ID: 1091820543

View in Genome Browser
Species Human (GRCh38)
Location 12:3472415-3472437
Sequence CACTGAAGGCAGGACAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 475}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091820543 Original CRISPR CACTGAAGGCAGGACAGGAG TGG Intronic
900155082 1:1200697-1200719 CTCTGAGGACAGGACAGGAGAGG - Intergenic
900193272 1:1360358-1360380 CACTGAGGGCCGGACAGGGAGGG - Intronic
900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG + Intronic
900315382 1:2053665-2053687 CACTGGAGGCAGGACTGTAGGGG + Intronic
900511184 1:3061910-3061932 CACTGAAGGGTGGAGAGGGGAGG + Intergenic
900573900 1:3373628-3373650 CCCTGCAGGCAGGACAGACGCGG + Intronic
900702499 1:4057080-4057102 GACTGAAGGCAGTAGAGGAGAGG + Intergenic
901068144 1:6504354-6504376 CAGGGAGGGCAGGACATGAGAGG - Intronic
902398268 1:16144051-16144073 GGCTGGAGGCAGGACAGGAGCGG - Intronic
902589303 1:17462066-17462088 CACTGATGTCAGGACCTGAGAGG - Intergenic
902672622 1:17985287-17985309 AACTGCAGGCTGGAGAGGAGGGG - Intergenic
902954537 1:19916111-19916133 ATATGAAGGCAGGACAGCAGAGG + Intergenic
903181440 1:21606960-21606982 GACTGGAGACAGGACAGGTGGGG - Intronic
903203079 1:21759278-21759300 GACTGAAGGGAAGGCAGGAGTGG + Intronic
903270066 1:22182604-22182626 CCCTGGAGGAAGGGCAGGAGCGG + Intergenic
904755812 1:32767978-32768000 CACTGGAGGGAGGAGAGGGGAGG - Intronic
905285819 1:36879681-36879703 CTTGGAAGGCAGGGCAGGAGTGG + Intronic
905482494 1:38271265-38271287 CTCTGGAGCCAGGGCAGGAGGGG - Intergenic
905881255 1:41465688-41465710 GACTGAAAGGAGGGCAGGAGGGG - Intergenic
905912605 1:41664217-41664239 CAGTGGGGGCAGGGCAGGAGTGG - Intronic
905933707 1:41807261-41807283 GAATGAAGCTAGGACAGGAGGGG + Intronic
905974648 1:42165632-42165654 CAGGGCAGGCAGGACAGGATGGG - Intergenic
906612993 1:47216126-47216148 CCCTGAAGGCAGGCCTGGTGGGG - Intergenic
906773380 1:48505607-48505629 CACTGAAGGGAGGAAGGGAAGGG + Intergenic
906790840 1:48657496-48657518 TCCTGAAGGCAGGACAGAGGTGG + Intronic
907189193 1:52634156-52634178 GACTGCAGGCAGGACAGAAGAGG - Intronic
907815559 1:57915389-57915411 CAAGGAACCCAGGACAGGAGAGG - Intronic
909103920 1:71384799-71384821 ACCTGAAGGCAGCACAGTAGTGG - Intergenic
909349067 1:74627361-74627383 CATGGAAGGCAAGAGAGGAGAGG + Intronic
909505822 1:76388618-76388640 GGCTAAAGGCAGGACAGCAGTGG - Intronic
909792169 1:79693381-79693403 CACTGGAGCCAGGGCTGGAGTGG + Intergenic
910372789 1:86535411-86535433 CACGAAAGGCAGGAAAAGAGAGG - Intergenic
910739225 1:90496622-90496644 CAATGTAGGCAGGACAAGAAGGG + Intergenic
912015226 1:105026575-105026597 CACTGAAAGCAGAACGGAAGAGG + Intergenic
912242514 1:107926519-107926541 CACTGAAAGCAGCACTGAAGAGG + Intronic
913196748 1:116463016-116463038 CACTGAAGCCAGGAAAGCAGAGG - Intergenic
915477686 1:156162644-156162666 CAGTGTAGGCAGGACAGGCAGGG + Intronic
915515258 1:156409057-156409079 CACTGAGGCCAGGCCAGGAGAGG + Intronic
916492139 1:165311425-165311447 CACTGAAGGGATGACACGACAGG + Intronic
917365515 1:174227594-174227616 ATCTAAAGGCAGGAAAGGAGGGG - Intronic
917674066 1:177302643-177302665 CAGTGAAGCCAGTCCAGGAGAGG - Intergenic
920261868 1:204693851-204693873 GTCTGAAGGCAGGAGATGAGGGG + Intergenic
920315756 1:205074679-205074701 GACTGCAGGCAGCACTGGAGAGG - Exonic
921277089 1:213531338-213531360 GAAGGAAGACAGGACAGGAGAGG + Intergenic
921471756 1:215557742-215557764 CACTGAAAGCATGGAAGGAGAGG - Intergenic
921613417 1:217238341-217238363 CACTGAATGCAGGATTGGAAAGG - Intergenic
922617964 1:226974250-226974272 CAATGAAGGAATGACAGGGGAGG - Intronic
922622831 1:227004017-227004039 CACTGAAAGAAGGCCAGGAATGG - Intronic
922767297 1:228162755-228162777 CCCTGAAGCCAGGACAGGGGCGG + Intergenic
922920687 1:229300330-229300352 AACTGAAGGGAGGACAGGCCTGG + Intronic
923041360 1:230322238-230322260 TGCTGACGGCAGGACTGGAGAGG - Intronic
923301336 1:232643400-232643422 CACTGAAAGCATGAAAGGATAGG - Intergenic
923417428 1:233777119-233777141 GTCTGAAGGAAGGACAGCAGAGG - Intergenic
923721276 1:236469025-236469047 CACTAAAAGCAGAAAAGGAGAGG - Intronic
923852545 1:237813135-237813157 CCCTGAAGGCAGGAGGGGAGTGG + Intronic
1065328516 10:24570694-24570716 CCCTCAAGGCAGGAGAGCAGTGG - Intergenic
1065909006 10:30285302-30285324 CACTGAAGGCTGGAAAGGGATGG + Intergenic
1066161594 10:32738108-32738130 CAGAGAAGGCAGGAAAGGTGTGG - Intronic
1067939318 10:50640336-50640358 CACTGTAGGCAGGCCAGGGAAGG + Intergenic
1067944507 10:50681719-50681741 GACAGATGGCAGGACAGGTGTGG + Intergenic
1068700032 10:60009865-60009887 GACTGGAGGCAGGACTGAAGTGG + Intergenic
1068805123 10:61186616-61186638 CACAGAAGGTAGGCCAGGCGCGG + Intergenic
1069890561 10:71649616-71649638 CACTGGTGGCAGGAAAAGAGTGG + Intronic
