ID: 1091829078

View in Genome Browser
Species Human (GRCh38)
Location 12:3536447-3536469
Sequence CCCCATGGAAAAGAGAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091829078 Original CRISPR CCCCATGGAAAAGAGAACCT TGG Intronic
900039080 1:441760-441782 CTCCCTGGAACAGAGCACCTAGG + Intergenic
902348324 1:15835364-15835386 CCCGATAGAAGAGAAAACCTAGG + Intergenic
902965062 1:19995169-19995191 CTCCCTGGAACAGAGCACCTAGG - Intergenic
905661458 1:39729254-39729276 CCCATTGGAAAGGAAAACCTGGG - Intronic
906739914 1:48172833-48172855 CTCCCTGGAACAGAGCACCTGGG - Intergenic
906843046 1:49160663-49160685 CTCCCTGGGAAAGAGCACCTGGG - Intronic
907015223 1:51005750-51005772 CTCCCTGGAACAGAGCACCTGGG + Intergenic
911217953 1:95216318-95216340 CCCCCTGGGACAGAGCACCTGGG - Intronic
911541316 1:99161829-99161851 CTCCCTGGAACAGAGCACCTGGG - Intergenic
911950205 1:104164056-104164078 GCACATAGAAAAGAGAACCCAGG - Intergenic
912310071 1:108611364-108611386 CCACATGGAAATGAGAAACAGGG + Intronic
912501224 1:110123405-110123427 CCTCAAGGAAATGAGAATCTGGG - Intergenic
917167501 1:172128922-172128944 CTCCCTGGAACAGAGAAACTAGG - Intronic
918226063 1:182484453-182484475 CCCCTGGGAAAACAGAACCTTGG - Intronic
919206501 1:194425972-194425994 CTCCAAGGCAAAGAGAAACTGGG - Intergenic
919461621 1:197884138-197884160 CTCCATGGGACAGAGCACCTGGG - Intergenic
919774775 1:201187375-201187397 CCTCATGGGAAAGAAGACCTTGG - Intergenic
920428708 1:205899955-205899977 CCCCCTGGGACAGAGCACCTGGG + Intergenic
921395368 1:214663418-214663440 CCCCATCTAACAGAGAACTTAGG - Intronic
921508351 1:216002395-216002417 CTCCCTGAAAAAGAGAAGCTGGG + Intronic
921851634 1:219938309-219938331 CCTCATGGAAATGTGAAGCTTGG - Intronic
923081360 1:230658665-230658687 CCCCGTGGGACAGAGCACCTGGG - Intronic
924172064 1:241352733-241352755 CTCCATGGAAAACAGATCCCTGG + Intronic
1063833435 10:9983907-9983929 CCACATGGAAAATTGAATCTTGG - Intergenic
1068500543 10:57836653-57836675 CTCAAAGGAAAAGAGAAACTGGG - Intergenic
1068567637 10:58593268-58593290 CTCCCTGGAACAGAGCACCTAGG + Intronic
1070249929 10:74764902-74764924 CGCCATGGAAAAGGGAGTCTTGG + Intergenic
1071190098 10:83089708-83089730 CTCCCTGGAACAGAGCACCTGGG + Intergenic
1071328621 10:84540408-84540430 CCCCAGGGGAAAGGGAAACTTGG + Intergenic
1072578212 10:96719353-96719375 CCCCTTGAAAAAGAAAATCTAGG - Intronic
1073845046 10:107545008-107545030 CCCCTTGGAAAGAACAACCTGGG + Intergenic
1074795465 10:116938778-116938800 CTCCCTGGGACAGAGAACCTAGG - Intronic
1074971168 10:118540229-118540251 CCGTATGAAAAAGAGAACATTGG - Intergenic
1075532838 10:123244527-123244549 CCCTATGGAGAAGTGCACCTGGG - Intergenic
1076177608 10:128380137-128380159 CTCCAAGCAAAGGAGAACCTGGG + Intergenic
1076965292 11:77669-77691 CTCCCTGGAACAGAGCACCTAGG + Intergenic
