ID: 1091834679

View in Genome Browser
Species Human (GRCh38)
Location 12:3577179-3577201
Sequence CTCCATGGTGGCACGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 375}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091834674_1091834679 -8 Left 1091834674 12:3577164-3577186 CCACTGAGAGAGTGGCTCCATGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1091834679 12:3577179-3577201 CTCCATGGTGGCACGGATGTGGG 0: 1
1: 0
2: 1
3: 19
4: 375
1091834672_1091834679 3 Left 1091834672 12:3577153-3577175 CCTGGACACAGCCACTGAGAGAG 0: 1
1: 1
2: 1
3: 27
4: 353
Right 1091834679 12:3577179-3577201 CTCCATGGTGGCACGGATGTGGG 0: 1
1: 0
2: 1
3: 19
4: 375
1091834671_1091834679 6 Left 1091834671 12:3577150-3577172 CCGCCTGGACACAGCCACTGAGA 0: 1
1: 0
2: 0
3: 27
4: 270
Right 1091834679 12:3577179-3577201 CTCCATGGTGGCACGGATGTGGG 0: 1
1: 0
2: 1
3: 19
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091834679 Original CRISPR CTCCATGGTGGCACGGATGT GGG Intronic
901220205 1:7579340-7579362 CACGATGGTGGCATGGATGGAGG + Intronic
901903797 1:12390815-12390837 GGCCATGGTGGCAGGGATGGAGG - Intronic
902714406 1:18262505-18262527 CTCCATAATGACACCGATGTTGG - Intronic
904179322 1:28654796-28654818 GGCCATGGTGGCAGGGATGAAGG - Intergenic
905354196 1:37369643-37369665 AGCCATGGTGGCAGGGATGGAGG + Intergenic
906879779 1:49577315-49577337 GGCCATGGTGGCAAGGATGGAGG + Intronic
908737509 1:67291674-67291696 GGCCATGGTGGCAGGGATGGAGG + Intergenic
909172482 1:72314604-72314626 GGCCATGGTGGCAGGGATGGAGG - Intergenic
909548830 1:76876337-76876359 GGCCATGGTGGCAGGGATGGAGG - Intronic
909811066 1:79932191-79932213 GGCCATGGTGGCAGGGATGAAGG + Intergenic
910370759 1:86512992-86513014 GGCCATGGTGGCAGGGATGGAGG + Intergenic
910830977 1:91462560-91462582 GGCCATGGTGGCAGGGATGGAGG - Intergenic
911109048 1:94163843-94163865 GGCCATGGTGGCAGGGATGGAGG - Intronic
911974347 1:104472553-104472575 TGCCATGGTGGCAGGGATGCAGG + Intergenic
911980540 1:104560284-104560306 GTCCATGGTGGCAGGGATGGAGG + Intergenic
912129791 1:106587196-106587218 GTCCATGGTGGCAGGGATGGAGG - Intergenic
913039325 1:115007537-115007559 GGCCATGGTGGCAGGGATGAAGG - Intergenic
914965390 1:152253045-152253067 GTCCATGGTGGCAAGGATGGAGG - Intergenic
915961664 1:160272198-160272220 CACCATGGTGGCAGAGATGGAGG - Intergenic
918025768 1:180744459-180744481 CTCCAAGATGACACAGATGTTGG - Intronic
918720440 1:187845798-187845820 CTCCATGAGGGCACAGATCTTGG - Intergenic
918774618 1:188611608-188611630 GGCCATGGTGGCAGGGATGGAGG + Intergenic
918958356 1:191238794-191238816 AGCCATGGTGGCAGGGATGGAGG + Intergenic
919318091 1:196000191-196000213 GGCCATGGTGGCAGGGATGGAGG + Intergenic
919330323 1:196162788-196162810 GTCCATGGTGGCAGGGATGGAGG + Intergenic
920197555 1:204239217-204239239 GGCCATGGTGGCAGGGATGGGGG + Intronic
921977476 1:221218347-221218369 AGCCATGGTGGCAGGGATGAAGG + Intergenic
922780928 1:228251741-228251763 AGCCATGGTGGCAGGGATGGAGG - Intronic
922902043 1:229144742-229144764 CGCTATGGTGGCAAGGATGGAGG + Intergenic
923128334 1:231052819-231052841 CTCCATGATGTCACTCATGTTGG - Intergenic
923253454 1:232198590-232198612 GGCCATGGTGGCAGGGATGCAGG - Intergenic
923676744 1:236086959-236086981 CTCAATGGTGGTATGGAGGTCGG - Intergenic
924237000 1:242007497-242007519 ATCCATGGTGGCAGGGATAGGGG - Intergenic
924412243 1:243818898-243818920 CTCCATTGTGGCTCCCATGTGGG - Intronic
924840651 1:247706969-247706991 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1063362384 10:5469047-5469069 CTCCTGGGTGGCTCGGACGTGGG + Intergenic
1066166903 10:32798367-32798389 GGCCATGGTGGCAGGGATGGAGG - Intronic
1066169557 10:32827182-32827204 GGCCATGGTGGCAGGGATGGAGG + Intronic
1067333264 10:45341080-45341102 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1068908963 10:62358117-62358139 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1070159449 10:73857079-73857101 CACCATGGGGGCAGGGATGTAGG + Intronic