1070794518 10:79209040-79209062 CAGTGAAGGCAGCACAGGGAAGG + Intronic
1070879800 10:79846721-79846743 GACAGATGGCAGGACAGGTGTGG + Intronic
1071632907 10:87230811-87230833 GACAGATGGCAGGACAGGTGTGG + Intronic
1071646356 10:87363029-87363051 GACAGATGGCAGGACAGGTGTGG + Intronic
1072213224 10:93266017-93266039 CACTGAAGAAAGGCCAGGTGAGG + Intergenic
1072359630 10:94647109-94647131 CAAGGAGGGCAGGAAAGGAGAGG - Intergenic
1072518600 10:96210659-96210681 GACAGAGGGCAGGCCAGGAGGGG + Intronic
1072957152 10:99897334-99897356 CAGTGAAGACAGGACAAGAAAGG + Intronic
1073140441 10:101243606-101243628 GACAGAAGGCAGGCCAGGACTGG - Intergenic
1073689563 10:105792783-105792805 CACTAAAGGCAGGAAATAAGGGG - Intergenic
1074282102 10:112062373-112062395 TATTTAAGACAGGACAGGAGGGG + Intergenic
1075467200 10:122660725-122660747 CAGAGAAGGCAGGAAAAGAGGGG - Intergenic
1075782655 10:125027015-125027037 CCCCGAAGGCAGCACAGGGGTGG - Exonic
1075905825 10:126081212-126081234 TGCTGACGGCAGGAAAGGAGTGG + Intronic
1076240400 10:128900744-128900766 CACTGTGGGCTGGAGAGGAGAGG + Intergenic
1076401363 10:130187606-130187628 CACAGAAGGCAGGCAATGAGAGG - Intergenic
1076803610 10:132844255-132844277 GCCTGCAGCCAGGACAGGAGAGG - Intronic
1077252073 11:1565150-1565172 CACTGCTGTGAGGACAGGAGGGG - Intronic
1077626620 11:3777906-3777928 TACTGATGGCAGGCCAGGCGCGG + Intronic
1078426274 11:11253659-11253681 CACTGCAGGCAGGAGAGGAAAGG + Intergenic
1078529110 11:12122697-12122719 CATTAAAGGCAGGCCAGGCGCGG - Intronic
1078924229 11:15859511-15859533 CACTGATGGGAGGACAGATGAGG - Intergenic
1079451440 11:20602569-20602591 CCCTGAGGCCAGGAAAGGAGAGG - Intronic
1081856147 11:46305094-46305116 CATTCAAGGCAGGGCTGGAGGGG - Intronic
1082926183 11:58549938-58549960 GACTGAAAGCTGGAGAGGAGCGG + Intronic
1083422093 11:62559577-62559599 CAAAGGAGGCAGGACAGGAAAGG + Intergenic
1083998761 11:66284798-66284820 AACTGAAGCCTGGCCAGGAGGGG + Intronic
1085399019 11:76224504-76224526 CACCAAATGCAGGACAGGAGAGG - Intergenic
1085449518 11:76623470-76623492 CACAGAAGGAAGGAAGGGAGTGG + Intergenic
1085472955 11:76769665-76769687 CACAGAGGGCAGGAGGGGAGGGG - Intergenic
1085740801 11:79076749-79076771 CACTGAAGACAGGAAAAGAAAGG + Intronic
1086086522 11:82960949-82960971 CACTCAAGGCAGGCAAGGGGTGG - Intronic
1088290202 11:108228355-108228377 AACTGATTGCTGGACAGGAGTGG + Intronic
1089640213 11:119843053-119843075 CGCTGAAGGCAGAATGGGAGAGG + Intergenic
1089891035 11:121881122-121881144 CATGGAAGGAAGGGCAGGAGAGG - Intergenic
1091820543 12:3472415-3472437 CACTGAAGGCAGGACAGGAGTGG + Intronic
1091848970 12:3679893-3679915 CTATGAAGGCAGAAAAGGAGAGG + Intronic
1092020054 12:5194233-5194255 CACTGAAGGCAAAATAGAAGGGG - Intergenic
1094407568 12:30134332-30134354 CCCTGAAAACAGGACAAGAGTGG + Intergenic
1096747890 12:53740094-53740116 CAGTGACGGCAGGACAGGGAGGG + Intergenic
1100594277 12:96058524-96058546 CATAGAAGGCAGAGCAGGAGAGG - Intergenic
1100863356 12:98830535-98830557 AACAGAGGGCAGGACAGGAAAGG - Intronic
1101797453 12:107988619-107988641 AACTGAATGAAGGAGAGGAGAGG + Intergenic
1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG + Intergenic
1105049923 12:133039758-133039780 CTTTGAAGGCAAGAAAGGAGGGG + Intronic
1105306272 13:19171238-19171260 GACTGGAGCCAGGGCAGGAGTGG - Intergenic
1106853745 13:33824152-33824174 CACAGAAGGCAAAACAGGAAGGG - Intronic
1107252305 13:38378963-38378985 CAGTGATGGCAGAACAGAAGGGG + Intergenic
1107262625 13:38513345-38513367 CAAAGAAGGCAGGAAAGAAGTGG + Intergenic
1108422831 13:50267985-50268007 GATTGAAGGGAGCACAGGAGTGG + Intronic
1108566082 13:51699279-51699301 CACTGAAGGAAGGGATGGAGAGG - Intronic
1109458673 13:62626488-62626510 CACTGAAGGAAGGAAGGGAATGG - Intergenic
1112275570 13:98015161-98015183 CACTGAAGGAAGGGCATTAGAGG - Intronic
1114256732 14:21009520-21009542 CACTGAACGCAGCACTGGGGTGG - Intergenic
1114267670 14:21082223-21082245 CACTGCAGGCACAATAGGAGTGG - Exonic
1114898988 14:27032772-27032794 CACTGTAGGCAGAACAAGAGTGG - Intergenic
1115115683 14:29878745-29878767 GGCTGAAGGGAGGACAGGAATGG + Intronic
1115264706 14:31489027-31489049 CACTGAGGTCAGCACAGAAGGGG - Intergenic
1115934052 14:38531527-38531549 CAATGGAGGCAGAGCAGGAGAGG - Intergenic
1116477129 14:45353022-45353044 GACTGAAGGCAGGACCGCATGGG + Intergenic
1118359590 14:65044745-65044767 CACAGAGCCCAGGACAGGAGTGG - Intronic
1118612931 14:67555491-67555513 GACTGAAGCCAGGACAGGGTGGG + Intronic
1119188529 14:72662660-72662682 CACAGGAGCCAGCACAGGAGTGG - Exonic
1119921850 14:78454059-78454081 TACTGAAAGAAGGAAAGGAGAGG - Intronic
1121259207 14:92553889-92553911 CCCTGAAGGCAGGGCTGTAGGGG - Intronic
1121319024 14:92980339-92980361 CTCTGAAGGCTTGAGAGGAGGGG + Intronic
1122632576 14:103113802-103113824 TACTGAAGCCAGGAAGGGAGGGG - Intergenic