1077149995 11:1068427-1068449 TGCCATGGAAAAGAAACCCTGGG + Intergenic
1077592464 11:3503213-3503235 CCCCATGGAATATAGAACAGAGG - Intergenic
1079620949 11:22553220-22553242 CCCCAAAGACAAGAGAATCTTGG + Intergenic
1079711240 11:23684720-23684742 CCCCATGAAAAAGAGATGTTTGG + Intergenic
1080977190 11:37357094-37357116 TCCCCTGGAACAGAGCACCTGGG + Intergenic
1081976712 11:47240016-47240038 GCCCATGGACAGGAGATCCTGGG - Exonic
1082127796 11:48453430-48453452 CTCCCTGGGAGAGAGAACCTGGG - Intergenic
1082249629 11:49963990-49964012 CTCCATGGGACAGAGCACCTGGG + Intergenic
1082993979 11:59234102-59234124 CTCCCTGGGACAGAGAACCTGGG + Intergenic
1084824524 11:71719545-71719567 CCCCATGGAATATAGAACAGAGG + Intergenic
1085081756 11:73640506-73640528 TCCCTTGGAGAAGAGAACATGGG + Intergenic
1086085989 11:82955995-82956017 CTCCCTGGGAAAGAGCACCTGGG - Intronic
1086331393 11:85757901-85757923 CCTCATGGGAAAGAGCACTTAGG - Exonic
1086402222 11:86470116-86470138 ACCTATGGAAAAGAGAAACTAGG - Intronic
1086492858 11:87372882-87372904 CCCAAGGGAATAGGGAACCTTGG + Intergenic
1087326329 11:96727737-96727759 CCCCCTGGGACAGAGCACCTGGG - Intergenic
1087667829 11:101070849-101070871 CTCCCTGGGACAGAGAACCTGGG + Intronic
1087695254 11:101369419-101369441 TTCCATGGGAAAGAGCACCTGGG - Intergenic
1087925190 11:103911111-103911133 CTCCCTGGGACAGAGAACCTGGG + Intronic
1088820580 11:113453151-113453173 CCCCATGGAGTAGAGAAAGTAGG - Intronic
1088987941 11:114926530-114926552 CCCCAGGGGAAAGACAAACTTGG + Intergenic
1091048211 11:132344378-132344400 CAGCATGGAAAAGAGTGCCTGGG - Intergenic
1091829078 12:3536447-3536469 CCCCATGGAAAAGAGAACCTTGG + Intronic
1091829337 12:3538526-3538548 GCACATGGAAAAGAGAGCCTTGG + Intronic
1093931232 12:24956710-24956732 CACCATAGAAAAAAGAACCAGGG - Intergenic
1099744937 12:86689927-86689949 CCCCCTGGGACAGAGCACCTGGG - Intronic
1099897586 12:88667983-88668005 CTCCCTGGAACAGAGAACCTGGG + Intergenic
1101102294 12:101406733-101406755 CACCATGGGCTAGAGAACCTTGG + Intronic
1101193332 12:102357257-102357279 CCCCACACAAAAGTGAACCTTGG - Intergenic
1103837926 12:123838749-123838771 CCTCATGGCAAAGGGAACCAGGG - Intronic
1104747160 12:131218041-131218063 CCCAAGGAAAAAGTGAACCTCGG - Intergenic
1106401356 13:29434316-29434338 CCCCAGGCAAAATAGCACCTGGG - Intronic
1106608105 13:31250739-31250761 CTCCCTGGGACAGAGAACCTGGG + Intronic
1107951489 13:45465651-45465673 CCCCATGGACAAAGCAACCTAGG - Intronic
1108379988 13:49846283-49846305 ACCCCTGGAAAAGAGACCCCAGG - Intergenic
1109615457 13:64828545-64828567 CTCCATGGGATAGAGCACCTAGG + Intergenic
1110169464 13:72483626-72483648 CCACATCGAAGAGAGAATCTTGG + Intergenic
1112760615 13:102690110-102690132 CCCCATGGAAAAGAGATGAATGG + Intronic
