ID: 1091833450

View in Genome Browser
Species Human (GRCh38)
Location 12:3567423-3567445
Sequence CACCCATTTGGTATTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091833448_1091833450 -3 Left 1091833448 12:3567403-3567425 CCTCACAAACACTAGAAGGGCAC 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1091833443_1091833450 27 Left 1091833443 12:3567373-3567395 CCATGCTCTCATCAAAATATCAA 0: 1
1: 0
2: 1
3: 20
4: 364
Right 1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1091833444_1091833450 1 Left 1091833444 12:3567399-3567421 CCTCCCTCACAAACACTAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1091833447_1091833450 -2 Left 1091833447 12:3567402-3567424 CCCTCACAAACACTAGAAGGGCA 0: 1
1: 0
2: 2
3: 14
4: 156
Right 1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1091833442_1091833450 28 Left 1091833442 12:3567372-3567394 CCCATGCTCTCATCAAAATATCA 0: 1
1: 0
2: 1
3: 20
4: 259
Right 1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091833450 Original CRISPR CACCCATTTGGTATTGAGCC TGG Intronic
901514450 1:9735579-9735601 CAGCCAGTTGGTATTGACCTTGG - Exonic
901928347 1:12581354-12581376 CACCGATTAGGTCTAGAGCCAGG + Intronic
909390639 1:75117095-75117117 GACCCATTTGTTATTCAACCAGG + Intergenic
910191207 1:84597893-84597915 CGCCCATTGGGTGTTGATCCAGG + Intergenic
911792338 1:102033415-102033437 GACCCATTTGTTAATAAGCCAGG + Intergenic
920657974 1:207890552-207890574 CTCCCAGTTGGAATGGAGCCTGG + Intronic
1068310919 10:55273884-55273906 AACTAATTTGTTATTGAGCCTGG - Intronic
1068410956 10:56653720-56653742 CACCCATTTGGTACTGGGGTGGG - Intergenic
1071979345 10:90987931-90987953 CATCCATTTGCTATTGTCCCAGG + Intergenic
1074937876 10:118203889-118203911 CACCAATTTGAAATAGAGCCTGG + Intergenic
1084620573 11:70267679-70267701 CACCCAGTTGGTATAGCTCCAGG - Intergenic
1087571090 11:99928517-99928539 CTTCCATGTGGTGTTGAGCCTGG - Intronic
1089085002 11:115809496-115809518 CACCCATTTAAAATTGAGTCAGG - Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG + Intronic
1095353252 12:41240346-41240368 CACCCATTATGTTTTGAGACAGG - Intronic
1096172919 12:49487897-49487919 AACCCATGTGTTATTGAGACTGG + Intronic
1100692058 12:97048555-97048577 AACCTATTTGGTACTGGGCCTGG + Intergenic
1102989270 12:117303190-117303212 CACCCTTTTGGTTTTCAGCAAGG + Intronic
1103920759 12:124398018-124398040 GACACATTTGGCCTTGAGCCAGG - Intronic
1110884183 13:80612502-80612524 CATCCATTTGGTGTTTAGTCTGG + Intergenic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1128961080 15:72005456-72005478 CAAGCATTTGGTATTGTGACAGG - Intronic
1139370047 16:66461418-66461440 CGCCCATCTGGTAATGAGCCTGG + Intronic
1143449504 17:7027438-7027460 CACCTTTTAGGTGTTGAGCCGGG - Intronic
1148669941 17:49402903-49402925 CACAGATTTGGGATGGAGCCAGG - Intronic
1152290733 17:79438620-79438642 CACCTATGTGGTACTGGGCCAGG - Intronic
1163284765 19:16339427-16339449 CATCCATTTGAGATAGAGCCCGG - Intergenic
926900969 2:17752022-17752044 AAACCAGTTAGTATTGAGCCTGG - Intronic
928982947 2:37155353-37155375 CACTCATTCATTATTGAGCCTGG - Intronic
935268452 2:101413970-101413992 CACCCTATTGGGATAGAGCCTGG - Intronic
937440644 2:121912613-121912635 CCCCCCTATGGTATAGAGCCTGG + Intergenic
939506398 2:143052633-143052655 CTTCCATATGGTGTTGAGCCTGG + Exonic
942417785 2:175776957-175776979 CACCCATTTTGTAATGAGGCAGG - Intergenic
944044049 2:195388466-195388488 CTTCCATGTGGTATCGAGCCTGG + Intergenic