1122812831 14:104297464-104297486 CACTGAAGGCAAAGCAGGGGTGG - Intergenic
1124204086 15:27702371-27702393 CACCGGAGGCAAGAGAGGAGAGG - Intergenic
1125729022 15:41882495-41882517 CAGTGAAGGCAGAACAGGGGAGG + Intronic
1125769325 15:42154457-42154479 CACTGCAGGTAGGACAGGGAGGG + Exonic
1126077225 15:44923142-44923164 CACAGAAAGCAAGCCAGGAGTGG - Intergenic
1126081490 15:44967723-44967745 CACAGAAAGCAAGCCAGGAGTGG + Intronic
1126947528 15:53839741-53839763 CAATGAAGGCAAGATAGGAGGGG - Intergenic
1127282316 15:57502923-57502945 CACTGGAGGCTGAGCAGGAGTGG - Intronic
1128171506 15:65517562-65517584 CACTGCAACCAGGACCGGAGTGG - Intronic
1128285143 15:66430321-66430343 CACTGTAGGAAGGAGAGGAAGGG - Intronic
1128372941 15:67053787-67053809 CCCAGAAGGCAAGATAGGAGGGG + Intergenic
1128631095 15:69268455-69268477 CACTGACCTCAGGAAAGGAGTGG + Exonic
1128995585 15:72292100-72292122 GACTGAAGCCAGAAAAGGAGGGG + Intronic
1129179770 15:73866793-73866815 GACTGAAGACAGCAGAGGAGAGG + Intergenic
1129737567 15:77974690-77974712 TACTGAAGGCAGGTGTGGAGAGG - Intergenic
1130041988 15:80413040-80413062 CACTGAAAGGAGGCCAGGAAAGG - Intronic
1130796901 15:87219164-87219186 CACTGAAGCCAGAAGAGGACAGG - Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131443954 15:92480228-92480250 CACTGCAGGAAGGACATGATAGG - Intronic
1131650171 15:94389342-94389364 CACTGAGGGCAGCCCAGGAAAGG + Intronic
1132339548 15:101069260-101069282 CACTTGAGGTAGGGCAGGAGGGG + Exonic
1132402749 15:101523484-101523506 CACCTCAGGCAAGACAGGAGAGG - Intronic
1133218571 16:4307980-4308002 CTCGGAAGGCAGGAGGGGAGGGG + Intergenic
1133942678 16:10323395-10323417 CACAGAAGGTAGGAGAAGAGGGG - Intergenic
1135635039 16:24068327-24068349 CAGGGAAGGCAGGACTTGAGGGG - Intronic
1136555045 16:31002611-31002633 CACTCAGAGCTGGACAGGAGAGG + Intronic
1136605951 16:31333849-31333871 CACTCAGGGCAGGCCAGAAGTGG - Intergenic
1136612985 16:31378362-31378384 CACTGACTGCAGGAGAGCAGGGG - Intronic
1137299544 16:47134723-47134745 AACTGAAGGCAAGACAGCAACGG + Intronic
1138484469 16:57328960-57328982 CAATGAAGGCAGGCCAGGTGCGG - Intergenic
1140329797 16:74043625-74043647 AACTAAAGGCAGGGAAGGAGAGG + Intergenic
1140507901 16:75485913-75485935 GACTGAAGGGAGGCCAGGTGGGG - Intronic
1140777864 16:78266517-78266539 CTCTGAAGGCAGGATAGCATAGG + Intronic
1141986870 16:87585806-87585828 CTCTGAGGCCAGGACAGGATGGG + Intergenic
1141989726 16:87602880-87602902 CGCTGGAGACAGGACCGGAGGGG - Intronic
1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG + Intronic
1142703120 17:1676523-1676545 ATCTGAAGGCAGAACAGGAGCGG - Exonic
1142901518 17:3015069-3015091 AACTGAGGGCAGGACAGGGGTGG - Intronic
1143316437 17:6036796-6036818 CACTGAAGCCAGCAGAGGATGGG + Intronic
1143538997 17:7558532-7558554 GACTGAAGGTGGGAAAGGAGGGG - Intronic
1143990161 17:10952334-10952356 GACTGAAGGCAGGAGAGAGGAGG + Intergenic
1144494211 17:15736578-15736600 CAGGGCAGGCAGGACAGTAGGGG + Intronic
1144906050 17:18640098-18640120 CAGGGCAGGCAGGACAGTAGGGG - Intronic
1147411974 17:40260030-40260052 CACAGAAGATAGAACAGGAGGGG + Intronic
1147426289 17:40347407-40347429 CACTGTAGGCAGAACAGGGCTGG - Intronic
1147585259 17:41650957-41650979 GCCTCAAGGCAGGACAGGTGGGG + Intergenic
1147721372 17:42541605-42541627 CACTGCAGGCAGGAGGTGAGTGG + Intronic
1148091886 17:45027527-45027549 CACTGAAAGCAGGGCATGAGTGG + Intronic
1148211973 17:45814038-45814060 CACGGAGGGCAGGAAAGGACTGG - Intronic
1148755640 17:49971731-49971753 CAGGGGAGGCAGGACAGGCGCGG + Intronic
1148778021 17:50106633-50106655 CAGGGAAGGGAGGACAGAAGCGG + Intronic
1150212390 17:63448245-63448267 CACTCAAGAAAGGGCAGGAGGGG - Intergenic
1150639927 17:66942608-66942630 CACTGAAGACAGGGGAGGAGGGG + Intergenic
1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG + Intronic
1151368053 17:73629921-73629943 CTTTTAAGTCAGGACAGGAGGGG + Intronic
1151598478 17:75091859-75091881 CGCAGGAGGCAGGATAGGAGGGG + Intronic
1151744720 17:76005731-76005753 CCCTGCAGGCAGGGCAGGTGAGG - Exonic
1152048009 17:77951243-77951265 CTCTGGAGGGAGGACAGGAGGGG + Intergenic
1152206314 17:78976463-78976485 CCCTGAGGGAAGGATAGGAGGGG + Intronic
1152293622 17:79454388-79454410 CGCAGAGGGCAGGCCAGGAGGGG - Intronic
1152425878 17:80218446-80218468 CACTGGGGGCACCACAGGAGAGG + Intronic
1152990009 18:354791-354813 CACTGAAGGAAAGAAAAGAGGGG + Intronic
1153732536 18:8029229-8029251 CACTCCAGGCAGGACAGGTGGGG - Intronic
1153732547 18:8029258-8029280 CACTCCAGACAGGACAGGTGTGG - Intronic
1153732573 18:8029347-8029369 CACTGATGGCAGGACAGGTGTGG - Intronic
1153732590 18:8029407-8029429 CACTCCAGGTAGGACAGGTGGGG - Intronic
1153732600 18:8029436-8029458 CACTCCAGGCAGGACAGGTGTGG - Intronic
