ID: 1091819072

View in Genome Browser
Species Human (GRCh38)
Location 12:3460964-3460986
Sequence CAAGTTGCCCACATTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091819068_1091819072 0 Left 1091819068 12:3460941-3460963 CCTGTGTTGCTCCGGACTTACCT 0: 1
1: 0
2: 2
3: 3
4: 53
Right 1091819072 12:3460964-3460986 CAAGTTGCCCACATTTTTCTGGG 0: 1
1: 1
2: 1
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091819072 Original CRISPR CAAGTTGCCCACATTTTTCT GGG Intronic
900960869 1:5918935-5918957 GAAGCTGCCCATTTTTTTCTGGG - Intronic
902774839 1:18667993-18668015 GAAGTTTCCCATATTTTACTCGG - Intronic
903832987 1:26185690-26185712 TATGTTGCCCAGATTTTTCAGGG - Intronic
904964035 1:34357863-34357885 CATCTTCCCCACATTATTCTTGG - Intergenic
905285827 1:36879719-36879741 AATGCTGCCCACATTTTTCTGGG - Intronic
906801438 1:48740781-48740803 GAAGTAGCCCTCATTGTTCTTGG - Intronic
908122018 1:60994682-60994704 AAAATTGCCCTCATTTTTCTAGG - Intronic
908677852 1:66625981-66626003 TAAGATGGCCACAGTTTTCTCGG + Intronic
909131099 1:71738409-71738431 CCAGTTGCCCAAAGTTCTCTGGG - Intronic
909504246 1:76370118-76370140 CGAGGTGGCCACATTTTTCATGG - Intronic
909747155 1:79111963-79111985 CAATTTGCCTACATCTTTCCAGG + Intergenic
910622089 1:89267002-89267024 CAAGTTGCCCATCTATTTCCAGG + Exonic
911892135 1:103384858-103384880 TCTGTTGCCCACATTTTTATAGG + Intergenic
912611369 1:111048477-111048499 CTATTTGCCCACTTTTTTATAGG + Intergenic
914686689 1:149986006-149986028 TAAATTGCCCACTTCTTTCTTGG + Intronic
916234136 1:162568765-162568787 CCAGTTGCCTATATTTTTCCTGG + Intronic
916244952 1:162677986-162678008 CAAGTTGCCCAAATTCTTTATGG - Intronic
916439487 1:164808956-164808978 CAAGTAGCCTAGTTTTTTCTAGG + Intronic
919509286 1:198440776-198440798 CACATTGCCCACATTTTCTTGGG + Intergenic
919867114 1:201790723-201790745 CAAGGTGGCCACTTTTTCCTGGG - Exonic
924058735 1:240149192-240149214 AAAGTTTTCCAAATTTTTCTAGG - Intronic
924166435 1:241288048-241288070 CAAGGTGTCCCCAATTTTCTAGG - Intronic
1066515378 10:36153449-36153471 CTAGTTGCTGAGATTTTTCTAGG - Intergenic
1068180088 10:53505893-53505915 CATGGCGCCTACATTTTTCTAGG - Intergenic
1070112934 10:73502081-73502103 CTAAGTGCCCACATTGTTCTAGG - Intronic
1070471104 10:76780297-76780319 CAAGATGACCATTTTTTTCTAGG + Intergenic
1070573432 10:77658984-77659006 CAAGTTGTCCCCGTCTTTCTGGG - Intergenic
1073138693 10:101233830-101233852 CCAGGTGGGCACATTTTTCTGGG + Intergenic
1073223602 10:101897092-101897114 GGAGTTGCCCACATTATTCAGGG + Intronic
1076422617 10:130341847-130341869 AAAGAAGCCCACATTTTCCTGGG - Intergenic
1077791597 11:5446940-5446962 CCAGATGCCCAGATTTCTCTGGG - Intronic