1071266956 10:83973143-83973165 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1071378499 10:85034220-85034242 GGCCATGGTGGCAGGGATGAAGG + Intergenic
1071942663 10:90606913-90606935 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1072717423 10:97761024-97761046 CACCATGGTGGCAGGGGCGTGGG + Intergenic
1073656560 10:105423631-105423653 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1073995754 10:109313875-109313897 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1076927282 10:133498355-133498377 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1078019506 11:7643968-7643990 CTCAATGCTGACAAGGATGTGGG - Intronic
1079393181 11:20039904-20039926 CTAGATGTTGGCATGGATGTAGG + Intronic
1080020044 11:27550821-27550843 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1080754277 11:35180539-35180561 CTCCATGGAGACAGGAATGTTGG - Intronic
1081642069 11:44762953-44762975 CTCCACAGTGGGAGGGATGTTGG - Intronic
1082920345 11:58485761-58485783 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1082999779 11:59280700-59280722 GTCCATGGTGGTAGGGATGGAGG + Intergenic
1083093257 11:60221963-60221985 GGCCATGGTGGCAGGGATGGAGG + Intronic
1085524892 11:77158323-77158345 CTTCATGGCGGAGCGGATGTTGG - Exonic
1085748456 11:79136414-79136436 GGCCATGGTGGCAGGGATGGAGG + Intronic
1086274524 11:85110085-85110107 CTCCATGGAGAAACAGATGTAGG + Intronic
1088395742 11:109366174-109366196 CTAAATGCTGGCAAGGATGTGGG - Intergenic
1088836778 11:113584217-113584239 GCCCATGGTGGCAGGGATGGAGG + Intergenic
1089676292 11:120092228-120092250 CTCCATGAGGGCAAGGATTTTGG - Intergenic
1090119076 11:124005558-124005580 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1090209370 11:124907220-124907242 AGCCATGGTGGCAGGGATGGAGG - Intergenic
1090221489 11:125030765-125030787 AGCCATGGTGGCAGGGATGGAGG - Intronic
1091030365 11:132181686-132181708 CTTAATAGTGGCACTGATGTTGG + Intronic
1091345467 11:134850210-134850232 CACCATGGTGTCACTAATGTGGG + Intergenic
1091834679 12:3577179-3577201 CTCCATGGTGGCACGGATGTGGG + Intronic
1092093402 12:5822471-5822493 GGCCATGGTGGCAGGGATGGAGG + Intronic
1093031745 12:14295098-14295120 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1093036464 12:14336512-14336534 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1093964659 12:25311788-25311810 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1094026910 12:25969040-25969062 CCGCATGGTGGCTGGGATGTGGG - Intronic
1094389673 12:29935386-29935408 GTCCATGGTGCCAGGGATGGAGG - Intergenic
1094451074 12:30583723-30583745 CACCATGGTGGCTCAGATGTAGG - Intergenic
1098158490 12:67624410-67624432 AACCATGGTGGCACGAATGGAGG + Intergenic
1098504335 12:71231898-71231920 CTTCATGGTGGCAAGGGTGGGGG + Intronic
1098733410 12:74066468-74066490 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1099379271 12:81935715-81935737 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1100083422 12:90879043-90879065 AGCCATGGTGGCAGGGATGGAGG + Intergenic
1100232072 12:92618746-92618768 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1101264258 12:103066953-103066975 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1104147915 12:126053499-126053521 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1105740236 13:23316018-23316040 GGCCATGGTGGCAGGGATGGAGG + Intronic
1105852643 13:24349468-24349490 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1106046164 13:26144204-26144226 GGCCATGGTGGCAGGGATGGAGG - Intronic
1108645089 13:52419493-52419515 CTAAATGCTGGCAAGGATGTGGG + Intronic
1109726507 13:66348257-66348279 CTGCATGGTGGCAGGGATTGGGG - Intronic
