ID: 1091833417

View in Genome Browser
Species Human (GRCh38)
Location 12:3567117-3567139
Sequence GTTGATCCACAGATGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091833417_1091833424 28 Left 1091833417 12:3567117-3567139 CCCCTCTCCATCTGTGGATCAAC 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1091833424 12:3567168-3567190 CTTCTGTTGAGCTTTAGCTATGG 0: 1
1: 0
2: 0
3: 10
4: 106
1091833417_1091833425 29 Left 1091833417 12:3567117-3567139 CCCCTCTCCATCTGTGGATCAAC 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1091833425 12:3567169-3567191 TTCTGTTGAGCTTTAGCTATGGG 0: 1
1: 0
2: 2
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091833417 Original CRISPR GTTGATCCACAGATGGAGAG GGG (reversed) Intronic
902565296 1:17307531-17307553 GTTCTTCCACAGCTCGAGAGTGG - Intergenic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
905707567 1:40073057-40073079 GTTGATCTCCAGAAGGAGAAAGG + Exonic
906609934 1:47194435-47194457 CTTGCCCCACAGATAGAGAGTGG - Intergenic
909218710 1:72926792-72926814 GTTGGCCCACACAGGGAGAGAGG - Intergenic
911177115 1:94827892-94827914 GGTCATCCACAGAGAGAGAGAGG + Intronic
912755774 1:112323913-112323935 GATGATAGACAGATGGAGGGAGG + Intergenic
918992536 1:191716500-191716522 TTTGATCAACAAATGGATAGCGG - Intergenic
919871659 1:201826537-201826559 GGTGTTCCTCAGGTGGAGAGTGG + Exonic
920194941 1:204220596-204220618 TTTGATCCAAAGAAGGGGAGAGG - Exonic
920406030 1:205711905-205711927 GTGGATAAACAGATGAAGAGAGG - Intergenic
920446411 1:206022005-206022027 GCTGACTCAAAGATGGAGAGTGG + Intronic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1066047458 10:31605567-31605589 GTTGATCCAAGGTTGGAGAGTGG - Intergenic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1076662014 10:132062024-132062046 GATGAGCCACAGAGGGAAAGGGG + Intergenic
1076825097 10:132963249-132963271 GTTGACGGACAGATGGAGGGAGG - Intergenic
1076825105 10:132963279-132963301 GTTGATAGACAGATGGATGGAGG - Intergenic
1076825110 10:132963309-132963331 TTTGATGGACAGATGGAGGGAGG - Intergenic
1076825122 10:132963369-132963391 GTTGATGGACAGATGGAGGGAGG - Intergenic
1079556627 11:21766531-21766553 GTTTATCAACAGATTAAGAGAGG - Intergenic
1084843523 11:71879043-71879065 TTTGATCAAAAGATGGTGAGAGG + Intronic
1089135259 11:116244123-116244145 GTGGATCCACAGGTGGCCAGAGG + Intergenic
1089795524 11:120977517-120977539 GTTGAAAAACAGATGGAGCGGGG - Intronic
1090049151 11:123362147-123362169 GGTGATCCACAGTAGGGGAGAGG + Intergenic
1091295006 11:134467529-134467551 GTTCATGCACAGATGAGGAGAGG - Intergenic
1091666729 12:2424272-2424294 GTCCATCCTCAGGTGGAGAGGGG + Intronic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1095969979 12:47894877-47894899 GTGGATCCACAGGTGGAGGCAGG - Intronic
1101543640 12:105688938-105688960 GTTGACACCCAGAGGGAGAGAGG + Intergenic
1103927570 12:124432408-124432430 GTTGAGCCACACATGGTGGGTGG - Intronic
1105052819 12:133069920-133069942 GTTGAACCAGAGATGGTGCGTGG - Intergenic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1107410232 13:40151497-40151519 AATGGTCCACAGATGGAGACAGG - Intergenic
