ID: 1091837520

View in Genome Browser
Species Human (GRCh38)
Location 12:3596088-3596110
Sequence GTCCATGGAGGGCCTGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091837520_1091837524 -10 Left 1091837520 12:3596088-3596110 CCTTAGCCAGGCCCTCCATGGAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1091837524 12:3596101-3596123 CTCCATGGACCCATCTCCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091837520 Original CRISPR GTCCATGGAGGGCCTGGCTA AGG (reversed) Intergenic
900712484 1:4123108-4123130 CTGCATGGAGGTCCAGGCTAGGG - Intergenic
901177389 1:7314364-7314386 GTCCAGGGAGGGCCTTGCAATGG + Intronic
901452770 1:9345953-9345975 GGCCATGGAGCCCCTGGCAAAGG - Intronic
901764476 1:11491132-11491154 GTCCCTGGAGGTCCGGGGTATGG - Intronic
904128445 1:28259131-28259153 GTTCCTGGAGGGACTGGCTAGGG - Intergenic
905366560 1:37454791-37454813 GTCCATAGAAGGCCTGCATAGGG + Intergenic
905650120 1:39650695-39650717 GTCAATGGAAGGCTTGCCTAGGG - Intergenic
908805237 1:67923636-67923658 GTTCATGGAGACCCTGGCTAAGG - Intergenic
912261192 1:108112776-108112798 GTCCATGGAGGACCAGGCTGGGG - Intergenic
914411802 1:147436416-147436438 ATCCATGAAAGGCCTGGCTGCGG - Intergenic
914804267 1:150981374-150981396 CTCCCTGGAGAGCCTGGGTAGGG - Intergenic
914930809 1:151931213-151931235 GTTCATGGGGACCCTGGCTAAGG - Intergenic
915290222 1:154878521-154878543 GTCCAGGGAGGGGCTGGCTCAGG - Intergenic
916804209 1:168243041-168243063 GCCCCTGGAGAGCCTGGCCATGG + Exonic
918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG + Exonic
921112876 1:212055764-212055786 GTGCATGCAGGTGCTGGCTATGG - Intronic
922583039 1:226712620-226712642 GTCCAGGGAGTGCAGGGCTAGGG - Intronic
923788383 1:237090240-237090262 ATCCATGGAGGGCCCTGATATGG - Intronic
924740102 1:246789949-246789971 GTGGAGGGAGGGCCTGGCTCTGG - Intergenic
1067448431 10:46367075-46367097 GGCCGTGGTGGGCCTGGCTCTGG + Intergenic
1067588944 10:47493691-47493713 GGCCATGGTGGGCCTGGCTCTGG - Intergenic
1067636070 10:48001782-48001804 GGCCGTGGTGGGCCTGGCTCTGG - Intergenic
1069728463 10:70596213-70596235 GGCCAGGGCGGGCCTGGCTCAGG - Intergenic
1070830400 10:79414749-79414771 ATCCAGGGTGGGCCTGGCCAAGG - Intronic
1076035480 10:127196023-127196045 GTCGATGCAGCGCCTGGCTCGGG + Exonic
1076634091 10:131871703-131871725 GTCCATGCAGGGCCTGCCCTTGG + Intergenic
1077014474 11:393622-393644 CTCCATGGAGGCCCTGGCCCTGG - Intronic
1077046655 11:549695-549717 AGCCCTGGAGGGCCTGGCTTGGG - Intronic
1077460580 11:2707382-2707404 GCCCAGGCAGGGCCTGACTAGGG - Intronic
1077515948 11:3002343-3002365 GTGCAGGGAAGGCCTGGCCAAGG - Intronic
1078170648 11:8926631-8926653 GTCCCTGGAGGACCTGGTGAGGG + Intronic
1083550934 11:63589827-63589849 GGCCAGGGAGGGCTTGGCAATGG + Intronic
1084012758 11:66361848-66361870 GACCAGGCAGGGCCTGGCTCGGG + Intronic
1084462688 11:69304716-69304738 GTCCAAGGAGGGGGTGGCCATGG + Intronic
1084463724 11:69310157-69310179 GCCCATGGAGGACCAGGATAGGG - Intronic
