ID: 1091823643

View in Genome Browser
Species Human (GRCh38)
Location 12:3493538-3493560
Sequence CAGACCCCGCGCGGCAGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091823643_1091823656 17 Left 1091823643 12:3493538-3493560 CCCCCGCTGCCGCGCGGGGTCTG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1091823656 12:3493578-3493600 GGTTCCGCAGTGTGCAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 65
1091823643_1091823655 14 Left 1091823643 12:3493538-3493560 CCCCCGCTGCCGCGCGGGGTCTG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1091823655 12:3493575-3493597 CCAGGTTCCGCAGTGTGCAGCGG 0: 1
1: 0
2: 0
3: 13
4: 176
1091823643_1091823650 -4 Left 1091823643 12:3493538-3493560 CCCCCGCTGCCGCGCGGGGTCTG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1091823650 12:3493557-3493579 TCTGGGTGCAGACCCCTGCCAGG 0: 1
1: 1
2: 4
3: 25
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091823643 Original CRISPR CAGACCCCGCGCGGCAGCGG GGG (reversed) Intronic
900118952 1:1040544-1040566 CCGCCCCCGCGCCGCATCGGGGG - Intronic
900237611 1:1600158-1600180 CGGACCCGGCGCGGCGGCGGAGG + Intergenic
900611043 1:3544787-3544809 CAGACCCCACGCAGCAACTGGGG + Intronic
901317346 1:8318052-8318074 CGGGCCCCGCGCGGATGCGGAGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902245388 1:15117474-15117496 CAGACCCCAGGCTGCAGAGGAGG + Exonic
903573353 1:24322234-24322256 GAGACTCCAGGCGGCAGCGGTGG - Intronic
903813258 1:26046375-26046397 CGCACCCCGCGCGGGAGAGGGGG - Intergenic
904746142 1:32712382-32712404 GCGGCCCCGCGCGGCTGCGGCGG - Intergenic
905959926 1:42035446-42035468 GAGACCTGGCGCGACAGCGGGGG - Intronic
907294201 1:53439290-53439312 CAGACCCTGGGCGGCGGCTGTGG - Intergenic
909547773 1:76867528-76867550 CAGATCGCGCGCGGGAGCCGCGG - Exonic
910759017 1:90717633-90717655 CTGGCACCGGGCGGCAGCGGTGG + Intergenic
911348148 1:96721723-96721745 GGGCCACCGCGCGGCAGCGGCGG - Intronic
912682545 1:111738626-111738648 CAGAGCTGGCGCGGCTGCGGGGG - Intronic
913937059 1:125065148-125065170 CCGACCCCGGTGGGCAGCGGTGG - Intergenic
917817433 1:178725249-178725271 CCTCCCCCGAGCGGCAGCGGCGG + Exonic
921017646 1:211207196-211207218 CAGCACCCGCGCAGCATCGGGGG - Intergenic
922569365 1:226624721-226624743 CAGGCCCCGGGCTGCAGCTGGGG + Intergenic
1063418136 10:5889952-5889974 GAGTCCCCGCGGAGCAGCGGCGG - Intergenic
1063577525 10:7275139-7275161 CAGACCTGGGGCTGCAGCGGGGG + Intronic
1064208968 10:13347771-13347793 CCGGCCCCGCGCGGCGGCGGCGG + Intronic
1064645443 10:17454597-17454619 GTGACCCCGCGCGGCGGCGGCGG - Intergenic
1065024260 10:21526191-21526213 CAGGCCCGGCGCGGTAGGGGAGG - Intergenic
1075425657 10:122339853-122339875 TAGACCCCGCCCGGCAGGGATGG - Intergenic
1075801881 10:125159477-125159499 CGAGCCCCGCGCGGCAGTGGCGG + Intronic
1076554206 10:131311514-131311536 CAGACCCAGGGCGGCGGCGGCGG + Exonic
1078354903 11:10626153-10626175 GAGAGCCCTCGCAGCAGCGGGGG + Exonic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1083227542 11:61294526-61294548 AAAGCCCCGCGCGGCAGGGGAGG + Intronic
1083457164 11:62786925-62786947 GAGAGCCCCCGGGGCAGCGGCGG + Exonic
1083547966 11:63563096-63563118 CAGACCCCATGCGGCAGCTGAGG + Intronic
1083885752 11:65572730-65572752 CTGAGGCCGCGCGGCAGCGGTGG - Exonic
1083888810 11:65585617-65585639 GGGACCCCGCGCTGCGGCGGGGG - Intronic
