ID: 1091826769

View in Genome Browser
Species Human (GRCh38)
Location 12:3518656-3518678
Sequence GCATTTGGGCCCGATTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 1, 2: 3, 3: 6, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091826769_1091826776 8 Left 1091826769 12:3518656-3518678 CCCCAGAAATCGGGCCCAAATGC 0: 1
1: 1
2: 3
3: 6
4: 66
Right 1091826776 12:3518687-3518709 AGAAAGCTAATAATAATTAAAGG 0: 1
1: 0
2: 1
3: 50
4: 663
1091826769_1091826777 9 Left 1091826769 12:3518656-3518678 CCCCAGAAATCGGGCCCAAATGC 0: 1
1: 1
2: 3
3: 6
4: 66
Right 1091826777 12:3518688-3518710 GAAAGCTAATAATAATTAAAGGG 0: 1
1: 0
2: 1
3: 57
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091826769 Original CRISPR GCATTTGGGCCCGATTTCTG GGG (reversed) Intronic
900289503 1:1917916-1917938 GTATTGGGGCCCGACTCCTGGGG + Exonic
902663174 1:17919743-17919765 ACATTTGGGGCCCAGTTCTGGGG - Intergenic
905494771 1:38376221-38376243 GCAGTTCTGCCCGAGTTCTGGGG - Intergenic
906091913 1:43186694-43186716 GCATTTTGGGCAGATTCCTGTGG + Exonic
907800656 1:57761970-57761992 GCATTTGAGCCAGTGTTCTGTGG - Intronic
910108126 1:83653447-83653469 GCAGTTGGTTCCAATTTCTGTGG + Intergenic
920793519 1:209115512-209115534 GCATGGGGGACAGATTTCTGAGG + Intergenic
923017096 1:230135314-230135336 TCATTTTGGGCCGATTCCTGTGG + Intronic
1073514862 10:104067181-104067203 GCATTTGGGCCCGATCTTTGGGG - Intronic
1084448212 11:69216643-69216665 GCAGTTGGGCTGGATGTCTGGGG + Intergenic
1087039194 11:93782259-93782281 GCTTTTGGGCCAGATATCTTTGG - Intronic
1088376687 11:109148945-109148967 GCAACTGGTCCCTATTTCTGAGG + Intergenic
1088895077 11:114072371-114072393 GCATTTGGACCCGATGGCAGTGG - Intronic
1089045431 11:115498180-115498202 GTATTTGGGCCTTATTTTTGTGG - Intronic
1089466232 11:118688200-118688222 GCAGTGGGGCCAGGTTTCTGGGG + Intergenic
1090967923 11:131614604-131614626 CCATTTGGCCCAGTTTTCTGGGG + Intronic
1091388481 12:110507-110529 GCACTGGGGCCTGATCTCTGAGG + Intronic
1091826769 12:3518656-3518678 GCATTTGGGCCCGATTTCTGGGG - Intronic
1111379103 13:87422939-87422961 GAATTTGAGGCCGATCTCTGAGG + Intergenic
1113013992 13:105806675-105806697 GCATTTGGGCAATATTTTTGAGG + Intergenic
1113520195 13:110935140-110935162 GCATTTGGGCCTGATGCCTGGGG - Intergenic
1116529330 14:45948377-45948399 GCATTTGGGAAAGATTTCTGAGG + Intergenic
1119904912 14:78292916-78292938 GCATTTTGACCCCGTTTCTGAGG + Intronic
1143197739 17:5089063-5089085 GCATTTGGACCCCTTGTCTGTGG + Intronic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1151654846 17:75491062-75491084 GCATTTGGGGCCACTTCCTGAGG + Exonic
1153918354 18:9766034-9766056 GAATTTGTGCCATATTTCTGTGG + Intronic
1157523949 18:48364399-48364421 GCATTTGGGCCTGACCTTTGAGG + Intronic
1158435133 18:57430218-57430240 GCAGTTGGCCCCGAATTCGGAGG + Intergenic
1162927400 19:13937300-13937322 GCATTTGGGGTCGATTGCGGGGG - Intronic
1162927408 19:13937330-13937352 GCATTTGGGGTCGATTGCGGGGG - Intronic
1167530253 19:50011504-50011526 GCATTTTGGAAAGATTTCTGTGG - Intronic
927985926 2:27410279-27410301 GCATTTGGGGAGGATTTCTGAGG + Intergenic