1109950904 13:69501374-69501396 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1110377283 13:74807348-74807370 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1110805408 13:79748716-79748738 CTACATGGTGGTGTGGATGTTGG - Intergenic
1110834022 13:80063793-80063815 CACCATGGTGGCAGGGATGGAGG - Intergenic
1111057675 13:82972188-82972210 GACCATGGTGGCAGGGATGGAGG - Intergenic
1111317616 13:86582636-86582658 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1111590912 13:90348176-90348198 CACCATGTTGGCCAGGATGTTGG + Intergenic
1112414182 13:99190689-99190711 CTCCATGCTGGCAAAGATGCTGG + Intergenic
1112459285 13:99589113-99589135 CGTCATGGTGGCACAGAAGTTGG + Intergenic
1113950927 13:114070264-114070286 CTCCATGGTGGCACCCACTTTGG - Intronic
1114205983 14:20571604-20571626 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1114635511 14:24184714-24184736 CTCCATGATGGCAGGGAAGTAGG + Exonic
1114905275 14:27119722-27119744 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1116059021 14:39897763-39897785 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1116415181 14:44670131-44670153 GGCCATGGTGGCAGGGATGAAGG + Intergenic
1117634256 14:57725212-57725234 GGCCATGGTGGCAGGGATGAAGG + Intronic
1118122319 14:62859342-62859364 GGCCATGGTGGCAGGGATGGAGG - Intronic
1118880654 14:69823179-69823201 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1118939244 14:70317330-70317352 CTCCATGGTGGCCGGTGTGTGGG - Intergenic
1119107438 14:71938006-71938028 GGCCATGGTGGCAGGGATGGAGG - Intronic
1119583461 14:75809413-75809435 CTCCATGAAGGCAAGGATTTGGG + Intronic
1119615782 14:76098206-76098228 CTCCAGGCTGACACGGATGGGGG + Intergenic
1120231324 14:81844415-81844437 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1120919806 14:89744552-89744574 TGCCATGGTGGCAGGGATGGAGG + Intergenic
1121928424 14:97949630-97949652 CTCCAAGGTGGCATGCATGTGGG - Intronic
1122901959 14:104785731-104785753 CTCCATGGTGGAGCGGAAGGAGG - Intronic
1123871496 15:24579220-24579242 CTCCCTGGTGGAAAGGATGGAGG + Intergenic
1124571327 15:30866862-30866884 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1125580234 15:40780114-40780136 CTCCCTGGTGGCTAGGAAGTGGG - Intronic
1128642919 15:69353062-69353084 GGCCATGGTGGCAGGGATGGAGG + Intronic
1132086684 15:98914109-98914131 TTGCATGGTGGCAGGGATGCGGG + Intronic
1132391105 15:101438856-101438878 CTTCCTGGTGGCAGGGATATTGG + Intronic
1132511802 16:346444-346466 CTCCATAGTGGCCTGGATTTCGG + Exonic
1133606262 16:7391190-7391212 CACCAAGGTGGGACGGAGGTGGG - Intronic
1134657184 16:15955818-15955840 CTCCATAGGGGCAGGGATTTTGG + Intronic
1135061515 16:19275132-19275154 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1135113613 16:19708753-19708775 CTTCATGGTGGCCCAGATGCAGG + Intronic
1136251057 16:29005406-29005428 GACCATGGTGGCAGGGATGGAGG + Intergenic
1138719134 16:59058829-59058851 GACCATGGTGGCAGGGATGGTGG + Intergenic
1140968967 16:79994577-79994599 CTCCATGGTGGGAAGGAAGCAGG - Intergenic
1141044124 16:80700643-80700665 CCCTATGTTGGCAAGGATGTGGG + Intronic
1142353687 16:89591209-89591231 CTCCAAGGTGGCACGCGTGGCGG + Exonic
1143697792 17:8632892-8632914 CACCATGTTGGCCAGGATGTTGG + Intergenic
1144778483 17:17796454-17796476 CTTCTTGGTGGCACGGCAGTTGG - Exonic
1146249558 17:31326685-31326707 CTCCATGATGACACAAATGTTGG - Intronic
1146758550 17:35454968-35454990 TGCCATGGTGGCAGGGATGGCGG + Intergenic
1146836474 17:36114811-36114833 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1146851055 17:36221870-36221892 GGCCATGGTGGCAGGGATGGAGG + Intronic
1150614247 17:66756606-66756628 CTCAAATGTGGCAAGGATGTTGG + Intronic
1151037682 17:70820762-70820784 GTCCATGGTGGCAGGGATGGAGG - Intergenic
1151195184 17:72426149-72426171 CCCCATGGTGCCATGGCTGTGGG + Intergenic
1151960596 17:77403453-77403475 CTCCATGTCAGCACGGCTGTGGG - Intronic