1078093936 11:8284940-8284962 CAAGTTGCCCACAATCTTGGGGG - Intergenic
1078805907 11:14703126-14703148 CAAATTGCTCATATTTTTTTGGG + Intronic
1078878990 11:15429120-15429142 CAAACTGACCACATTATTCTGGG - Intergenic
1079620802 11:22551690-22551712 AATGTTGCCCAAATTTTTCCAGG - Intergenic
1080567435 11:33525014-33525036 AAAGTTGACCAGATTTTTATAGG + Intergenic
1081554503 11:44145891-44145913 CAAGTGGCCAACATTTTTGAAGG + Intronic
1081624817 11:44646565-44646587 TAATTTGCCCACATTTTGATTGG - Intergenic
1085109994 11:73879315-73879337 TAAGTTACCATCATTTTTCTAGG + Intronic
1086804685 11:91225744-91225766 CCATTTGCCCACTTTTTTATGGG - Intergenic
1086925753 11:92639004-92639026 CCATTTACCCACATTTCTCTAGG + Intronic
1087798206 11:102476655-102476677 CAAGTTTCACCCATTGTTCTTGG - Intronic
1089812729 11:121144816-121144838 CAAGTTGCCCATAATCTTGTAGG + Intronic
1090338613 11:125994463-125994485 CTACTTGGTCACATTTTTCTAGG + Intronic
1090527201 11:127549597-127549619 CTAGTTTTCCACATTTTTATTGG - Intergenic
1090660342 11:128877696-128877718 TAAGTTGCCCACATTTTTTTTGG - Intergenic
1091101747 11:132881068-132881090 CAAGTTGCCCACAGCACTCTGGG + Intronic
1091819072 12:3460964-3460986 CAAGTTGCCCACATTTTTCTGGG + Intronic
1092531253 12:9347492-9347514 CATCTTGCCCACAATTTTCTGGG - Intergenic
1092533869 12:9367961-9367983 CATGTTGCCCACATTTTTCTGGG - Intergenic
1095295273 12:40520652-40520674 ACTGTTGGCCACATTTTTCTAGG + Intronic
1095296180 12:40530189-40530211 CTTGTTGCCCACATTCTTCCAGG + Intronic
1096662350 12:53134017-53134039 TATGTTGCCCAGATTTATCTCGG + Intergenic
1097328118 12:58302238-58302260 CAAGGACCCCCCATTTTTCTAGG - Intergenic
1099117515 12:78646258-78646280 CATATGGCTCACATTTTTCTGGG + Intergenic
1099644747 12:85338301-85338323 CAAGATGACAACAGTTTTCTGGG - Intergenic
1100018822 12:90045505-90045527 CATGTTGCCCAAAAGTTTCTTGG - Intergenic
1103379289 12:120481401-120481423 CCAGCTACCCACATTTTTGTTGG + Intronic
1104172327 12:126293875-126293897 CAAGTTGCCTACACTTTTGAGGG + Intergenic
1104651971 12:130541425-130541447 CAAGTTGCCTTCATTTATTTTGG - Intronic
1105383690 13:19910892-19910914 CAAGTTAACCACAGTGTTCTAGG + Intergenic
1105782808 13:23719277-23719299 CAATTTGCCCACAGTTTAGTGGG + Intergenic
1108049604 13:46419845-46419867 TCAGATGTCCACATTTTTCTTGG - Intronic
1108177048 13:47802717-47802739 CAAGTTGCACACATTTTTAAAGG + Intergenic
1108799689 13:54080490-54080512 CAAGTAACCCACATTTTCATTGG + Intergenic
1109542126 13:63793128-63793150 TCAGATGTCCACATTTTTCTTGG - Intergenic
1109781634 13:67117915-67117937 CAACTTGCCCACATTTCTCCTGG - Intronic
1112259625 13:97866610-97866632 CAAATTGCTCACCTTTTTTTGGG - Intergenic