1108093762 13:46879223-46879245 GCTGATCCAGAGAGGCAGAGAGG + Intronic
1110154483 13:72297916-72297938 GTAGAGCCATAGATGGAGAAGGG - Intergenic
1110846464 13:80195469-80195491 GTAGATCCAGACAAGGAGAGAGG - Intergenic
1114547671 14:23514269-23514291 GTGGAGCAACAGACGGAGAGTGG + Intergenic
1117345457 14:54827484-54827506 GTTGATCCCATGTTGGAGAGGGG - Intergenic
1120722708 14:87905664-87905686 GTGGATTCTCAGAGGGAGAGGGG + Intronic
1123804639 15:23858836-23858858 GTTAATCAACAGATGCAGAGTGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126341413 15:47645155-47645177 GATGATCCACAGAGGGATAAAGG + Intronic
1126879042 15:53074955-53074977 GGTGATCGACAGAAAGAGAGAGG - Intergenic
1129203991 15:74024576-74024598 GTTGGCTCAGAGATGGAGAGAGG + Intronic
1129743327 15:78000863-78000885 GTGGTCCCACAGATGGAGAAGGG - Intronic
1131348273 15:91671838-91671860 GTTGTTCCACAAGTGCAGAGAGG + Intergenic
1131571954 15:93546881-93546903 GTTTATCTATAAATGGAGAGAGG - Intergenic
1131622276 15:94080707-94080729 CTTGATCGACAGCTGGAAAGGGG + Intergenic
1132198457 15:99931668-99931690 GTGTTTCCATAGATGGAGAGTGG + Intergenic
1133289469 16:4709562-4709584 GTTCATCCACTGATGGACACAGG - Intronic
1136633906 16:31507365-31507387 GTTGGTCCTGAGAAGGAGAGAGG - Intronic
1137948489 16:52758735-52758757 TTTGATTCAAAGATGGGGAGTGG - Intergenic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1141023449 16:80520405-80520427 GTACATCCACAGAAGGAGTGGGG + Intergenic
1141487379 16:84349742-84349764 GAGGATCCTGAGATGGAGAGAGG + Intergenic
1142124039 16:88401419-88401441 GATGATGGACAGATGGATAGAGG + Intergenic
1142248690 16:88981244-88981266 GGTGAGCCACAGAGGGAGTGGGG + Intergenic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG + Intergenic
1142824934 17:2504172-2504194 TTTATTACACAGATGGAGAGTGG + Intronic
1143819734 17:9550683-9550705 TTTGAACCACAGATGGAGCGGGG + Intronic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1148660332 17:49325931-49325953 GGTGTTCCACAGATTTAGAGTGG + Intronic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1152890728 17:82880362-82880384 GTTGACCCTAAGATGGGGAGAGG - Intronic
1154352602 18:13598796-13598818 GATGCTCCACAGCTGGAGTGGGG + Intronic
1155039914 18:22056249-22056271 GTTGGTCCACAGGTAGAGATAGG + Intergenic
1155070203 18:22308239-22308261 GTTGATGCACTGATTGAGAAGGG + Intergenic
1157482175 18:48062281-48062303 CTTGATCCCCAGAAGGGGAGAGG + Intronic
1159719453 18:71869302-71869324 ACTGATACACAGATGGAAAGGGG - Intergenic
1159939204 18:74393555-74393577 GGTGACCCTCAGATGGAGTGGGG + Intergenic
1160427877 18:78790708-78790730 GTGGACACACAGATGGGGAGCGG + Intergenic
1160483156 18:79261500-79261522 GCAGATCCAGAGCTGGAGAGAGG + Intronic
1160727554 19:624262-624284 ACTCATCCACAGATGGGGAGGGG + Intronic
1163462150 19:17445471-17445493 ATTGATGGATAGATGGAGAGTGG - Intronic
1163688273 19:18724665-18724687 GATGAGACACAGATGCAGAGGGG - Intronic
1166335625 19:42105070-42105092 GTTGATCCACATCTGGAGGGAGG - Intronic