1153089831 18:1330996-1331018 GTCCGTGGTGGCAGGGATGGAGG + Intergenic
1153217567 18:2834769-2834791 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1154252445 18:12755851-12755873 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1155336871 18:24773916-24773938 GGCCATGGTGGCAGGGATGTAGG - Intergenic
1156546341 18:37967379-37967401 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1156990186 18:43399942-43399964 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1157341327 18:46780845-46780867 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1157401560 18:47392813-47392835 CTCCATGAGGGCAGAGATGTTGG + Intergenic
1159516331 18:69463167-69463189 CGCCATGGTGGAAGGGATGAGGG + Intronic
1159786092 18:72716436-72716458 CTCCAGGTTGGCACTGATCTGGG - Intergenic
1160092563 18:75840848-75840870 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1160580131 18:79879034-79879056 CTCCCTGGAGACCCGGATGTGGG + Intronic
1164419590 19:28077192-28077214 ATCCATGGTTGCAGGGATGGAGG + Intergenic
1165885365 19:39074393-39074415 CTCCAGGAAGGCAGGGATGTTGG - Intergenic
1167510218 19:49891789-49891811 CTCCATGGAGGCAGGGATGTGGG + Intronic
1167932015 19:52873710-52873732 CCCCATGGTGTCAGTGATGTTGG - Intronic
1167942048 19:52955746-52955768 CCCCATGGTGTCAGTGATGTTGG - Intronic
1167978302 19:53251255-53251277 CTCCATGGTGTCAGTGAGGTTGG - Intronic
1168093082 19:54098556-54098578 CTCCATGGTGGCATGCACTTTGG + Intronic
1168115903 19:54221289-54221311 CTCCAGTGTGGCTCTGATGTCGG - Exonic
1168118886 19:54241037-54241059 CTCCAGTGTGGCTCTGATGTCGG - Exonic
1168133832 19:54337606-54337628 CTCCAGTGTGGCTCTGATGTCGG - Exonic
1168185582 19:54697717-54697739 CTCCAGTGTGGCTCTGATGTCGG + Intronic
1168187556 19:54709623-54709645 CTCCAGTGTGGCTCTGATGTCGG + Intergenic
925415035 2:3664009-3664031 TTCCATGGTTGCACTGACGTGGG - Intronic
926022103 2:9505466-9505488 CTCCAGGGTGGCTCTGATGGTGG - Intronic
927008832 2:18880558-18880580 GGCCATGGTGGCAGGGATGGAGG + Intergenic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
930416692 2:51098067-51098089 CCCCATGGTGGCATGGATGGTGG + Intergenic
932655701 2:73609477-73609499 CTCCTTGGTGACATGGATGCAGG + Intronic
934305858 2:91821428-91821450 GGCCATGGTGGCAGGGATGGAGG + Intergenic
934327398 2:92031314-92031336 GGCCATGGTGGCAGGGATGGAGG - Intergenic
934465782 2:94261894-94261916 GGCCATGGTGGCAGGGATGGAGG - Intergenic
935131802 2:100266228-100266250 CACAATGGTGGCAGGGATGGAGG - Intergenic
935147608 2:100406544-100406566 CTTCATGGTGGAACGAATTTTGG - Intronic
935184064 2:100715731-100715753 GGCCATGGTGGCAGGGATGGAGG + Intergenic
935367559 2:102310371-102310393 CACCATGTTGGCCAGGATGTTGG + Intergenic
935539061 2:104327893-104327915 CTACATGGTGTCATGTATGTGGG - Intergenic
936805499 2:116327003-116327025 CTTCACGGTGGCACTGGTGTGGG - Intergenic
937581950 2:123498314-123498336 GACCATGGTGGCAGGGATGGAGG - Intergenic
939806352 2:146779305-146779327 GGCCATGGTGGCAGGGATGGAGG + Intergenic
939829705 2:147057106-147057128 CTACATGGTGGAAAGGAAGTGGG + Intergenic
941849973 2:170170648-170170670 CTCCATGCAGGCAGGGATGGTGG - Intergenic
941860122 2:170270691-170270713 CTCCAACGTGGCAAGGCTGTTGG + Intronic
941946314 2:171101899-171101921 CTCAATAGTGGGACTGATGTGGG - Intronic
942322059 2:174744340-174744362 GGCCATGGTGGCAGGGATGGAGG + Intergenic
943317805 2:186411484-186411506 GGCCATGGTGGCAGGGATGGAGG - Intergenic
943517477 2:188906422-188906444 GTCCATGGTAGCAGGGATGGAGG - Intergenic
944390989 2:199219390-199219412 TTCCAGGGTGGCAGGGTTGTAGG - Intergenic
945717723 2:213379836-213379858 GGCCATGGTGGCAGGGATGGAGG - Intronic
946405853 2:219491740-219491762 CTTCCTGGTGGCAGGGAAGTGGG - Intronic
947440965 2:230121087-230121109 GGCCATGGTGGCAGGGATGGAGG + Intergenic
947628274 2:231634883-231634905 CTCCATGGTGACAGCCATGTGGG + Intergenic