1153923170 18:9809081-9809103 CACATAAGGCAGTACAGGATGGG + Intronic
1154263232 18:12856207-12856229 GACTGAAGTCAGGAGAGGAGAGG + Intronic
1155372880 18:25121655-25121677 CAGTGAAGGAACAACAGGAGGGG + Intronic
1156372156 18:36481161-36481183 GACTGAAGGAAGGAGGGGAGCGG + Intronic
1156536343 18:37868159-37868181 CATTGGAGGCAGGACAGGGCAGG + Intergenic
1157030407 18:43899927-43899949 GACTGCAGACAGGACAGAAGAGG - Intergenic
1157431040 18:47626951-47626973 CATTGAAGGCTGGACTGGAAGGG - Intergenic
1158200942 18:54939747-54939769 CACTGAAGGCAAATGAGGAGAGG - Intronic
1158547181 18:58406251-58406273 CACTGAAGGCAGCACACTAAAGG + Intergenic
1158547482 18:58408437-58408459 CACTGAAGGCAGCACACTACGGG - Intergenic
1160131544 18:76230026-76230048 CAATAAACGCAGGACAGCAGAGG - Intergenic
1160266162 18:77342066-77342088 CACTGCAGGCCGCACGGGAGGGG - Intergenic
1160346903 18:78139617-78139639 CACTGAGGGCACGAGGGGAGAGG - Intergenic
1160580290 18:79879873-79879895 CACCAAAGGCAGGACAGGAAGGG + Intronic
1160749161 19:725942-725964 CAAGGAAGCCAGGACAGGAGGGG - Intronic
1160940876 19:1619939-1619961 CACCGGAGGCTGGACAGGCGGGG - Intronic
1161068742 19:2250316-2250338 CACTGCAGCCGGGACAGCAGGGG - Exonic
1161345412 19:3766740-3766762 CACAGAAGCCAAGACGGGAGTGG + Intronic
1161698335 19:5782534-5782556 CACTGCAGGCAGGGCGGGAAGGG - Intergenic
1161796284 19:6388502-6388524 GACTGAGGGCAGAACAGGAGGGG - Intronic
1162183797 19:8888950-8888972 CCCACAGGGCAGGACAGGAGGGG + Intronic
1162796707 19:13090859-13090881 CACTGAGGGCAGGGCAGGGCAGG + Intronic
1163005298 19:14393658-14393680 GCCTGAATGCAGGGCAGGAGGGG - Intronic
1163472386 19:17505203-17505225 CACTCTCGGCAGGAGAGGAGAGG - Exonic
1164320525 19:24140209-24140231 CACAGAAAGGTGGACAGGAGAGG - Intergenic
1164706475 19:30323869-30323891 GACTGAGGGGAAGACAGGAGTGG - Intronic
1164807811 19:31130337-31130359 GACTGAAAGCAGGTAAGGAGTGG - Intergenic
1165596782 19:37015900-37015922 CATGGAAGGCAGGAAAAGAGAGG - Intronic
1166248993 19:41552712-41552734 CACCGAATGCAGCACTGGAGTGG + Intronic
1166477430 19:43140444-43140466 CACTCATGGCAGAAGAGGAGGGG - Intronic
1166739235 19:45104140-45104162 CCCAGAAGGCAGCACGGGAGGGG - Intronic
1166762907 19:45235755-45235777 CACTGGAGGGAGGTGAGGAGGGG - Intronic
1167445061 19:49532964-49532986 CACTTAGGACAGGACAGGCGCGG - Intronic
1167645354 19:50702668-50702690 CACAGAGGGCATGAGAGGAGGGG + Intronic
1168350598 19:55673837-55673859 CACTGAAGGCAGGAAGGGACAGG - Intronic
925088439 2:1132852-1132874 CACTGAACTCAGGAGAGAAGGGG - Intronic
925688539 2:6496408-6496430 CACAGTAGCCAGCACAGGAGAGG + Intergenic
925992988 2:9268936-9268958 CACTGCAGGCAGCACAGCACCGG - Intronic
926062781 2:9814475-9814497 CTATGAGGGCAGGACTGGAGAGG + Intergenic
926542342 2:14196948-14196970 GACAGAAGAGAGGACAGGAGAGG - Intergenic
926741157 2:16111814-16111836 CAGTGATGGAAGGAGAGGAGAGG + Intergenic
928636277 2:33250473-33250495 CACCTAAGGCAGGGAAGGAGAGG + Intronic
928986398 2:37186390-37186412 CAGGGAAGGCAAGAAAGGAGTGG - Intronic
929558217 2:42938547-42938569 CACTGCAGGCTGGACTGCAGTGG - Intergenic
929761058 2:44806537-44806559 GACTGGAGGGAGGGCAGGAGGGG - Intergenic
930102280 2:47612710-47612732 CACAGAGGGCAGGGAAGGAGTGG + Intergenic
931134126 2:59377592-59377614 CACATAAGGCAGGAAAGGAGAGG + Intergenic
931568790 2:63646085-63646107 CACTAAAGGGAAGACAGGAAGGG - Intronic
932555015 2:72815454-72815476 CACTCTAGCCAGGACAAGAGAGG + Intronic
933814947 2:86059116-86059138 CACTGAATACAACACAGGAGGGG + Intronic
934126531 2:88898255-88898277 CACTGGAGGGAGGACTGAAGAGG - Intergenic
935351017 2:102151922-102151944 CAGTGAAGGCAGAAGAGTAGGGG + Intronic
935640510 2:105285575-105285597 CACTGAAGGTACAACAGAAGTGG + Intronic
935679834 2:105626323-105626345 CACTGAAGGCAGCTGAGCAGAGG + Intergenic
936250695 2:110866247-110866269 AGCTGGAGGCAGGAGAGGAGGGG + Intronic
936372710 2:111916326-111916348 CACTGAAGTCCTGAAAGGAGAGG - Intronic
936401623 2:112168979-112169001 AACAGCAGGCAGGCCAGGAGCGG + Intronic
937650899 2:124318084-124318106 CACTGGAGGCAGTGGAGGAGAGG + Intronic
938138597 2:128778996-128779018 CATTCCAGGCAGGACAGAAGGGG - Intergenic
938146939 2:128842455-128842477 CACTGGAGGCTGGAAAGGTGAGG - Intergenic
938714787 2:134009643-134009665 CTCTGAATGCAGGACCTGAGGGG - Intergenic
939935483 2:148287514-148287536 GACTGAAGGCAAAACAGGAGAGG - Intronic
939991126 2:148876947-148876969 CACTGGAGGAAGGGGAGGAGGGG - Intronic
940396733 2:153198444-153198466 CACTGAAGGAATGAGAGGAGAGG - Intergenic
940601856 2:155873382-155873404 CACTGAAAGCAAGGAAGGAGAGG + Intergenic
940789011 2:158012064-158012086 CACTAAAGGCAGGACCGCAGAGG - Intronic
941117792 2:161491490-161491512 CACTGATGGCAGGAGAAGAAAGG + Intronic
941680805 2:168396782-168396804 CCCTTAAGGCAGGATAGGAGTGG - Intergenic