928684333 2:33732688-33732710 CCATCTGGGCCACATTTCTGTGG - Intergenic
929128757 2:38545343-38545365 CCACTTGGGCCCAATTTCTGTGG + Intergenic
929636238 2:43524464-43524486 GCAGTTGGCCTCCATTTCTGTGG + Intronic
935561999 2:104568952-104568974 GCTTTTGGGTCAGGTTTCTGGGG - Intergenic
935581788 2:104761953-104761975 GCATTTGGCCACCATTTGTGGGG - Intergenic
1174341177 20:49896716-49896738 GGATTTGGGTCTGATCTCTGTGG - Intergenic
1184661467 22:45967433-45967455 GCATGTGGGTCCTAGTTCTGGGG + Intronic
956334874 3:68152498-68152520 GCATTAGGGTCAGATTTCTGTGG - Intronic
960476014 3:118129739-118129761 TCATTTGGGGCTGATTGCTGCGG - Intergenic
966769093 3:183488294-183488316 GCATTTGGGCCAACTTACTGTGG - Exonic
968410751 4:387458-387480 GCCATTGGGCACAATTTCTGAGG - Intergenic
980021155 4:127711771-127711793 GCATTGGAGACCAATTTCTGGGG - Intronic
980522764 4:133953672-133953694 GCATTTGGGCCCAATTCCTGGGG + Intergenic
986236961 5:5919962-5919984 GCATTTGTGCCCCAGATCTGAGG + Intergenic
999792031 5:154949557-154949579 GCATTTGAGAACGATTTCAGGGG + Intronic
1003123446 6:3336707-3336729 GAAGTTGTGCCTGATTTCTGTGG - Intronic
1003981446 6:11393978-11394000 GCTTTTGTCCCCGATTACTGAGG - Intergenic
1005869567 6:29964574-29964596 GCATTTGGACCCGATCCCTGGGG - Intergenic
1007647305 6:43392805-43392827 GCATTTGGGCCCAATCTCTGGGG - Intergenic
1011650636 6:89503249-89503271 GCAGTGGGACCCCATTTCTGAGG - Intronic
1012614710 6:101262346-101262368 GCTTTGGGCCCCGATCTCTGAGG - Intergenic
1012657531 6:101843643-101843665 GCAGTTGGGCCAGATTCATGGGG - Intronic
1015745250 6:136503169-136503191 CCATTTGGGGAAGATTTCTGAGG - Intronic
1018330520 6:162722816-162722838 CAATTTTGGCCCTATTTCTGAGG - Intronic
1019812689 7:3175970-3175992 GCATTTGGGCGAGCTTTCTCAGG - Intergenic
1022076236 7:26973859-26973881 GTCTGTGGGCCCCATTTCTGTGG - Intronic
1028409130 7:90509005-90509027 GCACTTGGGCCTTATTTGTGGGG + Intronic
1031214411 7:118871450-118871472 GCATTTAGATCCGATCTCTGGGG - Intergenic
1035892260 8:3358030-3358052 GCCTTTGGGGCAGATTTTTGGGG - Intronic
1038228635 8:25680245-25680267 GCACTTGATCCCAATTTCTGTGG - Intergenic
1043295657 8:78659587-78659609 GCATTTGGGCAGGATGCCTGAGG - Intergenic
1043559738 8:81478395-81478417 GCACTTGGGCCAGCTTGCTGTGG + Intergenic
1050181592 9:2928619-2928641 GCAGATGGGCACCATTTCTGGGG + Intergenic
1052684887 9:31743092-31743114 GCTTTTGGGACCTATTTTTGAGG + Intergenic
1052729986 9:32273990-32274012 GCTTTTGGGAACAATTTCTGTGG - Intergenic
1053841803 9:42193348-42193370 GCCTCTGGGCCAGATCTCTGAGG - Intergenic
1054098874 9:60924113-60924135 GCCTCTGGGCCAGATCTCTGAGG - Intergenic
1054120272 9:61199734-61199756 GCCTCTGGGCCAGATCTCTGAGG - Intergenic
1054587481 9:66982820-66982842 GCCTCTGGGCCAGATCTCTGAGG + Intergenic
1058953025 9:109921252-109921274 GCATTTGTGCCCTCTGTCTGAGG + Intronic
1062528698 9:136990052-136990074 GGATTAGGGCCTGATATCTGGGG + Intergenic
1190470681 X:50776047-50776069 GCCTTTGAGCCAGATGTCTGTGG + Intronic
1193047712 X:77069862-77069884 GCATTTGGGCCCGATCTCTGGGG - Intergenic
1198733342 X:139758484-139758506 GCATTAGGGCCCGAGGTCTCTGG + Intronic