948340328 2:237245528-237245550 GGCCATGGTGGCAGGGATGGAGG - Intergenic
948975424 2:241460785-241460807 CCACATGGTGGCAGGGCTGTGGG + Intronic
1169581613 20:7029489-7029511 GTCCATGGTGGAGTGGATGTAGG - Intergenic
1170869248 20:20189681-20189703 CTAAATGCTGGCAAGGATGTGGG + Intronic
1171329948 20:24328809-24328831 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1171409692 20:24937800-24937822 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1178240499 21:30894194-30894216 CACCATGGTGGCAGGGATAAAGG + Intergenic
1180586923 22:16901070-16901092 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1180591031 22:16937532-16937554 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1180622600 22:17171853-17171875 CTCCCTGGGAGCAAGGATGTAGG - Intergenic
1181406458 22:22688370-22688392 GCCCATGGTGGCAGGGATGGAGG - Intergenic
1182965827 22:34520132-34520154 GGCCATGGTGGCAGGGATGGTGG + Intergenic
1183017707 22:35003283-35003305 CTGCATGGTAGCAAGGATGAAGG - Intergenic
1183324292 22:37183103-37183125 GTCCAGGCTGGCAGGGATGTGGG + Intronic
1184596237 22:45515941-45515963 CCACATGCTGGCATGGATGTCGG + Intronic
1184603445 22:45557532-45557554 GGCCATGGTGGCAGGGATGGAGG - Intronic
1184937358 22:47734910-47734932 GGCCATGGTGGCAGGGATGGAGG - Intergenic
949169918 3:985767-985789 GGCCATGGTGGCAAGGATGGAGG - Intergenic
949417460 3:3830055-3830077 GGCCATGGTGGCAGGGATATAGG - Intronic
949445730 3:4131892-4131914 GGCCATGGTGGCAAGGATGGAGG + Intronic
949490138 3:4581162-4581184 CTCCAAGGTGGCTGGGCTGTCGG - Intronic
949639024 3:6014348-6014370 GGCCATGGTGGCAGGGATGAAGG + Intergenic
950101832 3:10361930-10361952 CTCCATATGGGCACTGATGTTGG + Intronic
950553115 3:13679526-13679548 CTCCATGCAGGCATGGATATGGG - Intergenic
950896289 3:16454584-16454606 CTGCATGGTGGCAGGAATGGGGG + Intronic
951384632 3:22028352-22028374 GGCCATGGTGGCAGGGATGGAGG + Intronic
951970647 3:28441053-28441075 GGCCATGGTGGCAGGGATGGAGG - Intronic
952495684 3:33913877-33913899 GTCCATGGTGGAAAGGATGGAGG + Intergenic
952541754 3:34374257-34374279 CTCCAGGGTGGAATGGATTTTGG + Intergenic
952695478 3:36260823-36260845 ACACATGGTGGCACTGATGTAGG + Intergenic
953278878 3:41532506-41532528 CTCCATGAAGGCAGGGATTTTGG + Intronic
953564196 3:44017005-44017027 CCTCATGGTGGCCAGGATGTGGG + Intergenic
954462424 3:50634910-50634932 CTCCATGGGGGCAATGATGTGGG + Intronic
954511365 3:51128832-51128854 GGCCATGGTGGCAGGGATGGAGG - Intronic
954759845 3:52866226-52866248 CACCATGCTGGCAAGAATGTGGG - Intronic
956509785 3:69981199-69981221 GGCCATGGTGGCAGGGATGGAGG + Intergenic
957754707 3:84470261-84470283 GGCCATGGTGGCAGGGATGGAGG + Intergenic
958812794 3:98881054-98881076 CACCATGGTGGCCAGGCTGTTGG - Intronic
958934425 3:100241445-100241467 GGCCATGGTGGCAGGGATGGAGG + Intergenic
959745898 3:109776441-109776463 GGCCATGGTGGCAGGGATGGAGG - Intergenic
960939357 3:122923351-122923373 CTCCAGGGAGGCAGGGAAGTGGG - Intronic
961697029 3:128712521-128712543 CTCCATGCTGACAGGGTTGTGGG - Intergenic
961710860 3:128827185-128827207 GGCCATGGTGGCAGGGATGGAGG - Intergenic
961921565 3:130431858-130431880 CTCCATGGTGGCCGTGATGATGG - Exonic
962214785 3:133511906-133511928 GGCCATGGTGGCAGGGATGGAGG + Intergenic
963379126 3:144506450-144506472 GGCCATGGTGGCAAGGATGGAGG - Intergenic
963970197 3:151421120-151421142 GGCCATGGTGGCAGGGATGGAGG - Intronic
964679117 3:159318080-159318102 GGCCATGGTGGCAGGGATGGAGG - Intronic
966497178 3:180594006-180594028 CTCCATAGAGGCAGGGAGGTTGG + Intergenic
967831909 3:193926822-193926844 GGCCATGGTGGCAGGGATGGAGG + Intergenic
970629400 4:17924336-17924358 GACCATGGTGGCAGGGATGGAGG + Intronic
971346495 4:25816445-25816467 CTCCATGGCTGCTTGGATGTGGG - Intronic
971687270 4:29786254-29786276 GGCCATGGTGGCATGGATGGAGG - Intergenic