1113482439 13:110631459-110631481 ACCCATGGGAAAGCAAACCTTGG - Intronic
1114139345 14:19893710-19893732 CCCCATGGAAAAGAAAGCTCAGG - Intergenic
1115912113 14:38268567-38268589 CTACCTGGAAAAGAGCACCTGGG - Intergenic
1115927054 14:38447767-38447789 GCCCATATAAAAAAGAACCTAGG - Intergenic
1116538410 14:46065350-46065372 CCCCATCGAAAAGTGGACCAAGG - Intergenic
1117061931 14:51972358-51972380 CACCATGAACCAGAGAACCTTGG - Intronic
1117624272 14:57619068-57619090 CTCCCTGGGACAGAGAACCTAGG + Intronic
1118248496 14:64135322-64135344 CTCCATGGAAAAGAGAACCCTGG - Intronic
1119565978 14:75629875-75629897 CCCCAAGGGAAGGTGAACCTTGG - Intronic
1120449998 14:84655183-84655205 CTCCATGGGACAGAGCACCTGGG - Intergenic
1120554075 14:85907533-85907555 CTCCCTGGAACAGAGCACCTGGG - Intergenic
1121267480 14:92613796-92613818 TCACATGGAAACTAGAACCTCGG + Intronic
1123939717 15:25210989-25211011 CCCCATGGCACAGAGAGTCTGGG - Intergenic
1124618182 15:31257582-31257604 ACCCATGGAAAATAGGACATTGG + Intergenic
1125329964 15:38573180-38573202 CTCCCTGGAACAGAGCACCTGGG - Intergenic
1125385622 15:39133469-39133491 ACCTCTGGAAAAGATAACCTAGG - Intergenic
1125805249 15:42488538-42488560 CCCAATGAATAAGAGCACCTGGG - Intronic
1126952157 15:53893467-53893489 CTCCCTGGAACAGAGCACCTGGG - Intergenic
1127604319 15:60570862-60570884 CCCCAGAGAAAACAGAAACTCGG - Intronic
1129499108 15:76018941-76018963 CTCCCTGGAACAGAGGACCTGGG - Intronic
1132781701 16:1630066-1630088 CCTCAGGGAAATGAGAACCTGGG - Intronic
1133434272 16:5765870-5765892 TCCCGTGGAAAAGACAACCTTGG + Intergenic
1134849988 16:17471229-17471251 CCACAGGGAAAACAGGACCTCGG - Intergenic
1139301364 16:65948037-65948059 CTCCATGGAAAAGAGCCCTTGGG + Intergenic
1139315211 16:66061833-66061855 CCCCAGGGAAAAGAGAACTCAGG + Intergenic
1140028012 16:71309230-71309252 CCTCATGGAGAAGAGAAACTGGG - Intergenic
1141339903 16:83193496-83193518 CCCCATCCTATAGAGAACCTAGG - Intronic
1142955850 17:3521249-3521271 TCACAGGGAGAAGAGAACCTGGG - Intronic
1143353570 17:6307618-6307640 CCCCATGGACAAATGAACCAAGG - Intergenic
1144434087 17:15223728-15223750 CTCCCTGGAACAGAGCACCTGGG - Intergenic
1145804337 17:27715750-27715772 CCCAAAGGCAAAGAGAAACTGGG - Intergenic
1147313398 17:39607571-39607593 CCCTAAGGGAGAGAGAACCTGGG + Intronic
1151196696 17:72436836-72436858 CCCCTGTGCAAAGAGAACCTTGG - Intergenic
1151256817 17:72883852-72883874 GCCCATAGAAAGGAGAATCTGGG + Intronic
1151285217 17:73105954-73105976 CCCAATGGAAATGAGAAGCTAGG + Intergenic
1152162171 17:78675553-78675575 CTCCCTGGAGAAGAGCACCTGGG - Exonic
1154382196 18:13862853-13862875 CTCCCTGGGAAAGAGCACCTGGG - Intergenic
1154993437 18:21617548-21617570 TCACATTTAAAAGAGAACCTAGG - Intronic
1156188337 18:34689758-34689780 CTCCCTGGAACAGAGCACCTGGG - Intronic