1084068469 11:66718912-66718934 CAGGCCCTGCGGGGCGGCGGAGG + Intronic
1088935901 11:114400232-114400254 CAGACCGCGGGCGTCAGCGTTGG - Exonic
1089332860 11:117701933-117701955 CAGACAGCGCGTGGCAGCTGTGG + Intronic
1090884129 11:130861458-130861480 CAGAGGCCGCGCGGCAGTGCTGG - Intergenic
1091823643 12:3493538-3493560 CAGACCCCGCGCGGCAGCGGGGG - Intronic
1095259586 12:40082915-40082937 CAGACCCCGGGCTGAAGTGGGGG - Intronic
1098320717 12:69240154-69240176 CGGAGCCCGAGCGGCAGCGGCGG - Intronic
1100444719 12:94650222-94650244 CGGACCTCCGGCGGCAGCGGAGG + Intronic
1101340923 12:103841291-103841313 CACTCCCCGCCCCGCAGCGGCGG - Intergenic
1102256515 12:111418521-111418543 CAGGGCCCGGGCGGCCGCGGCGG - Exonic
1103362436 12:120361994-120362016 CAGGCCCGGCTCGGCTGCGGCGG - Intronic
1103749863 12:123151144-123151166 CAGGCCGCGCGGGGGAGCGGCGG + Intergenic
1108541501 13:51451741-51451763 CCGGCCCGGCCCGGCAGCGGCGG - Intronic
1117132013 14:52695850-52695872 CAGACCCTGCGCGGGAGTCGGGG + Intronic
1118607677 14:67515345-67515367 CGGACCCCGCGCCGCCGCGGCGG - Intronic
1118809038 14:69260520-69260542 CAGACCCTGCGCGGCGGCCGAGG + Intronic
1121767794 14:96502525-96502547 CATGCCCAGGGCGGCAGCGGCGG + Exonic
1122445011 14:101761773-101761795 CAGTCCCCGGGCGGCGGCGGCGG + Intergenic
1123041293 14:105491321-105491343 CAGGCCCCGGGCCGCGGCGGAGG + Exonic
1123190802 14:106567866-106567888 CTGAACCCGCGAGGCAGAGGTGG - Intergenic
1126592708 15:50355452-50355474 CGGCGCCTGCGCGGCAGCGGGGG + Intergenic
1129220925 15:74131244-74131266 CAGACCCGGCGTGGCAGAGCAGG - Exonic
1132622937 16:876223-876245 GAGCCCACGCGCGGCCGCGGAGG + Intronic
1134482311 16:14630285-14630307 CAGCGCCTGCGCGGCGGCGGGGG + Intronic
1136546537 16:30958024-30958046 GAGACCCGGCCCCGCAGCGGTGG - Intronic
1136778815 16:32885067-32885089 CAGCCACCGAGCAGCAGCGGTGG + Intergenic
1136891803 16:33976451-33976473 CAGCCACCGAGCAGCAGCGGTGG - Intergenic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1139823910 16:69742177-69742199 CAGACCCAGCGGGGCATGGGCGG + Exonic
1141624690 16:85255006-85255028 GAGACCGCCCGCGGCAGAGGTGG - Intergenic
1141831156 16:86510594-86510616 CAGCCACCGCACGGCGGCGGCGG + Exonic
1142216625 16:88833179-88833201 CCAACCCCGAGCGGCAGCGTGGG + Intronic
1203081230 16_KI270728v1_random:1147156-1147178 CAGCCACCGAGCAGCAGCGGTGG + Intergenic
1144109803 17:12020896-12020918 CCGAGCCCGAGCGGCGGCGGCGG + Exonic
1144339745 17:14301679-14301701 CAGCCCCGGCGCGGCGGCGCAGG - Exonic
1144816621 17:18039647-18039669 CGGCTCCCGCGCGGCGGCGGCGG + Exonic
1146183106 17:30709538-30709560 CGGCCCCCTCGCGGCGGCGGAGG - Intergenic
1150003903 17:61457811-61457833 CAAGGCCCGCGCGGCTGCGGTGG - Intronic
1151791446 17:76308167-76308189 CGGACCCCGCCGGGGAGCGGAGG - Intergenic
1152345334 17:79747676-79747698 CAGCCCCCGCGCCGCTGCGGTGG - Intergenic
1152729124 17:81961259-81961281 CCGAGCCCGGGCGGCGGCGGCGG - Exonic
1157384057 18:47247484-47247506 TCGCCCCCGGGCGGCAGCGGCGG - Intronic
1157599640 18:48886044-48886066 CAGGCCCCGGGCAGCCGCGGGGG + Intergenic
1158648857 18:59269284-59269306 GCGCCCCCGCCCGGCAGCGGCGG + Exonic
1160394627 18:78562801-78562823 CAGACGCCGCGCGGCCGGAGAGG - Intergenic
1160685606 19:435137-435159 CCGGCCCCGCCCGGCAGCAGAGG + Intronic
1161622879 19:5308589-5308611 CAGACTCCATGCGGCAGAGGTGG + Intronic