928879734 2:36084582-36084604 ATTGATGGAAAGATGGAGAGTGG - Intergenic
933887254 2:86730078-86730100 GTTGGTGCACAGATGGAGTCTGG + Intronic
933922921 2:87066635-87066657 GTTGGTGCACAGATGGAGTCTGG - Intergenic
934768782 2:96894940-96894962 GTGGGCCCACAGATGCAGAGCGG - Intronic
939043600 2:137222930-137222952 TTTCATCCACAGAATGAGAGAGG - Intronic
940496112 2:154431135-154431157 TTTAATCCATAGATGAAGAGGGG - Intronic
940500595 2:154488884-154488906 GTTTGTTCACTGATGGAGAGGGG - Intergenic
940930287 2:159421092-159421114 TTTGGTCCACAGATGTAGTGAGG - Intronic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
944110347 2:196125004-196125026 GTTGAGCCACAGCTGGAGATTGG + Intergenic
944313557 2:198261852-198261874 GTTTGTACCCAGATGGAGAGAGG + Intronic
945425605 2:209696530-209696552 TTTGATCCACAGATGATGATAGG + Exonic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947937103 2:234016606-234016628 GTTGATTCAAGGATGGAGATGGG - Intronic
1168787090 20:549094-549116 GATGAACTACAGAGGGAGAGAGG - Intergenic
1169845498 20:9987438-9987460 GTTTATGCACAGAAGTAGAGAGG + Intronic
1172386679 20:34538890-34538912 GTAAATCCACAGGTGGAGTGGGG - Intronic
1173577743 20:44123972-44123994 ATGGATCCAGAGATGGTGAGTGG - Intronic
1173583814 20:44166748-44166770 ATGCATCCACAGAGGGAGAGAGG + Intronic
1175435696 20:58945991-58946013 GTGGATCCAGAGATGGAGTGGGG + Intergenic
1175748224 20:61476572-61476594 GGTGAGACACAGGTGGAGAGTGG + Intronic
1178092093 21:29174823-29174845 GTTGTTCCACACATTGAGACTGG - Exonic
1178579580 21:33827042-33827064 GTTGCTTCACACATGAAGAGTGG + Intronic
1180041055 21:45280352-45280374 GTAGATCCACAGCTGAAGATGGG - Intronic
1181973433 22:26711173-26711195 GATGATCCACAGGAGGGGAGTGG + Intergenic
1183764865 22:39863623-39863645 GTTCATCCCAAGATGGAGAAAGG - Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
949606024 3:5654787-5654809 TTTGATGGAGAGATGGAGAGGGG + Intergenic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952079427 3:29740145-29740167 GTTGATCCACAGGCACAGAGAGG - Intronic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
957877539 3:86168441-86168463 ATTGATTAAAAGATGGAGAGTGG - Intergenic
960036123 3:113104805-113104827 GCTGGGCTACAGATGGAGAGGGG + Intergenic
961592143 3:127988974-127988996 GGTGATCCACAGAGGGGGACGGG + Intergenic
964458186 3:156892072-156892094 ATTGATCCAGAGTTGGACAGGGG + Intronic
964562582 3:158014014-158014036 ATTGGTCCACATATGAAGAGAGG - Intergenic
967528575 3:190522605-190522627 GATGAATCTCAGATGGAGAGGGG + Intronic
969784620 4:9445123-9445145 TTTGATCAAAAGATGGTGAGAGG + Intronic
971559867 4:28064448-28064470 GATGATACACAGATTGAGAGTGG - Intergenic
973035055 4:45396123-45396145 CTTGATTCTCAGATTGAGAGTGG + Intergenic
974571778 4:63660778-63660800 GTTGCTTCACAGATAGAGAAAGG + Intergenic
985030525 4:185784516-185784538 GATGATACAGCGATGGAGAGAGG + Intronic
985716169 5:1463203-1463225 GTGGATCCACAGAGGCAGACAGG + Exonic
987331424 5:16860768-16860790 GTGGATGGACGGATGGAGAGAGG + Intronic
988453425 5:31365661-31365683 CATGATACTCAGATGGAGAGAGG + Intergenic