1157492262 18:48132044-48132066 CCCCAAAGAAATGAAAACCTAGG + Intronic
1158244124 18:55411679-55411701 TACCATGGAGAAGAGAACCCAGG - Intronic
1159661192 18:71097738-71097760 CTCCCTGGGACAGAGAACCTGGG - Intergenic
1160642096 19:147299-147321 CTCCCTGGAACAGAGCACCTAGG + Intergenic
1162376817 19:10309819-10309841 CCAGAGGGAAAAGAGAACCGGGG + Exonic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163125167 19:15240554-15240576 CCCCACGGAAGAGAGAAGCCTGG + Intronic
1163989916 19:20988696-20988718 CTCCCTGGGAAAGAGCACCTGGG + Intergenic
1165098198 19:33421875-33421897 TCCCAGGGGAGAGAGAACCTTGG - Intronic
1165379563 19:35468735-35468757 CCCCAGGGAAAAGTGAAAGTAGG + Intergenic
1167959785 19:53096555-53096577 CTCCATGGAAAAAAGGTCCTGGG + Intronic
1167963585 19:53126396-53126418 CTCCATGGAAAAAAGGTCCTGGG + Intronic
925484472 2:4312970-4312992 CTCCCTGGGACAGAGAACCTGGG - Intergenic
927408805 2:22801721-22801743 AACCATGGAAAACAAAACCTTGG + Intergenic
928750691 2:34467037-34467059 CTCCCTGGGAAAGAGCACCTGGG + Intergenic
929027389 2:37617602-37617624 CACCATGGAAAAGAAAAACAAGG + Intergenic
929117357 2:38455776-38455798 CCCCTTGGCTAACAGAACCTGGG + Intergenic
930616484 2:53599705-53599727 CCCCATGGGGCAGAGCACCTGGG + Intronic
931527820 2:63176955-63176977 CCCCATGCAAAAGAGCAAGTTGG - Intronic
932051851 2:68405722-68405744 CTCCATGGGAAAGAGCACCTGGG + Intergenic
932427463 2:71648364-71648386 CCACATGGAAAACACAACCAAGG + Intronic
933661578 2:84931795-84931817 TCCCATGGAAAACACAACATAGG + Intergenic
933770359 2:85740137-85740159 CTCCAAGGAAGAGACAACCTGGG + Intergenic
934608790 2:95719555-95719577 GCCCATGGAAAACAGATCTTTGG + Intergenic
935489380 2:103698190-103698212 CTCCCTGGAACAGAGCACCTTGG - Intergenic
936845167 2:116821938-116821960 CCCCATGGAAAACTGGATCTTGG + Intergenic
937983998 2:127630468-127630490 CCCCATGGAGAAGGGGAGCTGGG + Intronic
938286727 2:130125037-130125059 CCCCTTGGAACTTAGAACCTGGG + Intronic
938428870 2:131213825-131213847 CCCCTTGGAACTTAGAACCTGGG - Intronic
938469779 2:131547907-131547929 CCCCTTGGAACTTAGAACCTGGG - Intergenic
939599866 2:144175282-144175304 CCTCAAGCAATAGAGAACCTAGG + Intronic
939675968 2:145072232-145072254 CCCCATGGAAAAGAACTCTTCGG - Intergenic
940114455 2:150192703-150192725 CTCCCTGGAACAGAGCACCTGGG + Intergenic
941565312 2:167099118-167099140 CTCCCTGGAACAGAGCACCTGGG - Intronic
942411083 2:175709636-175709658 CTCCTTGGGACAGAGAACCTGGG + Intergenic
944389832 2:199206579-199206601 CCCAATGGCAAAGAGAACCAGGG + Intergenic
946645731 2:221831806-221831828 CCGCATGGGAGATAGAACCTGGG + Intergenic
948068666 2:235102217-235102239 CTCCGTGGGAAAGAGAACTTGGG + Intergenic
1170258255 20:14371786-14371808 AATCATGGAAGAGAGAACCTAGG - Intronic
1170465959 20:16622688-16622710 CCTGATGTTAAAGAGAACCTAGG + Intergenic