1112947542 13:104949927-104949949 CAAAGAGCCCACATTTTTCAGGG - Intergenic
1113642550 13:111968483-111968505 CAACATGCCCACATATTTCCTGG - Intergenic
1114964928 14:27945654-27945676 CAAGTTTCCTACACTTATCTCGG + Intergenic
1115080893 14:29449520-29449542 GATGTTGGCCTCATTTTTCTAGG - Intergenic
1116691148 14:48107500-48107522 AAAACTGCCTACATTTTTCTGGG + Intergenic
1117459498 14:55930873-55930895 TAAATTTCCCACATTTTTCTGGG - Intergenic
1117693227 14:58331018-58331040 CAAGAATCCCACATTTTTCCAGG - Intronic
1117762431 14:59044459-59044481 AAAGTAGCCAATATTTTTCTGGG + Intergenic
1119011200 14:70991137-70991159 CAATTTTCCCATGTTTTTCTAGG + Intronic
1119925859 14:78493120-78493142 CCAGTTGCCAACGTTCTTCTGGG + Intronic
1120049971 14:79854190-79854212 CAAATTGCCCGCATGTTTTTTGG - Intronic
1120073052 14:80124636-80124658 CCAGTGGGCCACAGTTTTCTAGG - Intergenic
1120681764 14:87488407-87488429 AATATTCCCCACATTTTTCTAGG - Intergenic
1121810093 14:96878521-96878543 AAAGTTGCTCCCATTTTGCTAGG - Intronic
1122183749 14:99973439-99973461 TATCTTGCCCACATTTCTCTTGG + Intronic
1126472050 15:49023150-49023172 CAAGTTGCAAATATTTTGCTAGG - Intronic
1126879443 15:53078682-53078704 CAAGGAGCCCACATTCTTATGGG + Intergenic
1127923963 15:63520059-63520081 CAAGTAGCCCTCATTCTTTTTGG + Intronic
1128343226 15:66837089-66837111 TATGTTGCCCACTTTTTGCTTGG - Intergenic
1138454579 16:57113979-57114001 CAGTTTCCCCACATTTTCCTTGG + Intronic
1139506165 16:67399121-67399143 CAGGCAGCCCACATTTCTCTGGG + Intronic
1139763258 16:69204800-69204822 CCAGTTTGCCACATCTTTCTTGG + Intronic
1143626606 17:8114051-8114073 CCAGGTGCCCACACTTTTCAGGG - Intronic
1144312527 17:14025945-14025967 CAACTTGCACACATAATTCTTGG - Intergenic
1144332226 17:14235380-14235402 CAACTTGCACACATAATTCTTGG + Intergenic
1144498598 17:15766143-15766165 CAATTTGCACACATAATTCTTGG - Intergenic
1144710120 17:17396018-17396040 CCAGGAGCCCACATTTCTCTAGG - Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145002564 17:19315370-19315392 CAAGTTGCCCCCATTCATCAGGG - Intronic
1145161981 17:20581183-20581205 CAATTTGCACACATAATTCTTGG - Intergenic
1147048115 17:37769863-37769885 CAAACTGACCCCATTTTTCTGGG - Intergenic
1148822721 17:50369489-50369511 CAAGTTGGCATCATTTTTATAGG - Intronic
1149423963 17:56537050-56537072 CAATCAGCCCTCATTTTTCTAGG - Intergenic
1150421988 17:65045155-65045177 GAGATTGCCAACATTTTTCTAGG - Intronic
1150507202 17:65711334-65711356 CAAGTTATTTACATTTTTCTGGG + Intronic
1150866313 17:68853990-68854012 CAAATAGCTCACATTTTTCCAGG + Intergenic
1151427917 17:74043244-74043266 TAAGCTGCCCGCACTTTTCTTGG + Intergenic
1153060722 18:992217-992239 CCAATTGCCCTAATTTTTCTAGG + Intergenic
