGGGCCCGAGGG - Intronic
1061327848 9:129875002-129875024 CAGAAGGCCCATGGGTCCCAGGG - Intronic
1061534065 9:131236699-131236721 CAGATGGTCCATGAACCCCATGG + Intergenic
1061618461 9:131795197-131795219 TAGCAGGTGCAAGGGCCCCAAGG - Intergenic
1061904299 9:133688709-133688731 CAGCAGGTGCAAAGGCCCCGTGG - Intronic
1062396083 9:136353443-136353465 AAGCAGGACCCTGGGCCCCAAGG - Intronic
1062609796 9:137368823-137368845 CACCAGGCCCATGGGGCGCAGGG + Intronic
1186733895 X:12440608-12440630 ATGCAGGTCCAAGGGCCCTAGGG + Intronic
1188156447 X:26748526-26748548 CAGCAGCTTCAGGGCCCCCATGG + Intergenic
1188212760 X:27443922-27443944 CAGCTGCTGCCTGGGCCCCAGGG - Intergenic
1190212053 X:48456811-48456833 CAACAGGTGCAAGGGCCCCGAGG - Intergenic
1190844984 X:54183127-54183149 TAGGAGGTCCACGGGCACCACGG + Exonic
1191902872 X:66056772-66056794 CAGCTGGGCCTCGGGCCCCAGGG - Intergenic
1193675642 X:84448395-84448417 CTGCTTGTCCTTGGGCCCCAGGG - Intronic
1194807143 X:98344163-98344185 GGGCAGGTCCTTGGGCCCCTAGG + Intergenic
1195754086 X:108183810-108183832 CAGAAGTTCCTTGGGGCCCAAGG + Intronic
1195797627 X:108668473-108668495 CAGGAGGACCTTGGGGCCCAGGG - Exonic
1196749052 X:119098210-119098232 CAGCAGGCACAATGGCCCCAAGG - Intronic
1197064328 X:122220745-122220767 CAGCTGCTGCCTGGGCCCCAAGG + Intergenic
1198583807 X:138096748-138096770 GTGCATGTCCCTGGGCCCCAGGG - Intergenic
1199965271 X:152814760-152814782 CAGTAGTTCCAGGGGCCCCTAGG - Intergenic
1200053620 X:153447170-153447192 CAGCAGGTACAATGGCCCCAAGG + Intronic