1171319975 20:24233935-24233957 CCCCTGGGAAAAGAGAACTAAGG - Intergenic
1172759104 20:37309469-37309491 CCCCATGGAAAAGAGGTGCTGGG + Intronic
1173556309 20:43968482-43968504 CCTCAGGGAAAAGAGCTCCTCGG - Intronic
1176169715 20:63691304-63691326 CCCCAAGGAAGAAGGAACCTGGG - Intronic
1178915971 21:36705734-36705756 CTCCATGGAAAATCGGACCTGGG - Intronic
1181115406 22:20629943-20629965 CCTCATGGAAGCGAAAACCTGGG - Intergenic
1181363210 22:22354587-22354609 CCCCATGGAATAGGAACCCTTGG - Intergenic
1181949882 22:26546256-26546278 CCAGATGGAAAAGGGAACCAAGG + Intronic
1182200984 22:28569600-28569622 ACCCATAGAAAAAAAAACCTAGG + Intronic
949955091 3:9260676-9260698 CTCCCTGGGACAGAGAACCTGGG + Intronic
952168871 3:30782764-30782786 TCACATGGAAAAGAGAAATTGGG + Intronic
953146637 3:40282387-40282409 CCCCATAGAAATGAAAACCTTGG - Intergenic
954911390 3:54113765-54113787 TGCCAAGAAAAAGAGAACCTGGG - Intergenic
954950572 3:54468953-54468975 CTCCCTGGTAAAGAGCACCTGGG + Intronic
955688110 3:61564381-61564403 CACCAGGGAAAAGAAAACCACGG - Intronic
955879361 3:63527308-63527330 CCTCATGGAGAGGAGATCCTAGG + Intronic
957062533 3:75493781-75493803 CCCCATGGAATATAGAACAGAGG - Intergenic
957137806 3:76311388-76311410 CCCCCTGGAAAGGAAAACCTTGG + Intronic
957446515 3:80318894-80318916 CCCCAGGGAAACCATAACCTAGG + Intergenic
957725504 3:84060344-84060366 CCAAATGCAAAAGAGATCCTTGG - Intergenic
957785404 3:84876036-84876058 CCCCAGGGAAAAGTAAATCTGGG - Intergenic
959848122 3:111057186-111057208 CTCCCTGGGAAAGAGCACCTGGG + Intergenic
959881160 3:111446719-111446741 CTCCATGGGACAGAGGACCTGGG - Intronic
960164542 3:114386676-114386698 GCCCAAGGACAAGAGAGCCTGGG + Intronic
960260283 3:115560151-115560173 CCTCTTGGGAAAGAGAATCTGGG - Intergenic
961830051 3:129618767-129618789 CGCCATGGAGATGGGAACCTGGG - Intergenic
961896260 3:130170559-130170581 CCCCATGGAATATAGAACAGAGG - Intergenic
963113619 3:141707316-141707338 CCCCATGGTACAGAGAGCCATGG - Intergenic
964517897 3:157532572-157532594 CCAGGTGGAAAGGAGAACCTGGG - Intronic
964989528 3:162790579-162790601 CCCCATTTAAAAAAGAACTTTGG + Intergenic
965497305 3:169413914-169413936 CTTCCTGGAACAGAGAACCTGGG + Intronic
965920275 3:173905131-173905153 CCACATGGGAAAGAGAACTCAGG - Intronic
966121585 3:176527832-176527854 CCCAAGGGAAAAGGGAACCTTGG - Intergenic
966652327 3:182315266-182315288 CTCCCTGGGACAGAGAACCTGGG - Intergenic
969806525 4:9613388-9613410 CCCCATGGAATATAGAACAGAGG + Intergenic
970119205 4:12733727-12733749 CCCCAGGGAAAAATGAACATGGG - Intergenic
970896623 4:21111207-21111229 CGCCAAGGAAGAGAGAACATAGG + Intronic
971368630 4:25997214-25997236 CCCCATGGTAAATGGCACCTGGG + Intergenic
972817312 4:42657716-42657738 CCCCATGGACAAGAGCACCATGG - Intergenic