1155498920 18:26467948-26467970 CATGTTGCTCACATCTTTCATGG - Intronic
1155577130 18:27259941-27259963 CAATCTGGCCACATTTTTGTAGG + Intergenic
1156051601 18:32942460-32942482 AAAGTAGCACACATTTTTCATGG + Intronic
1156165986 18:34421691-34421713 CAAGTTCCCCACCATTTTCATGG + Intergenic
1156803993 18:41154322-41154344 CAAGATGAACACATTTTTCACGG - Intergenic
1156834743 18:41539121-41539143 CAATTTGCACACATTTTGCAAGG - Intergenic
1157052002 18:44177062-44177084 CAAATTGCCCCATTTTTTCTTGG + Intergenic
1157155303 18:45259707-45259729 CATTTTGGCCACATTCTTCTTGG - Intronic
1160457248 18:79010623-79010645 TAAGTTGCTCACAGTTTTATTGG + Intergenic
1160525678 18:79533981-79534003 CAATTTGCCCACAATTCTCAGGG + Intergenic
1161586503 19:5108577-5108599 CAGGTGGCCCACACTTTGCTTGG - Intronic
1164814975 19:31191448-31191470 CATTTTGACCACATTTTTCAAGG - Intergenic
1166272023 19:41720347-41720369 GAGGTTGCCCAAATTTTCCTGGG - Intronic
925252068 2:2447865-2447887 CCAGTGGCTCCCATTTTTCTCGG + Intergenic
926477346 2:13340537-13340559 CAAGTTACCTACAGTTCTCTGGG - Intergenic
926845498 2:17133223-17133245 CAAGTGGCCCACCTTTATCACGG + Intergenic
926938419 2:18110420-18110442 CATGCTGCCCAACTTTTTCTTGG + Intronic
928057747 2:28074976-28074998 CAACTTGCCCTCCTTTTTCTTGG - Intronic
931904328 2:66825962-66825984 CTAGTTGCAGACATGTTTCTGGG + Intergenic
933488589 2:82954939-82954961 CAAGTTGTTTACAATTTTCTGGG + Intergenic
935414293 2:102799502-102799524 CAATTTGCCCATATCTTTTTGGG - Intronic
936625974 2:114149851-114149873 CCAGCTGCCCACATGTTTGTGGG + Intergenic
938615901 2:132998286-132998308 CACCTTTCCCCCATTTTTCTTGG + Intronic
938621732 2:133061927-133061949 CAACATGCCCACATTTTTTTTGG + Intronic
943404566 2:187463657-187463679 CACTTTCCCCACATTTTGCTAGG - Intergenic
944421949 2:199540817-199540839 GAACTTGACCACATTTTTCTGGG + Intergenic
944516784 2:200520583-200520605 CAAGTTGTCCCCACCTTTCTGGG - Intronic
944695762 2:202199083-202199105 TAAATTGCCCAGATTTCTCTTGG - Intergenic
944764111 2:202847274-202847296 CTAATTGCCCTTATTTTTCTGGG - Intronic
946879162 2:224160220-224160242 CAAACTGCCCATATTTCTCTAGG - Intergenic
947245210 2:228039064-228039086 AAAGGTGCTAACATTTTTCTTGG + Intronic
1169550239 20:6694917-6694939 TAAGTGCCCCACATTTTTGTGGG - Intergenic
1169963778 20:11192466-11192488 CCAGGTTCCCACATTTTTCCAGG - Intergenic
1171080666 20:22180060-22180082 AAAGTTGCTGTCATTTTTCTTGG + Intergenic
1177184878 21:17782280-17782302 CTGGGTCCCCACATTTTTCTGGG + Intergenic
1177479444 21:21668207-21668229 CAAGGTGCCCACCCTTCTCTTGG + Intergenic
1178234897 21:30829894-30829916 CTCATTGCCCACATTTTTGTTGG + Intergenic
1178449761 21:32686850-32686872 CAAGTACCCAACCTTTTTCTTGG + Intronic