1170621565 20:18000778-18000800 CACCCATTTGCTTTTGACTCTGG + Intronic
1173675031 20:44825962-44825984 CACCCTGTTGGTTTTGTGCCTGG + Intergenic
1173838905 20:46144088-46144110 CACCCTTTTTTTATTGAGACAGG - Intergenic
1177606027 21:23378912-23378934 CGTCCATGTGGTATTGATCCTGG + Intergenic
1177667255 21:24176497-24176519 CAGCCATTTTGTTTTAAGCCAGG - Intergenic
1177868581 21:26543234-26543256 CACCACTTAGGTATTAAGCCCGG - Intronic
1178338607 21:31766227-31766249 CTTCCATGTGGTATTGAGCCTGG + Intergenic
1179906536 21:44425898-44425920 CATCCATCTGGTATTAATCCTGG + Intronic
1184067944 22:42130793-42130815 AGCCCATTTGGTAGTGAGGCAGG - Exonic
952823385 3:37504536-37504558 CTCACATTTGGTATAGTGCCTGG + Intronic
956082806 3:65577726-65577748 CACACATTTTGTATACAGCCTGG - Intronic
957225287 3:77435657-77435679 CATTCCTTTGGTATTGAGACTGG - Intronic
966537964 3:181055160-181055182 CTACCAATTGGTAATGAGCCTGG + Intergenic
971154147 4:24064277-24064299 CACCCACTTGCTATAGAGCCAGG - Intergenic
972370559 4:38419462-38419484 CTTCCATGTGGTGTTGAGCCTGG - Intergenic
975629022 4:76380964-76380986 CTTCCATGTGGTGTTGAGCCTGG + Intronic
976118813 4:81757899-81757921 CACCCTGTTGGCAGTGAGCCTGG - Intronic
978145409 4:105366143-105366165 CTTCCATGTGGTGTTGAGCCTGG + Intergenic
983647633 4:170007831-170007853 CTCCCCTGTGGTATTTAGCCAGG - Intronic
983810065 4:172050609-172050631 GACCCATTTGGTGTGGATCCAGG + Intronic
987696196 5:21336252-21336274 CACACATTTGGACTTGAGCACGG - Intergenic
988162860 5:27543929-27543951 CTTCCATGTGTTATTGAGCCTGG + Intergenic
988370169 5:30358602-30358624 CAGCTATTTGGGATTGAGGCAGG + Intergenic
992148968 5:73882010-73882032 CACCCATTTGGCATTTACACTGG - Intronic
992764381 5:79983266-79983288 CACATATTAGGTATTCAGCCTGG + Exonic
995861374 5:116644420-116644442 CACCCATTTGTGAATAAGCCAGG - Intergenic
1004802366 6:19163856-19163878 CACCTATTTGGAAATGAGCTAGG - Intergenic
1007702311 6:43772208-43772230 CACCCATTTCCTTTTTAGCCTGG + Intronic
1008676872 6:53828365-53828387 CACCCATCTGGTTCTGAGCCAGG + Intronic
1017303813 6:152893288-152893310 CTCCCAGTTGAAATTGAGCCAGG + Intergenic
1024308451 7:47947613-47947635 CACCCATGTGTTGTTGAGGCTGG - Intronic
1025288835 7:57693850-57693872 CACTCATTGGATATTGATCCAGG + Intergenic
1025851568 7:65248912-65248934 CACCCATTTTTTTTTGAGACAGG + Intergenic
1034861306 7:154597283-154597305 AACTCATTAGGCATTGAGCCAGG - Intronic
1037019186 8:13947223-13947245 CATGAATTTGGTATTGTGCCAGG + Intergenic
1038626950 8:29203258-29203280 CACCCATGTGGGACTGACCCAGG + Intronic
1048096461 8:131300595-131300617 CTTCCATGTGGTATTAAGCCTGG - Intergenic
1049267583 8:141677245-141677267 CACCCATCTGGGACTGAGGCTGG + Intergenic
1054810624 9:69431068-69431090 CACCCACCTGGTACTGACCCAGG - Exonic
1056563844 9:87757098-87757120 CACCTACTTGGGAATGAGCCCGG + Intergenic
1056595150 9:88001955-88001977 CTTCCATCTGGTGTTGAGCCTGG + Intergenic
1185753446 X:2632826-2632848 CTCCCATGTGGTTTTGTGCCTGG + Intergenic
1187043077 X:15617273-15617295 CATCCTCCTGGTATTGAGCCAGG - Intergenic
1189722198 X:43931681-43931703 CACCCATTGTGTATGTAGCCTGG - Intergenic
1190110993 X:47588805-47588827 CAGCCATGTGGTATTCAGCATGG + Intronic
1199034136 X:143031669-143031691 CCAGCATTTGGTATTTAGCCTGG + Intronic
1199093288 X:143714862-143714884 CCAGCATTTGGTATTTAGCCTGG - Intronic
1199215048 X:145253304-145253326 CCAGCATTTGGTATTTAGCCTGG + Intronic
1199366008 X:146984052-146984074 TACCCATTTGCTATTCAGACTGG + Intergenic