1087845016 11:102962950-102962972 GGCCAGGGAGGACCTGGCTGAGG + Intergenic
1089964831 11:122647332-122647354 GTCCCTGAAGGGTCTGTCTAAGG - Intergenic
1091837520 12:3596088-3596110 GTCCATGGAGGGCCTGGCTAAGG - Intergenic
1095987685 12:48010528-48010550 GTCCCTGGGGGGCAGGGCTAAGG - Intergenic
1098162302 12:67657330-67657352 GTCCATGGAAGGCATGGGGAAGG + Exonic
1100406903 12:94279776-94279798 GTTCCTGGAGGGCATGTCTAGGG + Exonic
1103195397 12:119039330-119039352 TCTCCTGGAGGGCCTGGCTAGGG + Intronic
1109744296 13:66602039-66602061 ATGCCTGGAGGGCCTAGCTAAGG + Intronic
1112298215 13:98207712-98207734 GTGCATGGAGGGGCTGGGAATGG + Intronic
1113069454 13:106406407-106406429 CTCCATGGAGGGCTTGTCCAAGG - Intergenic
1113586905 13:111472055-111472077 GCCCATGGAGGCCCTGGGTAAGG + Intergenic
1113883890 13:113647267-113647289 GTCCATGGAGAGTCTGGGGAGGG + Intergenic
1113940747 13:114017508-114017530 GTGCTTGGAGGCCCTGGCCATGG + Intronic
1115533373 14:34347017-34347039 GTTCATGGAGATCCTGGCTAGGG - Intronic
1115862085 14:37698730-37698752 GTCCATATGGGGCCTGGCAATGG + Intronic
1119777219 14:77256764-77256786 GTCAGGGGAGGGCCTGGCAAGGG + Exonic
1122342443 14:101037265-101037287 CTCCCTGAGGGGCCTGGCTAGGG - Intergenic
1123004751 14:105315714-105315736 GTCCAAGGAAGGCTGGGCTATGG - Intronic
1202855060 14_GL000225v1_random:44596-44618 CACCATGGAGGGCCTTGCTGTGG + Intergenic
1202857485 14_GL000225v1_random:59886-59908 CACCATGGAGGGCCTGGCGGTGG + Intergenic
1202863933 14_GL000225v1_random:103757-103779 CACCATGGAGGGCCTGGCGGCGG - Intergenic
1202875357 14_GL000225v1_random:202531-202553 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1202877835 14_KI270722v1_random:23755-23777 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1123827774 15:24101118-24101140 GACCATGGAGGGACTGGGCAGGG + Intergenic
1123842228 15:24260527-24260549 GACCATGGAGGGACTGGGCAGGG + Intergenic
1125212046 15:37227932-37227954 TTGCATCGAGGGCCTGGCTGAGG + Intergenic
1129385770 15:75195570-75195592 GTCCAAGGAGGGCTTGGCTCTGG - Intergenic
1131083341 15:89555067-89555089 GTCCCTGGTGGGTCTAGCTAAGG - Intergenic
1131667964 15:94590483-94590505 GTCCATGAAGGTCATGTCTAGGG - Intergenic
1132460888 16:53998-54020 GTTCCAGGAGGGTCTGGCTATGG + Exonic
1133167360 16:3957707-3957729 GTCCTGGGAGGGCAGGGCTAGGG + Intronic
1133769310 16:8858566-8858588 GTACATGGCGGTCCTGGCCAGGG - Intronic
1135656705 16:24256432-24256454 GTCCGTGCAGGGCATGGCTCCGG - Exonic
1137953197 16:52803065-52803087 GTCCATTGAGGAGCTGGCTGTGG - Intergenic
1138173675 16:54876687-54876709 GTCCATGTAGGGACTGTCTGTGG - Intergenic
1138593704 16:58017807-58017829 GCCCTTGGAGGGCCTGGGCAAGG - Intronic
1139938330 16:70587140-70587162 CTCCACCCAGGGCCTGGCTAGGG - Intronic
1140866521 16:79067113-79067135 ATCCTTGGAGGCCCTGTCTAGGG + Intronic
1142100606 16:88269036-88269058 GGCCATGCAGGGCCTGGGTGAGG + Intergenic