1183123272 22:35748992-35749014 CAATTTCCCCTCATTTTCCTAGG + Intronic
1184678620 22:46057156-46057178 CAAGTGCCAGACATTTTTCTTGG + Intronic
949360627 3:3228703-3228725 CAAGCTGCCTTAATTTTTCTTGG + Intergenic
949648076 3:6121384-6121406 TAACTTGCTCACACTTTTCTTGG - Intergenic
950657327 3:14444808-14444830 CAAGTTGCCCACAGTTTCAAAGG + Intronic
951064910 3:18252541-18252563 CATGTTGTCCTCATTTTTCAAGG - Intronic
951867085 3:27320653-27320675 CTTGTTGCTCACAGTTTTCTGGG - Intronic
952010517 3:28895579-28895601 CTAGTTACCCACACTTTCCTTGG - Intergenic
953290856 3:41660615-41660637 CAAGTTGCACACATGTTGCTAGG + Intronic
953586759 3:44208022-44208044 CACCTTGCCCACTTTCTTCTAGG + Intergenic
954936708 3:54333425-54333447 CATGTTCCCCACTTTTCTCTGGG + Intronic
955777472 3:62449009-62449031 CAATTAGCCCATCTTTTTCTAGG - Intronic
956648516 3:71481092-71481114 AAAGTTGCCCTCATTTCTCTAGG - Intronic
957821967 3:85388225-85388247 CAAGTTGCCCAGAATGGTCTTGG + Intronic
960542685 3:118878961-118878983 CAAGTTTCTCACATCTCTCTTGG + Intergenic
960711324 3:120531801-120531823 CAATTTGCTAACATTTTGCTGGG + Intergenic
960843580 3:121986102-121986124 CTAGCTGCCCAGATTTCTCTGGG + Intergenic
962732661 3:138298361-138298383 GAAGTTGCCATGATTTTTCTTGG - Intronic
962895622 3:139711411-139711433 TGAGTTTCCCACCTTTTTCTTGG + Intergenic
963025784 3:140917540-140917562 CATGTTGCTCACATTTTTGTGGG - Intergenic
963679809 3:148360286-148360308 CAAGTTGCCCACAAATTCCTGGG + Intergenic
964849275 3:161077450-161077472 CAGGTTGTCCAGATCTTTCTAGG + Exonic
965081941 3:164044790-164044812 CAAGTTTAACACATGTTTCTGGG - Intergenic
966903341 3:184503304-184503326 CAAATTCCAGACATTTTTCTAGG + Intronic
967579438 3:191135226-191135248 CAAGGTGCCCACCTTTTTCCTGG - Intergenic
970721669 4:18996151-18996173 CAAGGTGCCAGCATCTTTCTAGG - Intergenic
972979203 4:44675590-44675612 AACGTTGGCCACATTTTTCTTGG + Intronic
974352079 4:60761388-60761410 CAAGTTGCCTGGAATTTTCTTGG - Intergenic
974622204 4:64371885-64371907 CAAGTAACCCACTTTTCTCTTGG - Intronic
976309125 4:83592819-83592841 CATTTTACCCACATTTTTATAGG - Intronic
976442561 4:85092263-85092285 CATGTTGCCCACGTTGATCTTGG + Intergenic
977487478 4:97666514-97666536 GAAGATGCCCACATATTTCTTGG + Intronic
977695891 4:99965322-99965344 CAAGGTTCACACATTTTACTGGG - Intergenic
977893070 4:102334302-102334324 CAAAGTCCCCAGATTTTTCTGGG - Intronic
979400369 4:120242019-120242041 CAAGTTCTCTACATTTTACTTGG + Intergenic
982095445 4:151918018-151918040 TAAGATGCCCAGATTTTACTTGG + Intergenic
983400475 4:167258339-167258361 GAATTTGCCCACTTTTTTATGGG - Intergenic
984573088 4:181416621-181416643 CAGGTTCTGCACATTTTTCTTGG - Intergenic