973856944 4:55021066-55021088 CACCCTGGAAAACAGAACCTGGG - Intergenic
974106208 4:57472487-57472509 CTCCCTGGAACAGAGCACCTGGG - Intergenic
974161792 4:58150068-58150090 CTCCCTGGAACAGAGCACCTTGG + Intergenic
974196749 4:58585183-58585205 CCCCCTGGGACAGAGCACCTGGG - Intergenic
974838638 4:67278338-67278360 CCTCAAGGCAAAGAGAAACTGGG + Intergenic
975296609 4:72742391-72742413 CCAAGTGGAAAAGAGAAACTTGG + Intergenic
976065595 4:81184021-81184043 CTCCCTGGAACAGAGCACCTGGG + Intronic
976092755 4:81474201-81474223 CTCCCTGGAACAGAGCACCTGGG + Intronic
976114898 4:81715766-81715788 CTCCCTGGAACAGAGCACCTGGG + Intronic
977994501 4:103485288-103485310 CTCCCTGGAACAGAGAACCCGGG + Intergenic
978175114 4:105720721-105720743 GATCATGGAGAAGAGAACCTAGG - Intronic
979001908 4:115232016-115232038 CTGCTTGGAAAAGAAAACCTAGG - Intergenic
979866176 4:125757241-125757263 ACCCATGGAAAACAGATCCATGG + Intergenic
980290686 4:130845261-130845283 CCCAAAGGCAAAGAGAAACTGGG + Intergenic
981039810 4:140212674-140212696 CCCCAGGGAAAAGTCAAGCTGGG + Intergenic
981217408 4:142186975-142186997 CCACATGGAGAAGAGAAACCTGG + Intronic
982060236 4:151597642-151597664 CTCCCTGGGAAAGAGCACCTGGG - Intronic
985080900 4:186262846-186262868 CCACATGGAAAAGTAAAGCTGGG + Intergenic
986715175 5:10518288-10518310 CCCCATGGGGCAGAGAATCTGGG + Intronic
988867668 5:35353668-35353690 CTCCCTGGAACAGAGCACCTTGG - Intergenic
990741652 5:58918769-58918791 CCCCCTGGAAAAAAGAAATTTGG - Intergenic
990897554 5:60715528-60715550 CTCCCTGGAACAGAGCACCTGGG - Intergenic
991003740 5:61807880-61807902 CCCCATGGAAATCAGCAACTTGG + Intergenic
991019465 5:61964819-61964841 TGTCATGGATAAGAGAACCTAGG - Intergenic
991186153 5:63810602-63810624 GAACATGGAAAAGAGAAACTAGG - Intergenic
995471258 5:112504116-112504138 CTCCCTGGAACAGAGCACCTGGG + Intergenic
995827450 5:116316384-116316406 CCCCATAGGAAAGAATACCTAGG - Intronic
996129985 5:119770056-119770078 CTCCATGGGACAGAGCACCTGGG + Intergenic
996270827 5:121602681-121602703 CTCCCTGGAACAGAGCACCTGGG + Intergenic
997969098 5:138385529-138385551 ACCAAAGGAAAAGTGAACCTGGG - Intronic
999011212 5:148042799-148042821 CCCCTTGGAAAAGAGGCCTTAGG + Intronic
1001346348 5:170903112-170903134 CTCCCTGGAACAGAGCACCTGGG - Intronic
1002734767 5:181377183-181377205 CTCCCTGGAACAGAGCACCTAGG - Intergenic
1002749763 6:96937-96959 CTCCCTGGAACAGAGCACCTAGG + Intergenic
1002944846 6:1751099-1751121 CTCCCTGGAACAGAGCACCTGGG + Intronic
1003879937 6:10470897-10470919 CCCCATGGGAATGAGGACCAGGG - Intergenic
1004019874 6:11767759-11767781 GCACATGGAAAAGACAACCGAGG - Intronic
1005425930 6:25702304-25702326 CCCCATGGAAAGGAGACTGTTGG + Intergenic
1005456849 6:26028464-26028486 CACCTTGGAAAAGAGAACAAAGG - Intergenic