971857541 4:32062021-32062043 GGCCATGGTGGCAGGGATGGAGG - Intergenic
971858341 4:32072006-32072028 CTCCAGTGTGGCATGGCTGTAGG - Intergenic
972085334 4:35207919-35207941 GGCCATGGTGGCATGGATGGAGG + Intergenic
972201190 4:36716349-36716371 GGCCATGGTGGCAGGGATGGAGG - Intergenic
972806038 4:42530162-42530184 GGCCATGGTGGCAAGGATGGAGG + Intronic
972882856 4:43447339-43447361 CGCCATGGTGGCAGGGATGGAGG - Intergenic
973066378 4:45798481-45798503 CTACATGCTGGCAAGGGTGTGGG - Intergenic
974727338 4:65813371-65813393 GGCCATGGTGGCAGGGATGGAGG + Intergenic
975386600 4:73766679-73766701 GGCCATGGTGGCAGGGATGGAGG - Intergenic
975742305 4:77441548-77441570 GACCATGGTGGCAGGGATGGAGG + Intergenic
975982485 4:80176444-80176466 TTCCATGGTGGCAGGGATGGAGG - Intergenic
977833111 4:101617006-101617028 GGCCATGGTGGCAGGGATGGGGG - Intronic
977930285 4:102742985-102743007 GGCCATGGTGGCAGGGATGGGGG - Intronic
978772036 4:112466953-112466975 GGCCATGGTGGCAGGGATGGAGG - Intergenic
978877443 4:113658646-113658668 CTCCATGAGGGCAGGGATATTGG + Intronic
978898949 4:113925979-113926001 GGCCATGGTGGCAGGGATGGAGG - Intronic
980385677 4:132086226-132086248 GGCCATGGTGGCAGGGATGGAGG - Intergenic
980957845 4:139446748-139446770 GGCCATGGTGGCAGGGATGGAGG + Intergenic
981979266 4:150771786-150771808 GGCCATGGTGGCAGGGATGGAGG - Intronic
982111481 4:152059869-152059891 CTCCATGGTGCCAAATATGTAGG - Intergenic
982623219 4:157732054-157732076 GGCCATGGTGGCAGGGATGGAGG - Intergenic
982657811 4:158170998-158171020 CTTCACGGTGCCACGGATATTGG + Exonic
982847897 4:160275134-160275156 GGCCATGGTGGCAGGGATGGAGG + Intergenic
983185189 4:164692408-164692430 GGCCATGGTGGCAGGGATGGAGG + Intergenic
986036925 5:3949617-3949639 GGCCATGGTGGCAGGGATGGAGG - Intergenic
986087221 5:4463551-4463573 GGCCATGGTGGCAGGGATGGAGG + Intergenic
986087294 5:4464141-4464163 GTCCATGGTGGCAAGGATGGAGG - Intergenic
986531283 5:8739489-8739511 GGCCATGGTGGCAGGGATGGAGG - Intergenic
986743071 5:10720592-10720614 GGCCATGGTGGCAGGGATGGAGG + Intronic
986766276 5:10931138-10931160 GGCCATGGTGGCAGGGATGGAGG + Intergenic
986959947 5:13200017-13200039 GGCCATGGTGGCAGGGATGGAGG + Intergenic
987472666 5:18351911-18351933 AGCCATGGTGGCAGGGATGGAGG + Intergenic
988254819 5:28808513-28808535 CTACTGGGTGGCACAGATGTTGG + Intergenic
988562246 5:32291673-32291695 GGCCATGGTGGCAGGGATGGAGG + Intronic
988603534 5:32661350-32661372 CTCTGTGGTGGCACCCATGTGGG + Intergenic
989045036 5:37266452-37266474 GGCCATGGTGGCAGGGATGGAGG - Intergenic
990748214 5:58982756-58982778 GGCCATGGTGGCAGGGATGGAGG - Intronic
991330621 5:65488852-65488874 GGCCATGGTGGCAGGGATGGAGG - Intergenic
991946264 5:71900959-71900981 GGCCATGGTGGCAGGGATGGAGG + Intergenic
993780794 5:92063225-92063247 AGCCATGGTGGCAGGGATGGAGG + Intergenic
994291249 5:98031120-98031142 GGCCATGGTGGCAGGGATGGAGG - Intergenic
995427616 5:112042916-112042938 GGCCATGGTGGCAGGGATGGAGG - Intergenic
997465373 5:134084494-134084516 CTCCAGGGTGGCATGGTTGGGGG + Intergenic
998290213 5:140907719-140907741 GGCCATGGTGGCAGGGATGGAGG - Intronic
999148725 5:149412833-149412855 CTCCAAGGAGGCAGGGATGGGGG + Intergenic
999987616 5:157019487-157019509 CTAAATGCTGGCAAGGATGTGGG + Intergenic
1000417088 5:160994735-160994757 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1001930889 5:175672266-175672288 CCCCTGGGTGGCAGGGATGTGGG + Intronic
1002099647 5:176851015-176851037 CCCCATGGGGGCATGGACGTGGG + Intronic
1002998090 6:2305594-2305616 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1003561569 6:7185020-7185042 CCCCATGGGGGCATGGGTGTGGG - Intronic
1004024952 6:11809209-11809231 CACCATGTTGGCAAGGATTTGGG + Intergenic
1004824170 6:19402399-19402421 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1005973973 6:30783216-30783238 CACCATGTTGGCCAGGATGTAGG + Intergenic