984662995 4:182393891-182393913 CAAGTTGGCCACATTTCAGTTGG - Intronic
987002679 5:13676102-13676124 CAAGTTGGCAGAATTTTTCTAGG + Intergenic
987958903 5:24777628-24777650 AAAGTGGCCTGCATTTTTCTAGG - Intergenic
987988790 5:25183075-25183097 GAAGTTGTCCACATTATGCTAGG - Intergenic
988413357 5:30914746-30914768 TAAGTTGCCCATATTTTGATAGG - Intergenic
988871098 5:35390984-35391006 CAAGCTGCACATATTTTTCTTGG + Intergenic
988957611 5:36334553-36334575 GCTGTTGTCCACATTTTTCTAGG + Intergenic
989541485 5:42623702-42623724 CAGTGAGCCCACATTTTTCTAGG - Intronic
991650377 5:68846647-68846669 CAAGTTGGCTGCATTCTTCTGGG - Intergenic
992673266 5:79080847-79080869 CAAGAAGTCCACATTTTTCCAGG - Exonic
993522293 5:88917823-88917845 CAAGTTGCTCACATTTTAGTTGG + Intergenic
995994063 5:118278490-118278512 CAAATTACCCTCAATTTTCTTGG + Intergenic
997594517 5:135097104-135097126 CCATTTGCCCACATTTTAATGGG - Intronic
997641700 5:135452694-135452716 CATGTTGCCTACAGTTTCCTTGG - Intergenic
999419068 5:151425308-151425330 CAAGATGCCCACATTCTTCATGG + Intergenic
1005430952 6:25756267-25756289 CAAGTTTGTCACGTTTTTCTAGG - Intronic
1006050398 6:31338026-31338048 CTTGTTGCCAACATTTCTCTTGG + Intronic
1007204794 6:40140202-40140224 CAAGTTGCTCACATGTTGGTGGG - Intergenic
1008536780 6:52512329-52512351 CAAGCAGGCAACATTTTTCTGGG - Intronic
1009947611 6:70357887-70357909 CAAGTGGCATACATTCTTCTAGG - Intergenic
1010795559 6:80113322-80113344 CCAGTTGCCCACAATTATCAGGG + Intronic
1011273185 6:85600936-85600958 CAAATTGCCAAGATTTTTCAAGG + Intronic
1011328419 6:86175921-86175943 CAAGATGAGCACATTTTTCTGGG + Intergenic
1011899452 6:92274572-92274594 CTAATTGTCAACATTTTTCTAGG - Intergenic
1012222755 6:96669700-96669722 CACGTTGTTCTCATTTTTCTGGG + Intergenic
1013923302 6:115436652-115436674 TAAGTTACATACATTTTTCTAGG - Intergenic
1014107330 6:117582190-117582212 AGAGTTGTCCATATTTTTCTTGG + Intronic
1015044599 6:128762331-128762353 CAAGGTGCCCACATATTGGTGGG - Intergenic
1015164804 6:130191972-130191994 TCAGTTGCCCTCATTCTTCTAGG + Intronic
1015343617 6:132130513-132130535 CAAGTTGCCCAGCTATTTCAGGG - Intergenic
1015603888 6:134936449-134936471 CAAGTCTCCCACAGTTTCCTGGG + Intronic
1021661232 7:22919796-22919818 AAAGTTTCCCATATTTCTCTGGG - Intergenic
1023587985 7:41750837-41750859 GGAATTGCCCACACTTTTCTGGG - Intergenic
1026093543 7:67321503-67321525 CAAGTTGCTCACATTTTAGTTGG - Intergenic
1028003109 7:85526458-85526480 CAAGTTGGCTACAGTTTTATAGG - Intergenic
1028124346 7:87094721-87094743 CAGCTTCCCCACATTTCTCTTGG + Intergenic
1030096085 7:105901199-105901221 CAAGTTGCTCTCATTCTTATTGG + Intronic
1030727535 7:112942976-112942998 AAAGTTGCTGACATTTTCCTGGG - Intergenic