1162597448 19:11640095-11640117 CGGTCCCCGCGCGGCAACTGCGG + Intergenic
1162731780 19:12722477-12722499 CCGGCCCCGGGCAGCAGCGGCGG + Intronic
1162975688 19:14206230-14206252 CGGCCCCCTCGCGGCGGCGGAGG + Intergenic
1163427099 19:17245750-17245772 CAGGCCCGGAGCGGCAGCCGCGG - Exonic
1163575768 19:18110084-18110106 CAGGCCCGGCCCGGCAGCGAGGG - Intronic
1165549612 19:36573196-36573218 CCGACCTCGCCCGGCAGCGCGGG + Exonic
1167358146 19:49016481-49016503 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167359641 19:49023371-49023393 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167361490 19:49032714-49032736 CAGACCCACAGAGGCAGCGGGGG + Intronic
1167362164 19:49036071-49036093 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167363920 19:49044787-49044809 CAGACCCACAGAGGCAGCGGGGG + Intronic
1167364578 19:49048140-49048162 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167365863 19:49054776-49054798 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167464260 19:49641982-49642004 CTGTCCCCGCGCGACAGAGGCGG + Intergenic
1167696626 19:51019080-51019102 CAGAGCCCGGGCGCCAGAGGCGG + Exonic
926217097 2:10912352-10912374 CGGACCCCCAGCGGCAGCGGCGG + Exonic
927713728 2:25340634-25340656 AAGACCCCGCTCCGCAGCCGCGG + Intronic
929855822 2:45637950-45637972 CAGACCCAGAGCCGCAGCGTAGG - Intergenic
930011522 2:46941405-46941427 CGGGGCCCGGGCGGCAGCGGGGG - Exonic
936097787 2:109546265-109546287 CTGACACAGCGCGGCAGCAGAGG + Intronic
942151065 2:173076157-173076179 CAGGGCCCGCCCGGCGGCGGCGG + Intronic
944451808 2:199851146-199851168 CGGGCCACGCGCGGCGGCGGAGG - Intronic
944457615 2:199911535-199911557 ATGAACCCGGGCGGCAGCGGCGG + Exonic
946702135 2:222424557-222424579 CCGGCCCGGCGTGGCAGCGGCGG + Exonic
947765462 2:232634452-232634474 CAGACCCCGCGCTGCAGCCAAGG - Intronic
1170578404 20:17681345-17681367 CGGACGCCGGGCGGCCGCGGTGG - Intronic
1171170173 20:23008912-23008934 GAGACCCCCAGCAGCAGCGGAGG + Intergenic
1172303586 20:33866041-33866063 CAGAGCCCGTGAGGCAGCAGAGG + Intergenic
1172775894 20:37406697-37406719 CTGACCCGCCGCGGCAGCGCGGG - Intergenic
1173790375 20:45824228-45824250 CAGAACCCGGCCGGCAGCGCTGG - Intronic
1174358788 20:50015323-50015345 CAGCCCCCGCCCCACAGCGGGGG + Intergenic
1175439483 20:58980999-58981021 CAGAGCCGGCGCCGCAGGGGAGG + Intergenic
1176207112 20:63895202-63895224 GAGACCCCGGGCGGCGGCGGCGG - Exonic
1176685047 21:9839523-9839545 CTGACACCGCGCGGCGGTGGCGG - Intergenic
1177669600 21:24208714-24208736 CAGGCCCCGCGGAGCAGGGGAGG + Intergenic
1179500137 21:41803508-41803530 CAGAGGCCGCGGGGCAGTGGTGG + Intronic
1179674989 21:42974970-42974992 CAGGCCCAGCGCGGCGGCGGCGG - Intronic
1181478094 22:23180838-23180860 CATGGCCCGCGCGGCGGCGGCGG - Exonic
1182475526 22:30574599-30574621 CGGGCGCGGCGCGGCAGCGGCGG - Intergenic
1184782950 22:46658244-46658266 TGGACCGCGAGCGGCAGCGGCGG + Exonic
1185269624 22:49923051-49923073 GAGGCCCCACGCGGCAGGGGAGG - Intronic
1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG + Intronic
954763888 3:52897241-52897263 GAGGCCCTGCGCGGCAGCCGCGG - Intronic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
968701700 4:2060637-2060659 CAGGCCCCGCGCGGGGGAGGGGG - Intronic
969306035 4:6326837-6326859 CAGCCACCACGCGGCAGCAGCGG + Intronic
