ID: 1091819161

View in Genome Browser
Species Human (GRCh38)
Location 12:3461667-3461689
Sequence AAGCTTGGACTCCTCTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091819161_1091819165 -5 Left 1091819161 12:3461667-3461689 CCTCTCAAGAGGAGTCCAAGCTT 0: 1
1: 0
2: 1
3: 11
4: 76
Right 1091819165 12:3461685-3461707 AGCTTCAGACAGAGAAGCAGGGG 0: 1
1: 0
2: 3
3: 36
4: 489
1091819161_1091819163 -7 Left 1091819161 12:3461667-3461689 CCTCTCAAGAGGAGTCCAAGCTT 0: 1
1: 0
2: 1
3: 11
4: 76
Right 1091819163 12:3461683-3461705 CAAGCTTCAGACAGAGAAGCAGG 0: 1
1: 1
2: 1
3: 31
4: 286
1091819161_1091819164 -6 Left 1091819161 12:3461667-3461689 CCTCTCAAGAGGAGTCCAAGCTT 0: 1
1: 0
2: 1
3: 11
4: 76
Right 1091819164 12:3461684-3461706 AAGCTTCAGACAGAGAAGCAGGG 0: 1
1: 1
2: 1
3: 25
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091819161 Original CRISPR AAGCTTGGACTCCTCTTGAG AGG (reversed) Intronic
906126001 1:43427317-43427339 AGGCTTTGTCTCCTCTTGAGGGG - Exonic
906494925 1:46298416-46298438 ATGCTTGGAAACCTCTTGGGTGG - Intronic
908822112 1:68099151-68099173 AAGCTGGGAATCCTCCTAAGTGG - Intronic
909570274 1:77102218-77102240 AAGCCTGGATGCCTCTTCAGTGG - Intronic
913053958 1:115140518-115140540 AAGCCTGGCCTGCTCTTGACTGG - Intergenic
916892737 1:169128544-169128566 AAGCTTAAAATCCTTTTGAGAGG - Intronic
918152016 1:181805747-181805769 AATCTTGGACTCAGTTTGAGCGG - Intronic
920274555 1:204794460-204794482 AACCTTGAACTTCTCTTGGGAGG - Intergenic
1062938239 10:1403591-1403613 GAGCTTGCACTCCACGTGAGGGG + Intronic
1068701206 10:60022012-60022034 AAGCTTGGAATCTGCATGAGGGG + Intergenic
1070776036 10:79110456-79110478 AAGCTTGAACTCTTCTTCGGTGG - Intronic
1072935157 10:99704941-99704963 AGGCTTCGACTCCTTCTGAGAGG + Exonic
1077556126 11:3226988-3227010 AAGCTCGGAAACCTGTTGAGGGG + Intergenic
1083702264 11:64487228-64487250 AAGCTTGGGCCCTTCTTAAGTGG - Intergenic
1087580289 11:100042082-100042104 AAGCTTGGGCCCTTCTTGAGAGG - Intronic
1091819161 12:3461667-3461689 AAGCTTGGACTCCTCTTGAGAGG - Intronic
1092531165 12:9346829-9346851 AAGCTTGGACTATTCATGAGAGG + Intergenic
1092533769 12:9367254-9367276 AAGCTTGGACTTCTCCTGAGAGG + Intergenic
1100615742 12:96230597-96230619 AAGGCAGGACTCCTCTTGGGTGG - Intronic
1110783164 13:79490351-79490373 AATCATGGATTCCTCCTGAGTGG + Intronic
1124581894 15:30963270-30963292 GAATTTGGACTCCTCTTAAGTGG + Intronic
1125741747 15:41970053-41970075 AACCATGGATTCATCTTGAGCGG - Intronic
1132083196 15:98884850-98884872 GAGTTTGGACTACTCTTAAGAGG - Intronic
1137930377 16:52581604-52581626 TAACTTGGATTCCTCCTGAGTGG - Intergenic
1144284181 17:13756693-13756715 AAGCATGGACCCCTGTTGAAAGG - Intergenic
1147217830 17:38911308-38911330 AAGCCTGGACTGCCCTTGAGTGG + Intronic
1150553622 17:66233700-66233722 AAGCTTGTATTCCTCTTTAGGGG - Intronic
1151409187 17:73909956-73909978 CAGCCTGGACTTCTCTAGAGAGG + Intergenic
1156326667 18:36079741-36079763 AAGCTCAGACTCTCCTTGAGTGG - Intergenic
1161184439 19:2907017-2907039 CCGCCTGGACTCCTCTGGAGAGG - Intronic
1164560017 19:29284454-29284476 AAGCTTGCCCTCCTGTGGAGGGG - Intergenic
1164696220 19:30246487-30246509 AAGCTTGCAGTCTACTTGAGAGG - Intronic
1167707353 19:51089475-51089497 AAGTCTGGACTCCTCGGGAGAGG + Intergenic
925213859 2:2075318-2075340 AAGCTATGATTCCTCTTGATGGG + Intronic
925875621 2:8309003-8309025 AAGCTTTGCCTCCTCTCAAGAGG + Intergenic
931563513 2:63589168-63589190 AAGCTCGGACTCATCTTCTGGGG + Exonic
932819580 2:74887970-74887992 AAGCGTGGACTACTCTTCCGAGG + Exonic
934152567 2:89161738-89161760 AAGCTGGGCTTCCTCTTGAATGG + Intergenic