1031146147 7:117999278-117999300 CAAGTTGGCCACATTCTCTTTGG + Intergenic
1032574840 7:133042465-133042487 CAAGCTCCCTACATCTTTCTGGG - Intronic
1033549262 7:142431697-142431719 CACATTGCTCACATTTTTCTGGG - Intergenic
1033900198 7:146128638-146128660 CAAATTACCCAAATATTTCTAGG + Intronic
1034408457 7:150922380-150922402 CAATTTGGCAACATTTTTATAGG + Intergenic
1039027512 8:33273704-33273726 CTAGTTACCTCCATTTTTCTGGG - Intergenic
1039348810 8:36738435-36738457 CAAGTTGCCTATATTTATGTGGG - Intergenic
1040764422 8:50889874-50889896 CAAGATGCCAACATTTTTGGGGG + Intergenic
1041742048 8:61166327-61166349 CATGTTGCCCACAATTTTTTTGG + Intronic
1043429532 8:80181546-80181568 CATGTTGCCCAGATTGGTCTCGG - Intronic
1043705464 8:83343409-83343431 CAAGGTGCCCACATTTGGTTGGG - Intergenic
1044252632 8:90022067-90022089 CAAGTTCCCCAAATTATTCAGGG - Intronic
1045167020 8:99617985-99618007 CAAGATGGGTACATTTTTCTGGG - Intronic
1046089545 8:109484312-109484334 CAAGTGTCACACAGTTTTCTAGG + Intronic
1046719001 8:117597732-117597754 CCAGTTCCCCACAGATTTCTTGG + Intergenic
1047830052 8:128619303-128619325 CAAGTTACATAAATTTTTCTAGG - Intergenic
1050068387 9:1785436-1785458 CAAGGTGCCCTCTTTTTCCTTGG + Intergenic
1050687278 9:8185879-8185901 CAATTTGCAGACATTTTTGTGGG + Intergenic
1051813275 9:21075174-21075196 CTAGTTGCCTTCATTTTTATTGG + Intergenic
1051910228 9:22146640-22146662 CAAGAACACCACATTTTTCTGGG + Intergenic
1055428107 9:76216597-76216619 TAAGATGCCCACAATTTTTTAGG + Intronic
1059254795 9:112919893-112919915 CAAGTTGGTCACATTCATCTGGG - Intergenic
1061522813 9:131130870-131130892 TAAGTTGCCCACTTTTTTGGGGG + Intronic
1186566491 X:10668430-10668452 CCAATTTCCCACACTTTTCTTGG + Intronic
1189186050 X:39056186-39056208 CATCTTGCCCACATCCTTCTTGG - Intergenic
1192928347 X:75779648-75779670 AAAGTTACTCACATCTTTCTAGG - Intergenic
1193020800 X:76790794-76790816 CAATTTGCCCACTTTTTAATGGG - Intergenic
1193738513 X:85188948-85188970 CAAATTGGCCACAATATTCTTGG + Intergenic
1194072355 X:89341553-89341575 AATGTTGCCCACATTTATTTTGG + Intergenic
1194402290 X:93453507-93453529 AAAGCTGCCCACACTTTTCCTGG + Intergenic
1195148281 X:102040514-102040536 CAATTTGCCCACTTTTTGATGGG - Intergenic
1197200820 X:123747167-123747189 CAAGTTGTCCCAATTTTCCTGGG + Intergenic
1197290759 X:124654400-124654422 ACAGTTGCCTACATTGTTCTAGG - Intronic
1197364991 X:125553224-125553246 TAATTTGCCCACTTTTTTATTGG - Intergenic
1197584498 X:128328300-128328322 AAAGTTGCCCACTTTTTAATGGG + Intergenic
1200726597 Y:6677299-6677321 AATGTTGCCCACATTTATTTTGG + Intergenic
1200727749 Y:6693075-6693097 AATGTTGCCCACATTTATTTTGG + Intergenic