942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG + Intergenic
944783841 2:203047598-203047620 CACAGAAGGCATTACAGCAGAGG - Intronic
945179704 2:207079383-207079405 CAGTCAAAGGAGGACAGGAGGGG + Exonic
945669348 2:212784644-212784666 CATTGAAGGAAGGGAAGGAGAGG + Intergenic
946104575 2:217358028-217358050 GACTGAAGCCAGGACAGGAGTGG + Intronic
947001348 2:225460548-225460570 CTCTGAAGGTAAGAGAGGAGGGG + Intronic
947315343 2:228851623-228851645 CTCTGGAGACAGGACTGGAGGGG + Intronic
947540847 2:230976750-230976772 CACTAGAGGCCAGACAGGAGGGG + Intergenic
948550833 2:238772212-238772234 CACTGAACGCTTCACAGGAGAGG - Intergenic
948870213 2:240794054-240794076 CACTGCAGACAGGGCATGAGAGG - Intronic
1169135098 20:3192458-3192480 CAGCGAAGGCAAGGCAGGAGTGG - Intronic
1169236079 20:3930916-3930938 CAGGGAAGGCAGGACAGAAATGG - Intronic
1169309010 20:4519371-4519393 CTCTGAAGGCAGAGCATGAGAGG + Intergenic
1169970786 20:11267538-11267560 AACTGAAGGCTGAACAGCAGGGG + Intergenic
1171349994 20:24494745-24494767 CCCTGAAGCCAGCACAGCAGGGG - Intronic
1172697381 20:36831972-36831994 CACTGGAGGCAGGAGTGGTGGGG + Intronic
1173161335 20:40654690-40654712 CATTGAAGGCAGGCCCGTAGTGG - Intergenic
1174193911 20:48759257-48759279 TACTGCAGGCAGGCCAGGCGCGG + Intronic
1174513156 20:51071173-51071195 CACTGCAGCAAGGTCAGGAGAGG + Intergenic
1174683825 20:52434442-52434464 CACTGGAGGAAGGAAAGAAGAGG - Intergenic
1174849884 20:53983610-53983632 AGCTGAAGGCATGACAGGTGGGG - Intronic
1175927651 20:62478916-62478938 CACACAAGGCAGGACAGGGCTGG + Intergenic
1176044199 20:63083967-63083989 CCCAGAGGGCAGGACGGGAGCGG + Intergenic
1176088011 20:63306861-63306883 CCCTGAGGGGAGGACAGCAGCGG - Intronic
1176309376 21:5141705-5141727 GACCTGAGGCAGGACAGGAGGGG + Exonic
1177686513 21:24444036-24444058 CAGTGAAGGCAGAAGATGAGGGG + Intergenic
1177900855 21:26913566-26913588 CACTGACTCCAGGACAGGATTGG - Intergenic
1177947195 21:27485492-27485514 CACAGAAAGAAGGACTGGAGTGG + Intergenic
1178073218 21:28992349-28992371 CACTGTAGGTAGCAAAGGAGAGG + Intronic
1178262614 21:31113994-31114016 CAGAGAAAGGAGGACAGGAGTGG + Intergenic
1178476897 21:32944897-32944919 GTCTGGAGGCAGGACAGGATGGG + Intergenic
1178630980 21:34261375-34261397 CACTGAAGCCATGAGAGGTGGGG + Intergenic
1179724090 21:43332100-43332122 CACAGACAGCAGGACAGGGGTGG - Intergenic
1179847686 21:44120328-44120350 GACCTGAGGCAGGACAGGAGGGG - Exonic
1179937122 21:44612942-44612964 CACTTAACCCAGGACAGGACCGG - Exonic
1179964849 21:44796934-44796956 CAGTGAAGGCAGGATGGGGGTGG - Intronic
1179980040 21:44891061-44891083 CACTGCGGTCAGGACAGGGGAGG + Intronic
1180196520 21:46198592-46198614 CACTGAAGTGAGAACAGGGGCGG + Intronic
1180705634 22:17808288-17808310 CACTTAGGGCAGGGCTGGAGAGG - Intronic
1181667480 22:24408116-24408138 CAGAGAAGACAGGACAGGACAGG - Intronic
1181878601 22:25959562-25959584 AAATGAAGACAGGCCAGGAGCGG - Intronic
1182411177 22:30188132-30188154 CTCTGAAGCCAAGACAGTAGTGG + Intergenic
1182875634 22:33688913-33688935 CACTGAAGGAGGTTCAGGAGTGG - Intronic
1183075851 22:35426310-35426332 GCCTGAAGGGAGGCCAGGAGAGG + Intergenic
1183165287 22:36142960-36142982 AACTAAAGGCAGGTAAGGAGCGG - Intronic
1183168958 22:36170409-36170431 CACTGAAGGCTATACTGGAGTGG - Intergenic
1183429593 22:37757669-37757691 CCCTGAAGGCAGGGGAGCAGCGG + Exonic
1184120118 22:42444583-42444605 CCCTGGAGGCCGGACAGGAAGGG + Intergenic
1184186506 22:42868685-42868707 CCCTGAGGGCAGGGCAGGAGAGG + Intronic
1184393983 22:44221858-44221880 CACTGGAGGCTGGGCAAGAGGGG - Intergenic
1184787250 22:46677895-46677917 CACTGAGGGCAGGCGAGGGGTGG - Exonic
949134221 3:543095-543117 CGCTGAAAGCAGGAGAGGACTGG - Intergenic
949399462 3:3650793-3650815 CACAGAAGCCAAGAGAGGAGAGG - Intergenic
949474507 3:4430839-4430861 CAAGTAAGGCAGGGCAGGAGTGG + Intronic
949752496 3:7370704-7370726 GTCTGAAGGCAGGGAAGGAGGGG - Intronic
950680259 3:14580274-14580296 CACTCAGGGAAGGGCAGGAGAGG - Intergenic
950684720 3:14608315-14608337 CAAGGGAAGCAGGACAGGAGAGG - Intergenic
950703034 3:14763099-14763121 CACCAAGGGCAGGACAGGACAGG + Intronic
950870428 3:16223647-16223669 AACTGAAGGCAGGACTCAAGGGG + Intronic
951763195 3:26167018-26167040 CACTGAAGTAAAGAAAGGAGTGG - Intergenic
951902506 3:27670721-27670743 CACTGAAGGCAGCTCAGGTGTGG + Intergenic
952253843 3:31678892-31678914 GACTGAAGGCAGAAGTGGAGAGG - Intronic
952901740 3:38115651-38115673 GACTGAAGGCAGGAGGGGAGGGG + Intronic
953322842 3:41987663-41987685 CACAGAAGGGAGGAGAGGAGTGG - Intergenic
954713690 3:52516920-52516942 GGCCGGAGGCAGGACAGGAGAGG - Intronic
954714879 3:52522016-52522038 CACTGAGGGCAGGGAGGGAGTGG - Exonic
957379280 3:79404618-79404640 AACTGATGGCAGAACATGAGTGG - Intronic