1008340381 6:50357113-50357135 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1008400404 6:51056300-51056322 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1009389991 6:63134240-63134262 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1009770230 6:68136023-68136045 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1010084546 6:71901605-71901627 CTCTATGGTGGCAAGGGTGAAGG + Intronic
1010308496 6:74353380-74353402 CTCAAAGGTGGCAAGGTTGTAGG - Intergenic
1010818746 6:80389243-80389265 GCCCATGGTGGCAGGGATGGAGG + Intergenic
1012344704 6:98171156-98171178 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1012820889 6:104083597-104083619 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1013406791 6:109850635-109850657 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1014363283 6:120507518-120507540 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1015443169 6:133271728-133271750 GGCCATGGTGGCAGGGATGGAGG - Intronic
1015475868 6:133658316-133658338 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1015527568 6:134188042-134188064 AGCCATGGTGGCAAGGATGGAGG - Intronic
1016576145 6:145571754-145571776 GGCCATGGTGGCATGGATGGAGG - Intronic
1017213754 6:151885009-151885031 CTCCATGATGGCGCGGGGGTGGG + Intronic
1017976917 6:159366313-159366335 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1018600011 6:165528371-165528393 GGCCATGGTGGCAGGGATGGAGG + Intronic
1019420476 7:948367-948389 CTCCATGGTGGCCCGAGTTTCGG + Intronic
1021988933 7:26123755-26123777 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1022079006 7:27001164-27001186 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1022816475 7:33919040-33919062 CTCCATGGGTGCACGTGTGTGGG + Intronic
1023106994 7:36772283-36772305 CCCCATAGTGGCAGGGAAGTAGG - Intergenic
1024040660 7:45550980-45551002 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1025986424 7:66456714-66456736 CTCCATGGTTTCATGGATATTGG - Intergenic
1026022287 7:66718402-66718424 CCCCAAGATGGCACAGATGTTGG - Intronic
1027209693 7:76135574-76135596 CTCCATGGTTTCATGGATATTGG - Intergenic
1027406939 7:77872172-77872194 GGCCATGGTGGCAGGGATGGAGG - Intronic
1027685915 7:81278788-81278810 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1028935133 7:96455898-96455920 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1030277666 7:107737473-107737495 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1030677525 7:112399492-112399514 CTCCATGGTGGCAGAGATCGAGG + Intergenic
1031682151 7:124688181-124688203 GACCATGGTGGCAGGGATGGAGG + Intergenic
1034169926 7:149055104-149055126 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1037953776 8:23037226-23037248 GTGCATGGTGGCAGGGATGGAGG + Intronic
1039324055 8:36465712-36465734 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1040061156 8:43103899-43103921 ATCCATGCTGGCACGGATTACGG + Intronic
1040912060 8:52529249-52529271 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1041558438 8:59186116-59186138 TTGCATGGTGGCAATGATGTGGG - Intergenic
1043258042 8:78159652-78159674 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1044150914 8:88773904-88773926 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1044633030 8:94297569-94297591 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1046128554 8:109940763-109940785 GTCCATGGTGGCAGGGATGGAGG - Intergenic
1051702755 9:19841895-19841917 GTCTATGGTGGCAGGGATGGAGG + Intergenic
1052442148 9:28511456-28511478 GGCCATGGTGGCAGGGATGGAGG - Intronic