1006379103 6:33687545-33687567 CACCATGGAAGAGATACCCTCGG - Exonic
1006873052 6:37270780-37270802 CCCCAGGAAGATGAGAACCTAGG - Intronic
1008150944 6:47950298-47950320 CCACATGGAAAATATAAGCTGGG + Intronic
1011086526 6:83546996-83547018 CTCCCTGGGAAAGAGCACCTGGG + Intergenic
1011998118 6:93619091-93619113 CCCCATGGAAAAGTGAGCAAAGG + Intergenic
1013625621 6:111934579-111934601 CCCCCTGGGAGAGAGCACCTGGG - Intergenic
1013956957 6:115852829-115852851 CTCCCTGGAACAGAGCACCTGGG + Intergenic
1014385709 6:120799203-120799225 ACCCATGTAAGAGAAAACCTGGG - Intergenic
1014466373 6:121761021-121761043 CCCCCTGGGACAGAGCACCTGGG + Intergenic
1015108953 6:129569491-129569513 CCCCATGGGACAGAGCACCTGGG + Intergenic
1016737418 6:147494385-147494407 CCCCATGGAATAGAGACCACAGG - Intergenic
1017271079 6:152506169-152506191 GCCCTTGGAAAAGAGAAGCGAGG + Intronic
1017768388 6:157625511-157625533 GTCCATGGAAAAGAGACCCTGGG + Intronic
1019239025 6:170649503-170649525 CTCCCTGGAACAGAGCACCTAGG - Intergenic
1019729438 7:2622313-2622335 CCCCATGGAGGAGAGAGCCCAGG + Intergenic
1020338944 7:7088888-7088910 CTCCCTGGAACAGAGCACCTGGG - Intergenic
1022159298 7:27692880-27692902 CCCCATTGAAAAGAGAAGGATGG + Intergenic
1028080351 7:86567704-86567726 CTCCTTGGAACAGAGTACCTGGG + Intergenic
1028774703 7:94663862-94663884 CTTCATGGAAAAGAGCACCAGGG + Exonic
1028991298 7:97051439-97051461 CTCCCTGGAACAGAGCACCTGGG + Intergenic
1029607600 7:101608582-101608604 CCCCAGGGAAAAGAAAAGCAGGG - Intergenic
1029845213 7:103405791-103405813 CTCCCTGGGACAGAGAACCTGGG - Intronic
1030114106 7:106050212-106050234 CCCCACAGAAAAGGGAACGTGGG - Intergenic
1030402942 7:109075632-109075654 CCAAATGAAAATGAGAACCTAGG - Intergenic
1030776630 7:113541687-113541709 CCACATGGAAAAAAGAGTCTGGG - Intergenic
1031107531 7:117563552-117563574 CTCCATGCATAAGAGAAACTGGG + Intronic
1032312543 7:130802141-130802163 CTCCCTGGAACAGAGCACCTAGG - Intergenic
1035054066 7:156022230-156022252 CCCTAAGGAGATGAGAACCTGGG + Intergenic
1035054073 7:156022254-156022276 CCACATGGAGATGAGAACCTGGG + Intergenic
1035508745 8:157106-157128 CTCCCTGGAACAGAGCACCTAGG + Intergenic
1036545351 8:9763432-9763454 CCCCATGCATTAGAAAACCTAGG - Intronic
1036585235 8:10117457-10117479 CCCCATGGAAGTGTGAACTTGGG + Intronic
1036799128 8:11776754-11776776 CCCCAAGGAAGAGAGAACCCAGG - Intronic
1036949693 8:13129339-13129361 AGCCATGGAAAAGAGGATCTTGG + Intronic
1038430583 8:27496422-27496444 CTCAAAGGCAAAGAGAACCTTGG + Intronic
1039212511 8:35233952-35233974 CCCCATAGAAAAGGGAGCCTTGG - Intergenic
1039283019 8:36006938-36006960 CTCCATGGGACAGAGCACCTGGG + Intergenic
1042834204 8:73063321-73063343 GCACATGGAAAAGGGAACCAGGG + Intergenic
1045797744 8:106065598-106065620 CTCCCTGGGAAAGAGCACCTGGG + Intergenic