957871268 3:86093095-86093117 CACTGGGGGCAGGACAGTGGGGG + Intergenic
959593747 3:108106299-108106321 CACTGATGGCAGGACAGCTCTGG + Intergenic
959740688 3:109715884-109715906 CACTGAATGCAGGAAAGCAGGGG - Intergenic
961158668 3:124703264-124703286 CAAAGAAGACAGGAAAGGAGAGG - Intronic
961390320 3:126548775-126548797 CCCTGGGGGCAGGACAGGGGTGG - Intronic
961718047 3:128872391-128872413 CCCTGTAGGCAGCACAGGAAAGG - Intergenic
961745797 3:129062754-129062776 CCCTGGAGGGAGGAGAGGAGGGG + Intergenic
963014588 3:140809773-140809795 CACAGAAGCCATGGCAGGAGGGG - Intergenic
963275937 3:143329830-143329852 CGCTGACGGCTGGGCAGGAGCGG - Intronic
964809028 3:160642256-160642278 CACTGAGGGCAGGGGAGAAGAGG + Intergenic
964902121 3:161671758-161671780 CACCCAAAGCAGGAAAGGAGAGG - Intergenic
965317221 3:167207895-167207917 CACTGAAAGAGGGACAGAAGTGG + Intergenic
965478829 3:169191177-169191199 CAGGGAAGGAAAGACAGGAGGGG - Intronic
965652775 3:170951031-170951053 CAGTCAAAGGAGGACAGGAGGGG + Intergenic
967712891 3:192729192-192729214 AACTAAAGGCAGGGGAGGAGTGG + Intronic
967875926 3:194268378-194268400 CCATCAAGGCAGGAGAGGAGGGG + Intergenic
967977694 3:195044622-195044644 GGCTGAAGGCAGGACACCAGGGG - Intergenic
968001600 3:195210245-195210267 CGCTGAAGTCAGGACAGGACAGG + Intronic
968458319 4:710220-710242 CTCTGAAGGCTGGACTGGGGAGG + Intronic
969480731 4:7445589-7445611 CGCTGAAGGCAGAACAGGGCGGG + Intronic
969674502 4:8607491-8607513 CACTGAGCTCAGGACTGGAGGGG - Intronic
969959962 4:10934430-10934452 CACTGAAGGCAATATATGAGAGG + Intergenic
970257880 4:14188003-14188025 CACTGAAGGCCCTAAAGGAGAGG + Intergenic
972008166 4:34138527-34138549 CACTGAAGGCAGAACAAGCCTGG + Intergenic
972362904 4:38345401-38345423 CATGGAGGGCAGGACAGGGGTGG - Intergenic
974039105 4:56842803-56842825 AGATGTAGGCAGGACAGGAGAGG + Intergenic
975778946 4:77819579-77819601 CGCTGAATGCAGGTGAGGAGGGG - Intronic
975842888 4:78494429-78494451 CACTCAAGGCAGAAGAGGAAGGG + Intronic
976413703 4:84747071-84747093 GAATGAAGGCAGGACAGGCACGG + Intronic
978379422 4:108111446-108111468 GCCTGAAGGGAGGAAAGGAGGGG + Intronic
978501784 4:109417728-109417750 CACTCCAAGCAGGAGAGGAGAGG + Intergenic
980981013 4:139654582-139654604 CACTGAAGGGAGGAAAGGAGAGG - Intergenic
981267043 4:142798155-142798177 TACCAAAGGAAGGACAGGAGAGG + Intronic
981456770 4:144962052-144962074 CAGTGAAGGGAGGACAGAGGAGG - Intergenic
981836787 4:149064350-149064372 CACTGTAGAGAGGAGAGGAGAGG + Intergenic
982041893 4:151405922-151405944 AAATCAAGGCAGGAAAGGAGAGG - Intergenic
982605341 4:157509342-157509364 AACTGAAGGCAGCACTGCAGAGG - Intergenic
982752573 4:159179719-159179741 CACTATGGGCAGGAAAGGAGTGG + Intronic
985042940 4:185910452-185910474 GAGAGAAGGGAGGACAGGAGAGG - Intronic
985620436 5:952181-952203 AGCTGGCGGCAGGACAGGAGAGG + Intergenic
986247629 5:6025175-6025197 CACTGAAGAAAGGAGAGGACAGG + Intergenic
986628633 5:9747434-9747456 CACTCAAGGCAGAATGGGAGGGG + Intergenic
986737171 5:10676336-10676358 CACTGAAGGCATGAGTGCAGAGG - Intergenic
987232118 5:15905795-15905817 AACAGAAGGCAGGAATGGAGAGG + Intronic
987438905 5:17932196-17932218 CACCTAAGGCAAGAAAGGAGAGG + Intergenic
991109213 5:62879649-62879671 AACTGAGGGCAGGGCATGAGGGG - Intergenic
992109012 5:73474990-73475012 CACTCAAGGCTGGCCAGGTGTGG - Intergenic
993590194 5:89784917-89784939 CAATGAAGACAGAAAAGGAGGGG + Intergenic
994778210 5:104061955-104061977 CACAGAAGTCAAGACAGGTGGGG - Intergenic
995183549 5:109250318-109250340 GACTGAAGGAAGTCCAGGAGTGG + Intergenic
996873324 5:128215788-128215810 CAAGGAAGGCAGGCAAGGAGAGG + Intergenic
997218211 5:132132530-132132552 CACGGAAGGCAGAAAAAGAGTGG - Intergenic
997926820 5:138038039-138038061 CTCTGAATGCAGTATAGGAGAGG - Intronic
998104052 5:139457128-139457150 AACTGAAAGCAGGAAAGAAGAGG - Intronic
998253895 5:140570432-140570454 CACTGAAGGCCTGCGAGGAGAGG - Intronic
999070532 5:148739090-148739112 AACTGGAGGCAAGACAGGTGAGG + Intergenic
999755315 5:154659795-154659817 CACTGTAGGAAGGACAGAATTGG - Intergenic
1000143389 5:158428809-158428831 GACTGAAGTCAGCACAGCAGTGG - Intergenic
1000261043 5:159588952-159588974 CACAGAGGAGAGGACAGGAGTGG + Intergenic
1001071647 5:168590509-168590531 CACAGAAGGCAGGAAAGAAGGGG + Intergenic
1001081031 5:168667576-168667598 CACTGTAGTGAGGACAGTAGAGG - Intronic
1001261605 5:170233754-170233776 GACTGGAGGCAGGACAGGTCTGG - Exonic
1002089701 5:176797322-176797344 GAGTGAAGGCAGGACCGGACAGG - Intergenic
1002094420 5:176822729-176822751 CCCTGAGGCCAGAACAGGAGAGG + Intronic
1002789807 6:428672-428694 CCCTGCAGGCCTGACAGGAGAGG + Intergenic
1003053090 6:2797355-2797377 CACAGAAGGAAGGAAATGAGAGG + Intergenic
1003879437 6:10466692-10466714 CACAGAAGCCAGGAGAGGCGAGG - Intergenic