969360276 4:6658850-6658872 CAGCCCGCGCGCGGAGGCGGAGG + Intergenic
969371030 4:6731803-6731825 CAGACCCAGTGAGGCAGGGGAGG + Intergenic
969721182 4:8893750-8893772 GAGACCGAGCGCGGCAGAGGTGG + Intergenic
976390015 4:84497702-84497724 TAGAGCCCGGGCGGCGGCGGCGG + Exonic
978013745 4:103719496-103719518 CAGTCCCAGCGCGGAAGGGGAGG + Exonic
986813627 5:11385042-11385064 GAGCCCCCGCGCGGCGGCGCGGG + Exonic
991587577 5:68215902-68215924 CGGGGCCCGCGCTGCAGCGGTGG - Exonic
992105785 5:73448201-73448223 CTGTCCCCGCGCAGCGGCGGCGG - Exonic
992627630 5:78649061-78649083 CTGAGCCCGCCGGGCAGCGGCGG + Intronic
993116158 5:83722247-83722269 CACAGCCCGAGCGGCGGCGGCGG - Intergenic
1002175305 5:177398188-177398210 AAGACCCTGGGGGGCAGCGGGGG - Exonic
1002591100 5:180292062-180292084 CAGACCGGGCGCCGCGGCGGCGG - Exonic
1003325241 6:5085716-5085738 AGGAGCGCGCGCGGCAGCGGCGG - Exonic
1003872267 6:10412597-10412619 CAGACCTCGGGATGCAGCGGGGG + Intronic
1003948102 6:11093768-11093790 CCGACCCCGCGCCGCGGAGGAGG + Intergenic
1004044693 6:12012453-12012475 CGACCCCCGCGCGGCGGCGGCGG - Exonic
1005825200 6:29628079-29628101 CGGGCGGCGCGCGGCAGCGGGGG + Intronic
1007363218 6:41373203-41373225 CAGCCCCCGCGCCGGAGCTGCGG + Intergenic
1013369231 6:109455515-109455537 TGGACCGCGGGCGGCAGCGGTGG + Intronic
1014932960 6:127355678-127355700 CAGTCTCTGGGCGGCAGCGGTGG - Intergenic
1018686283 6:166307297-166307319 CCGGCCCCGCGCGGCAGCCGCGG + Exonic
1018876603 6:167827097-167827119 CCGGCCCCGCGCGGCTGAGGAGG + Exonic
1019308220 7:346524-346546 GTGACCCCGGGTGGCAGCGGTGG - Intergenic
1021231097 7:18086894-18086916 CCCCCCCCGCGCGGCGGCGGCGG + Intergenic
1022734528 7:33063250-33063272 CAGAAACCCCGCGGCTGCGGCGG - Intergenic
1022989674 7:35695108-35695130 CAAAACCGGCGCGCCAGCGGTGG - Exonic
1027266455 7:76497616-76497638 CTGCCCCCGCTCGGCAGCAGAGG + Intronic
1027317836 7:76995734-76995756 CTGCCCCCGCTCGGCAGCAGAGG + Intergenic
1029367792 7:100127573-100127595 GAGTCCCCGCGCGGGAGTGGCGG + Exonic
1033253192 7:139777823-139777845 CCGGGCCCGGGCGGCAGCGGCGG - Intronic
1034399451 7:150852458-150852480 CAGACCCCGCCCTGCAGGGAGGG - Intronic
1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG + Exonic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1046545766 8:115648309-115648331 CAGGCACCGCGCAGCAGCCGAGG + Intronic
1047202857 8:122781341-122781363 ACGACCCCGCGCGGCGGCCGCGG - Intergenic
1052494664 9:29212245-29212267 CGGAGCCCGCGCGGCAGGGGCGG - Intergenic
1053050523 9:34957947-34957969 CAGTCCCCGCGCCGCAGTGCCGG + Intronic
1053367998 9:37537462-37537484 CAGACCCCGGACAGCAGCGATGG - Exonic
1056170456 9:83980170-83980192 CTGAGGCGGCGCGGCAGCGGAGG - Exonic
1057283145 9:93727029-93727051 CAGACCCAGCACAGCAGAGGTGG - Intergenic
1059633943 9:116154356-116154378 CAGGCACCGCCCGGCGGCGGCGG - Exonic
1062370994 9:136238613-136238635 CAGGCCGCGCGTGGCAGCTGGGG - Intronic
1062628762 9:137454366-137454388 AAGACCCCGTGCGGCGGGGGTGG - Intronic
1190505429 X:51120445-51120467 CAGCCTCCGCTCGGCATCGGAGG + Intergenic
1195138210 X:101931897-101931919 CACCGCCTGCGCGGCAGCGGCGG - Intronic
1196965114 X:121047431-121047453 CAGGCCCGGCGAGGCCGCGGCGG + Intergenic
1200100985 X:153688974-153688996 CGGCCACCGAGCGGCAGCGGCGG - Intronic
1200228681 X:154433167-154433189 CAGACCCCACTTGGCAGAGGGGG + Intronic