1045844072 8:106613119-106613141 CCCTAGGGAAAACAGAACTTTGG + Intronic
1046330660 8:112710908-112710930 CTCCAAGGATAAGAGACCCTGGG + Intronic
1046787964 8:118288000-118288022 GCCATTGGAAAAAAGAACCTTGG + Intronic
1047121345 8:121908445-121908467 CTCCCTGGAACAGAGCACCTGGG + Intergenic
1047278692 8:123426029-123426051 CCCCCTGCAAAAAAGAAACTAGG + Intronic
1050965440 9:11795645-11795667 CCCCATGGACATTAGAACTTTGG - Intergenic
1056176742 9:84043694-84043716 CTCCCTGGGACAGAGAACCTGGG - Intergenic
1056217347 9:84417583-84417605 CCCCATGGAAAAGTCCAGCTGGG - Intergenic
1057958360 9:99430803-99430825 CTCCATGGACAAGAGAGCCTTGG - Intergenic
1059998703 9:119938963-119938985 CCCTGGGGAAAAGAGGACCTGGG + Intergenic
1062759230 9:138329793-138329815 CTCCCTGGAACAGAGCACCTAGG - Intergenic
1203599680 Un_KI270748v1:566-588 CTCCCTGGAACAGAGCACCTAGG - Intergenic
1186740992 X:12517850-12517872 CTCCCTGGAAAAGAGCCCCTTGG - Intronic
1186929178 X:14369735-14369757 CCCCCTGGGACAGAGCACCTGGG + Intergenic
1186945355 X:14559958-14559980 GCCCATGAAAGAGAGAGCCTTGG - Intronic
1191221448 X:57991687-57991709 CTCCTTGGAAAACAGTACCTTGG - Intergenic
1191966696 X:66766743-66766765 CTCCCTGGGATAGAGAACCTCGG - Intergenic
1192075225 X:67988058-67988080 CCCTATCTAAAAGAAAACCTAGG + Intergenic
1192598594 X:72437869-72437891 CTCCATGGGACAGAGCACCTGGG + Intronic
1192712577 X:73607094-73607116 CTCCCTGGAACAGAGCACCTGGG - Intronic
1193295637 X:79828745-79828767 CCAAAGGGAAAAGAGAAGCTGGG - Intergenic
1193774252 X:85622956-85622978 CTCCTTGGAACAGAGCACCTGGG + Intergenic
1194139899 X:90196485-90196507 CTCCATGGGAGAGAGCACCTGGG + Intergenic
1194158579 X:90422951-90422973 CTCCCTGGGAAAGAGCACCTGGG + Intergenic
1194242608 X:91470315-91470337 CTCCCTGGGAAAGAGCACCTGGG + Intergenic
1195557955 X:106248860-106248882 CCTCAAGGAAAAGAAATCCTAGG - Intergenic
1195558210 X:106251506-106251528 CCTCAAGGAAAAGAAATCCTAGG - Intergenic
1196308022 X:114127423-114127445 CTCCCTGGAAAAAAGCACCTAGG - Intergenic
1196476404 X:116091825-116091847 CTCCCTGGAACAGAGCACCTGGG - Intergenic
1197132156 X:123018183-123018205 CCCCATTGAAAAGTGGACCAAGG - Intergenic
1197142237 X:123130173-123130195 CTCCCTGGAACAGAGCACCTGGG + Intergenic
1198645456 X:138801696-138801718 CTCCCTGGGAAAGAGCACCTGGG - Intronic
1200129792 X:153835158-153835180 CCACATGGAAAAATGAACCTAGG - Intergenic
1200210062 X:154343073-154343095 CCCCAGGGCAAAGAGATGCTGGG - Intergenic
1200220790 X:154389019-154389041 CCCCAGGGCAAAGAGATGCTGGG + Intergenic
1200504895 Y:3999919-3999941 CTCCCTGGGAAAGAGCACCTGGG + Intergenic
1201422251 Y:13812321-13812343 CTCCCTGGGAAAGAGTACCTGGG - Intergenic
1201455302 Y:14162203-14162225 CCCAAAGGCAAAGAGAAACTGGG - Intergenic
1201689962 Y:16752629-16752651 CTCCCTGGGAAAGAGCACCTGGG - Intergenic