1004814208 6:19294880-19294902 CATTGAAGGTAGGACTGGAAGGG + Intergenic
1005394540 6:25367741-25367763 GTCTGAATGCAGCACAGGAGAGG - Intronic
1006097308 6:31664134-31664156 TACTGAGGGCAGCCCAGGAGGGG - Exonic
1006190045 6:32202039-32202061 CACTGGAGCCAGGGAAGGAGAGG - Intronic
1007245350 6:40457901-40457923 CCCTCATGGCAGGACAGGAAAGG - Intronic
1008546545 6:52588674-52588696 CACTGAGGTCAGGGCAGAAGTGG - Intergenic
1008547989 6:52600184-52600206 CACTGAAGGAAGGCCAGGGAAGG + Intergenic
1010534552 6:77011384-77011406 CGCTGAAGGCAGTTCAGCAGGGG + Intergenic
1011406939 6:87025457-87025479 CAGTGAAGGAAGGATGGGAGGGG + Intergenic
1012476345 6:99618628-99618650 CTCTGAGGGAAGGACGGGAGTGG + Intergenic
1012549859 6:100456280-100456302 CACCGAAGGCAGGAGGCGAGGGG - Intronic
1013464922 6:110409540-110409562 CACTGAAGTCATGTCAGTAGCGG + Intronic
1015006064 6:128283166-128283188 CTCTGTAGGCAGGGCAGGAAAGG - Intronic
1015312804 6:131783563-131783585 CTCTGAATGCATGATAGGAGTGG + Intergenic
1015365526 6:132393404-132393426 CACTGAAAGCAAGGAAGGAGAGG + Intronic
1016636204 6:146295088-146295110 AACAGAAGGCAGGAAAGTAGGGG - Intronic
1018310869 6:162506995-162507017 GCCTGATGGCAGAACAGGAGAGG + Intronic
1018568090 6:165178470-165178492 TACTGAGGGCAGGAAAGGATTGG - Intergenic
1019021542 6:168922830-168922852 CACTGAAGGCAGGACAATGAAGG + Intergenic
1019552169 7:1608442-1608464 CAGGGCAGGCTGGACAGGAGTGG + Intergenic
1020143264 7:5623952-5623974 CACTCAACCCAGCACAGGAGAGG - Intronic
1020855914 7:13422304-13422326 CACAGAAGGAAGGAAAGGAGTGG + Intergenic
1021078533 7:16334783-16334805 CACTGATGACAACACAGGAGAGG - Intronic
1021388866 7:20067927-20067949 CAGTGAGGGCAGGACAGTGGGGG + Intergenic
1021922965 7:25505596-25505618 CACTGAAAGAAGCACTGGAGAGG + Intergenic
1022145759 7:27538830-27538852 CACTGAAGGCAGGAACAGAGAGG + Intronic
1022273390 7:28832406-28832428 CAGTGAAGGCAGAAGAGAAGGGG + Intergenic
1022914129 7:34929884-34929906 CCCTGGAGGCAGCCCAGGAGAGG - Exonic
1023017822 7:35984183-35984205 CCCTGAGGTGAGGACAGGAGTGG - Intergenic
1023199250 7:37675980-37676002 CACTGAAGGCATGGGAGGAGTGG - Intergenic
1023270304 7:38455530-38455552 CACTGAAAGCAAGCAAGGAGAGG + Intronic
1023761422 7:43468226-43468248 GATTGAAGGCTGGACATGAGAGG - Intronic
1023938253 7:44754849-44754871 CACTGGCTGCAGCACAGGAGAGG - Intronic
1025796951 7:64746709-64746731 CACTGAATGCAGCGCTGGAGTGG + Intergenic
1026110257 7:67453754-67453776 CTCTCAAGGCAGAAGAGGAGTGG - Intergenic
1026168250 7:67930354-67930376 CACTGAAGGCAGGATAAAAAGGG + Intergenic
1026574772 7:71562895-71562917 CACTGAAGGCTTTAGAGGAGGGG + Intronic
1026843112 7:73682037-73682059 CTCTGTAGGCATGACAGCAGAGG - Exonic
1026974579 7:74489631-74489653 AACTGAAACCAGGCCAGGAGTGG - Intronic
1027779414 7:82503737-82503759 CACTGACAGCAGGGCAGAAGTGG - Intergenic
1031723050 7:125200840-125200862 CTCTGAAGGCAGGCGAGCAGGGG - Intergenic
1032736688 7:134698865-134698887 GGCTGAAGGCTGGACGGGAGAGG - Intergenic
1033405570 7:141069525-141069547 AACTGAAGGCAGTTCAGAAGGGG + Intergenic
1034258545 7:149738461-149738483 CAAGGAAGGAAGGAGAGGAGAGG + Intergenic
1034829224 7:154294775-154294797 CACTGAAGACAGCACGGCAGTGG + Intronic
1035106240 7:156443775-156443797 CCCTGAGCGCAGGCCAGGAGTGG - Intergenic
1035435933 7:158859000-158859022 CTCTGAAGAAAGGAAAGGAGAGG - Intronic
1035713746 8:1738382-1738404 GACTGTAGGCAGCAAAGGAGGGG + Intergenic
1035938526 8:3869422-3869444 TTATGAAGGCAGGACAGGATTGG - Intronic
1036199200 8:6752838-6752860 CACTGAAGGGAGGAAATAAGTGG - Intronic
1036226039 8:6958265-6958287 AGCTGGAGGCAGGACAGCAGGGG + Intergenic
1036643460 8:10598184-10598206 CACTGAAGTGGGGACAGGAAGGG + Intergenic
1036844564 8:12155922-12155944 GTCTGAAGGCAGGGCAGGACAGG + Intergenic
1036865934 8:12398255-12398277 GTCTGAAGGCAGGGCAGGACAGG + Intergenic
1036936074 8:13003881-13003903 CACTAAAGGAAGCACAGAAGAGG + Intronic
1038878686 8:31582215-31582237 CACAGAAGGCAGAAAAAGAGGGG - Intergenic
1039546494 8:38414628-38414650 CCCTGAAAGCAGCACAGGGGAGG + Exonic
1039731055 8:40278701-40278723 CACAGAAGGCAGAAAAAGAGTGG - Intergenic
1039981950 8:42415512-42415534 CCCAGCAGGCAGGACAGCAGAGG - Intergenic
1040384905 8:46908067-46908089 GAATCAAGGCAGGAGAGGAGAGG + Intergenic
1040891674 8:52323781-52323803 CACTGAAGACAGGCCGGAAGTGG - Intronic
1041175719 8:55194036-55194058 GACTGAAAGGTGGACAGGAGGGG - Intronic
1041425697 8:57718083-57718105 GACTGAAGGCAGGAGAGGCTGGG - Intergenic
1041616138 8:59908195-59908217 CCCTGAAGACAGCACAGGACTGG - Intergenic
1043115950 8:76254550-76254572 CACCTAAGGCAGGGAAGGAGAGG + Intergenic
1044059743 8:87621188-87621210 CACTGCAGGAAGCACAGGTGGGG + Intergenic
1044688346 8:94850692-94850714 AACAGAAAGCAGGAGAGGAGTGG + Intronic