989648244 5:43659877-43659899 GTTTATCTCCAGATGGAGAGAGG - Intronic
991592101 5:68263998-68264020 GTTAATCATCAGATGGACAGAGG - Intronic
992770432 5:80042321-80042343 GCTGATCCACAGATGAAGAACGG - Intronic
996635528 5:125684829-125684851 GTTGAAGCACAGATTGGGAGTGG - Intergenic
999238464 5:150114015-150114037 GTTGGTCCAAGGAGGGAGAGTGG - Exonic
999507866 5:152217128-152217150 ATTCATCCACGAATGGAGAGAGG - Intergenic
1001147557 5:169198037-169198059 GTTGATGCATAGATGGATGGTGG - Intronic
1002758495 6:183595-183617 GTTGACCCACAGCTGGAGTGCGG + Intergenic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1015982198 6:138850542-138850564 GTTCATCCACTGATGGAAACTGG + Intronic
1021928354 7:25554580-25554602 GATGATGCAGGGATGGAGAGTGG + Intergenic
1023138534 7:37077757-37077779 GAGGAGCCACAGGTGGAGAGAGG + Intronic
1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG + Intronic
1024274278 7:47665243-47665265 CTTGAGCCACAGATGGTGATTGG - Intergenic
1031089602 7:117338609-117338631 GTTGTTCCACAGATGAAGATTGG - Intergenic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032444053 7:131965434-131965456 GTTCATCCTCAGCTGGAGAATGG - Intergenic
1035042151 7:155936713-155936735 GTGAGTCCACAGATGGGGAGTGG + Intergenic
1037131582 8:15413262-15413284 ACGGGTCCACAGATGGAGAGAGG - Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1038418645 8:27417621-27417643 GTTGAGTCACAGCTGGGGAGTGG + Intronic
1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG + Intronic
1041412726 8:57574489-57574511 GTTGATTCTCAGATGGGGACAGG + Intergenic
1045165234 8:99597104-99597126 GTTCATCGTCAGATGAAGAGGGG - Intronic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1047454964 8:124999905-124999927 GTTGAGCCTCAGATGGAGGTTGG + Intronic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1053290030 9:36873704-36873726 TTTGAGCATCAGATGGAGAGAGG - Intronic
1055961842 9:81828003-81828025 GGTAAACTACAGATGGAGAGAGG - Intergenic
1056683452 9:88740094-88740116 GTTGATCCCCAAATGTAGGGAGG + Intergenic
1056684422 9:88747700-88747722 GTCGGTCCACACAGGGAGAGAGG + Intergenic
1057673731 9:97120161-97120183 ATTGATCAAAAGATGGAGATTGG + Intergenic
1058151597 9:101469507-101469529 GCTGATCTGCAAATGGAGAGAGG - Intergenic
1060493980 9:124104609-124104631 GTGGATCCACTGATGCAGAAAGG - Intergenic
1060874382 9:127070067-127070089 GTTTTTCCACGGATGGAGAGTGG + Intronic
1186603189 X:11060671-11060693 GCAAATCCACACATGGAGAGAGG - Intergenic
1192084480 X:68082666-68082688 GTTGTTCCACATATGGAGCATGG + Intronic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1194292120 X:92087021-92087043 GTTCATGCACAGATGAGGAGAGG + Intronic
1194322868 X:92474082-92474104 ATTGAGCCACAGATAGAGATAGG - Intronic
1196209573 X:112980916-112980938 GTTGAAGCAGAGATGGTGAGAGG - Intergenic
1198479206 X:137025468-137025490 GTTGTAGCACAGATGAAGAGGGG + Intergenic
1199081041 X:143577150-143577172 ATTGATGCATAGATGGAGGGTGG + Intergenic
1200631021 Y:5587561-5587583 ATTGAGCCACAGATAGAGATAGG - Intronic