934214678 2:90020180-90020202 AAGCTGGGCTTCCTCTTGAATGG - Intergenic
935224694 2:101043300-101043322 GAACTTGGGGTCCTCTTGAGGGG - Intronic
937828938 2:126399345-126399367 AAGCTCAGACTCTTCTTGGGCGG + Intergenic
941123100 2:161554176-161554198 AGGCTTGGACACCACTTCAGGGG + Intronic
942996148 2:182263101-182263123 AGGCATGGACTCCTGCTGAGTGG + Intronic
946362626 2:219228563-219228585 ATGCTTGGCCTCCTCTTGGTGGG - Intronic
1171181495 20:23094146-23094168 AAGCTGGGACCCCTTTGGAGGGG + Intergenic
1179918522 21:44494133-44494155 AAGCTCAGACTCCGCATGAGAGG + Intergenic
1180195692 21:46192221-46192243 AGGCTTGGCGTCCTCTTCAGGGG - Intronic
1180962779 22:19769777-19769799 GAGCGTGGAGTCCTCATGAGTGG + Intronic
1183678478 22:39313040-39313062 AGTCTTGGTCTCCTCTAGAGTGG - Intronic
1183929604 22:41228403-41228425 CAGCTTGGGTTCCACTTGAGGGG + Intronic
1184662754 22:45972801-45972823 AGGCTTGTGCTCCTCTTGGGGGG + Intronic
952649882 3:35713008-35713030 GTGCTGGGACTCCTCTTCAGTGG + Intronic
963646608 3:147923027-147923049 AAGGATGGACTCCTCTTGATGGG - Intergenic
967853423 3:194098793-194098815 ACGCTAGGACTTCTCTTGTGAGG + Intergenic
968041818 3:195595230-195595252 AACCTTGCCCTTCTCTTGAGTGG - Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
981132754 4:141176226-141176248 AAGGTTGGACCCCTCATGAAAGG - Intronic
985575871 5:673343-673365 CAGCTTGGACTCCCCTCGGGGGG - Intronic
988652391 5:33166919-33166941 AAGCTCAGACTCCCCTTGGGAGG + Intergenic
989339431 5:40356432-40356454 AAGCTTGGACTGTTGTTGATTGG - Intergenic
990672466 5:58148472-58148494 AAGCCTGGATGCCTCTTCAGTGG + Intergenic
992886546 5:81165736-81165758 AAGCTTTGACTCATCTCCAGAGG + Intronic
993574579 5:89586034-89586056 AAGATTGGATTCCTCATGAATGG - Intergenic
994014467 5:94948712-94948734 AAGCTTGGACTCTACTTCAGAGG + Intronic
998731408 5:145081583-145081605 AGGCTTGGTCTCCTCTGGATAGG + Intergenic
999311312 5:150553854-150553876 AGGCTGGGAGTCCTCTTGAGGGG - Exonic
1007863677 6:44942827-44942849 AACTTTGAACTCCTCTTCAGTGG - Intronic
1009792052 6:68416317-68416339 AGGCTTGGACTCCTGCAGAGTGG - Intergenic
1012359885 6:98364092-98364114 AAGCTTGCACTCCAATTCAGTGG + Intergenic
1023555944 7:41423204-41423226 GAGGGTGGAGTCCTCTTGAGTGG + Intergenic
1025849864 7:65236965-65236987 AAGCTGCCACTCCTGTTGAGAGG + Intergenic
1026913215 7:74104820-74104842 GAGCTTGGCCTCCTCTTGCAGGG + Intronic
1027154304 7:75755661-75755683 AAGCTTGGACTCCAGTTGCCTGG - Intergenic
1031121815 7:117730493-117730515 AAGCCTTGTCTCTTCTTGAGTGG - Intronic
1034588958 7:152122439-152122461 AAACTGGGACGCGTCTTGAGAGG - Intergenic
1035001033 7:155612181-155612203 AAAGTAGTACTCCTCTTGAGTGG - Intronic
1035430004 7:158812182-158812204 AAGCATGTACTCCTCCAGAGGGG - Intronic
1037549570 8:19957182-19957204 AAGCTTGGCCTCTTGTTTAGAGG + Intronic
1039784371 8:40819607-40819629 AAGCTTGCAGTCCTCTTGGGAGG + Intronic
1048665199 8:136653316-136653338 CAGCTTGGACACCTGTTGTGTGG - Intergenic
1055709548 9:79045119-79045141 ACGGTTGGAGTCCTCCTGAGGGG + Intergenic
1056937506 9:90927590-90927612 AGGCTGGGTCTCCTCTTGAGGGG + Intergenic
1057040811 9:91846170-91846192 AAGCTTGGAATACTGTAGAGTGG + Intronic
1057700751 9:97361781-97361803 CAGCTTGGCCTCCTCTTCAAGGG - Exonic
1188163105 X:26826797-26826819 TAGCTTGGACCCTTCTTTAGCGG - Intergenic
1191879323 X:65828657-65828679 AACCTTAGACTCTTCTTGAGTGG - Intergenic
1193505445 X:82336842-82336864 TAGCTTGTACTCCTGTTCAGCGG - Intergenic
1195474293 X:105266590-105266612 AAGATTGGACTTCTCTAGAAAGG - Intronic
1196937742 X:120746231-120746253 GAGCTTGAACTTCTCTTGTGAGG + Intergenic