1044867041 8:96581728-96581750 GACAGAAGGCAGCACGGGAGTGG + Intronic
1045402252 8:101831020-101831042 CACTCAAGCCAGGTCAGGTGAGG - Intronic
1046328321 8:112679352-112679374 CAAGGAAGGCAGAACTGGAGTGG - Intronic
1046385384 8:113502089-113502111 CACCGAAGGTAGCACTGGAGTGG + Intergenic
1046802501 8:118443957-118443979 CACTGAAGGCAGGAAAAGAGAGG + Intronic
1047531763 8:125683231-125683253 CACTGAAGACAGGCCATGTGAGG - Intergenic
1048049858 8:130806618-130806640 CATTGGAGGCAGCACAGCAGTGG + Intronic
1048627332 8:136199663-136199685 CAGTGAAGGCAGAAAAGAAGGGG + Intergenic
1048757285 8:137754008-137754030 CACTGAAAGCAGCACCGAAGAGG + Intergenic
1048816571 8:138339927-138339949 CACTGCAGGCTGGACCGGATGGG - Intronic
1049618625 8:143587940-143587962 GACTGGCGGCAGGGCAGGAGGGG - Intronic
1049850978 8:144829998-144830020 GACTAACGGCAGGACAGGAGGGG - Intronic
1050465032 9:5912984-5913006 CACTGAGGGCTGGACAGGAAGGG - Intronic
1051083252 9:13317453-13317475 CACGGAAGGAAGGAAAGGAAAGG + Intergenic
1051408034 9:16760110-16760132 GGGGGAAGGCAGGACAGGAGAGG + Intronic
1051601405 9:18878239-18878261 CACAGAAGCCACGACAGGTGGGG - Intronic
1052849206 9:33366094-33366116 AACAGAAGGGAGGAAAGGAGGGG - Intronic
1053333375 9:37237209-37237231 CACTCAAGGCATGAAAGCAGGGG - Intronic
1053618046 9:39789885-39789907 CACAAAAGGCAGGAAAAGAGTGG - Intergenic
1053876223 9:42549250-42549272 CACAAAAGGCAGGAAAAGAGTGG - Intergenic
1053896432 9:42745383-42745405 CACAAAAGGCAGGAAAAGAGTGG + Intergenic
1054235474 9:62552472-62552494 CACAAAAGGCAGGAAAAGAGTGG + Intergenic
1054266112 9:62917544-62917566 CACAAAAGGCAGGAAAAGAGTGG + Intergenic
1056870688 9:90274920-90274942 CACTCAAGTCAGGCCAGCAGGGG + Intergenic
1057131531 9:92657567-92657589 CACTGAATGCAGCAAAGAAGGGG + Intronic
1057354472 9:94322416-94322438 GACAGATGGCAGGACAGGTGTGG - Intronic
1057427329 9:94963140-94963162 TATTGAAGGAAGGACAGGATTGG - Intronic
1057653289 9:96935219-96935241 GACAGATGGCAGGACAGGTGTGG + Intronic
1057958586 9:99433165-99433187 CACTGAAGGCAGAAGAGGCAGGG - Intergenic
1058458755 9:105163042-105163064 CGCAGAAGGCAGGAGAAGAGAGG - Intergenic
1058837981 9:108876638-108876660 CACTGTAGGCAGGACATGATGGG - Intronic
1058978035 9:110142913-110142935 CAGTGAAGGCAGGACAGCTTGGG - Intronic
1058986277 9:110210912-110210934 CAGTGGGGGCAGGACAGGAGTGG + Intergenic
1059305850 9:113352536-113352558 CACTGAAGTCAGGACAAGTTTGG + Intronic
1059490588 9:114663054-114663076 CACAGAGGCCAGGACAGGAGAGG - Intergenic
1059492278 9:114678372-114678394 CACTGAAGGTAGATCAAGAGAGG + Intergenic
1060190446 9:121589038-121589060 CAGGGAAGGGAGGACAGGAAGGG - Intronic
1060462873 9:123875267-123875289 CTCTGAAGGCAGGGAGGGAGGGG + Intronic
1060733208 9:126050707-126050729 CACAGAAGGCAGGGGAGGGGAGG - Intergenic
1060793674 9:126501343-126501365 CACTGAGGGCAGGAGAGGAGAGG + Intronic
1061002684 9:127911186-127911208 CAGGGCAGGCAGGCCAGGAGTGG + Intronic
1061114953 9:128604268-128604290 GACTGGGGGCATGACAGGAGAGG + Intronic
1061149940 9:128822886-128822908 CACTGAAGACAGGCTGGGAGCGG - Intronic
1061735681 9:132655930-132655952 CACTGAACGCAGGCTAGGAATGG + Intronic
1061777105 9:132972980-132973002 CGCTGAAGGGTGGACAGCAGTGG - Intronic
1062074169 9:134575490-134575512 CACTGAAGGCAAGACATGTGAGG + Intergenic
1062167783 9:135116621-135116643 CCCTCCAGGCAGGTCAGGAGAGG + Intronic
1062562692 9:137148803-137148825 GGCTGAAGACAGGACAGGACCGG + Intronic
1062733589 9:138122202-138122224 CCAGGAAGGCAGGACAGGAAGGG - Exonic
1203785569 EBV:125734-125756 CGCTGAAGGGCGGACAGGGGGGG - Intergenic
1186187495 X:7036036-7036058 CACTCATGGCAGAAGAGGAGGGG - Intergenic
1188374477 X:29410929-29410951 GACTGAAGGAAAGAGAGGAGTGG - Intronic
1188852069 X:35144288-35144310 CACTGATGGCAGCACAGGGGAGG - Intergenic
1189579389 X:42389666-42389688 CATTGAAGTCAGGAGCGGAGAGG - Intergenic
1190386871 X:49890614-49890636 AATTGAAGGCAGGAAAGAAGAGG + Intergenic
1190635113 X:52425652-52425674 CACAGAAAGCAGGACAGAGGAGG - Intergenic
1192147606 X:68692405-68692427 AACTGAAAGCTAGACAGGAGAGG + Intronic
1192244435 X:69360958-69360980 CTCAGAAGGCAGGTCTGGAGTGG + Intergenic
1195783172 X:108486227-108486249 CACTGAAGGAGGCACTGGAGAGG - Intronic
1195933655 X:110105093-110105115 GAGTGAAGGAAGGACAGGAAGGG - Intronic
1196574704 X:117304619-117304641 CACCTAAGGCAAGAAAGGAGAGG + Intergenic
1198915654 X:141668607-141668629 TACAGATGGCAGGGCAGGAGAGG - Intronic
1199122201 X:144068911-144068933 GACTGAAGGCAGGAAAGGCATGG - Intergenic
1199595739 X:149504724-149504746 CAATGGAGGGAGGAAAGGAGGGG + Intronic
1199794473 X:151181041-151181063 CACTGAAGGCAGACTTGGAGTGG - Exonic
1200130943 X:153845441-153845463 CCATGAAGGCATGAAAGGAGAGG - Intergenic
1200234646 X:154462391-154462413 CTCTGAGGACAGGACAGGAGAGG + Intronic