ID: 1091823643

View in Genome Browser
Species Human (GRCh38)
Location 12:3493538-3493560
Sequence CAGACCCCGCGCGGCAGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091823643_1091823655 14 Left 1091823643 12:3493538-3493560 CCCCCGCTGCCGCGCGGGGTCTG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1091823655 12:3493575-3493597 CCAGGTTCCGCAGTGTGCAGCGG 0: 1
1: 0
2: 0
3: 13
4: 176
1091823643_1091823656 17 Left 1091823643 12:3493538-3493560 CCCCCGCTGCCGCGCGGGGTCTG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1091823656 12:3493578-3493600 GGTTCCGCAGTGTGCAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 65
1091823643_1091823650 -4 Left 1091823643 12:3493538-3493560 CCCCCGCTGCCGCGCGGGGTCTG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1091823650 12:3493557-3493579 TCTGGGTGCAGACCCCTGCCAGG 0: 1
1: 1
2: 4
3: 25
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091823643 Original CRISPR CAGACCCCGCGCGGCAGCGG GGG (reversed) Intronic