1053695843 9:40638671-40638693 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1053942830 9:43269708-43269730 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1054307090 9:63437889-63437911 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1054405821 9:64761880-64761902 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1054439448 9:65247367-65247389 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1054490959 9:65774572-65774594 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1056156794 9:83846038-83846060 GGCCATGGTGGCAGGGATGTGGG + Intronic
1056353742 9:85777488-85777510 GGCCATGGTGGCAGGGATGTGGG - Intergenic
1056999517 9:91494540-91494562 CTCCATGGTCTCACTCATGTGGG - Intergenic
1057100474 9:92354407-92354429 GGCCATGGTGGCAGGGATGGAGG - Intronic
1058020022 9:100076894-100076916 GGCCATGGTGGCAGGGATGGAGG + Intronic
1058259145 9:102808853-102808875 GCCCATGGTGGCAGGGATGGAGG - Intergenic
1059196385 9:112375029-112375051 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1060804449 9:126565670-126565692 TTCCATGAGGGCAGGGATGTTGG - Intergenic
1061151643 9:128831923-128831945 CTCCATGGAGGCAGAGATGGAGG + Intergenic
1202778288 9_KI270717v1_random:12283-12305 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1186279624 X:7977950-7977972 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1186383980 X:9090944-9090966 GCCCATGGTGGCAGGGATGAAGG - Intronic
1186966330 X:14790129-14790151 CTCCATAATGGCAGGGATTTTGG - Intergenic
1191629909 X:63311752-63311774 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1191953134 X:66616015-66616037 ATCCATGGTGGGAAGGCTGTGGG + Exonic
1192297596 X:69867196-69867218 GGCCATGGTGGCAGGGATGGAGG - Intronic
1192814627 X:74577757-74577779 CTCCATGATGGCAGGGGTCTTGG + Intergenic
1192896400 X:75447052-75447074 GGCCATGGTGGCAGGGATGGAGG + Intronic
1193231384 X:79050856-79050878 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1193297891 X:79853488-79853510 GGCCATGGTGGCAAGGATGGAGG + Intergenic
1193833067 X:86310938-86310960 GGCCATGGTGGCAGGGATGGAGG + Intronic
1194174735 X:90631666-90631688 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1194210388 X:91063182-91063204 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1194220061 X:91178612-91178634 CTGCATTGTGGCACAGATGCTGG - Intergenic
1194343427 X:92731917-92731939 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1194453996 X:94080009-94080031 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1194604261 X:95961021-95961043 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1194834065 X:98659631-98659653 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1195748813 X:108144530-108144552 GGCCATGGTGGCAGGGATGGAGG - Intronic
1195809674 X:108816017-108816039 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1197371939 X:125637034-125637056 GGCCATGGTGGCAGGGATGCAGG - Intergenic
1197386662 X:125811411-125811433 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1197405161 X:126039773-126039795 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1197477248 X:126940600-126940622 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1197591991 X:128420217-128420239 AGCCATGGTGGCAGGGATGGAGG + Intergenic
1198701420 X:139401129-139401151 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1198782921 X:140256979-140257001 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1199144345 X:144348145-144348167 GACCATGGTGGCAAGGATGCAGG - Intergenic
1199229919 X:145424736-145424758 CTAGATGTTGGCTCGGATGTGGG + Intergenic
1199310310 X:146313570-146313592 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1200521381 Y:4212855-4212877 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1200556572 Y:4642372-4642394 CTGCATTGTGGCACAGATGCTGG - Intergenic
1200651781 Y:5848582-5848604 GGCCATGGTGGCAGGGATGGAGG + Intergenic
1201193603 Y:11470587-11470609 GGCCATGGTGGCAGGGATGGAGG - Intergenic
1201529547 Y:14977077-14977099 GGCCATGGTGGCAGGGATGGAGG - Intergenic