1143480931 17:7226986-7227008 ATCCATGGTGGCCCTGGCTGCGG + Intronic
1146901442 17:36592008-36592030 CTCCATGCCGGGCCTGGCCATGG - Exonic
1147977940 17:44258684-44258706 GTTCCTGGAGGCCCTGGCTGTGG - Intronic
1148052701 17:44776956-44776978 GGCCATGGTGAGTCTGGCTAGGG + Exonic
1150323216 17:64233982-64234004 GTCCATGGAGGCCCTGGCGGGGG - Intronic
1150657829 17:67051865-67051887 GGCCATGGAGTGCCTTGCTGGGG - Intronic
1151440544 17:74126152-74126174 GTCCATGGAGTGCCTGGCATGGG + Intergenic
1152460356 17:80439100-80439122 GTCCCTGAAGGGCCTGGCCTGGG + Intergenic
1153419346 18:4886496-4886518 GTCCATGGAGGGCGAGCCAAGGG - Intergenic
1153605063 18:6824854-6824876 CTCCATGGAGGCGCTGTCTACGG - Intronic
1153718936 18:7881654-7881676 GTTCATGGAGCACCTGGCTTAGG + Intronic
1153805730 18:8706748-8706770 GCCCCCGGAGGGCCTGGCTGCGG + Intronic
1155002999 18:21704647-21704669 GGCCATGCAGCGCCTGGCCATGG - Exonic
1158852267 18:61506770-61506792 GTCCATGGAGAGGCAGGCTGGGG + Intronic
1160719379 19:590641-590663 GTCCTTGGAGCGCCTGGGGAGGG + Intronic
1161454712 19:4364174-4364196 GTCCATGAAGCGCCTGGCAGAGG - Exonic
1164795804 19:31027584-31027606 GTCCTGGGAGGGCTTGCCTATGG - Intergenic
1164866509 19:31608766-31608788 GTCCATGGAGGGTCTGCCCCTGG + Intergenic
1165150731 19:33758722-33758744 GCCCCTGGAGGGCCTGTCTCAGG + Intronic
1165755482 19:38290446-38290468 CCCCATGGAGGCCCTGGCTGAGG + Intronic
1202672843 1_KI270710v1_random:9188-9210 GCCCATGGAAGGCCTGCATAGGG - Intergenic
925613805 2:5726045-5726067 ATCCATGGAGACCCTGGCTCCGG + Intergenic
927511816 2:23648684-23648706 GGCCATGGAGGACCTGGCCCCGG - Intronic
935851114 2:107219999-107220021 ATTCATGGAGACCCTGGCTAAGG + Intergenic
936073751 2:109388469-109388491 GTACCTGGGGGGCCTGGCTGGGG - Intronic
936237426 2:110755155-110755177 GTCTAGGGAGGGCCTAGCTCTGG - Intronic
937089760 2:119198390-119198412 GGCCTTGGTGGGGCTGGCTAGGG - Intergenic
938090314 2:128426857-128426879 TTCCATGCAGGGCCTGGCAAGGG + Intergenic
939076656 2:137610360-137610382 ATCCATGGAAGGCATGGCTAGGG + Intronic
940888312 2:159010525-159010547 GTCGGGGGAGGGCCTGGCTGTGG + Intronic
945616013 2:212068057-212068079 GTTCATGGGGAGCCTGGCTGAGG + Intronic
1169210675 20:3764751-3764773 TTGCTTGGAGGGCCTGGCCAAGG + Intronic
1170569419 20:17624623-17624645 GGCCATGGAGGCACTGGCCACGG - Exonic
1170850367 20:19998821-19998843 ATCCAGGGAGGGGCTGCCTAGGG + Intronic
1172647470 20:36479902-36479924 GTCCATGGAGGGCCTGGGATTGG + Intronic
1172887010 20:38238159-38238181 GTCCATGGAAGGCTCTGCTATGG - Intronic
1173546794 20:43903929-43903951 GTCCATGGGGGGCCTGCCCTTGG + Intergenic
1175885518 20:62288311-62288333 GTGGCTGGAGGGCCTGGCTGTGG + Intronic
1175885718 20:62289363-62289385 GGCCAAGGACGCCCTGGCTAGGG + Intronic
1175985831 20:62763810-62763832 GCCCATGGAGGGGCTGAGTAGGG + Intergenic
1176639123 21:9281190-9281212 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1179824634 21:43957265-43957287 GCCCATGGAGAGCCTTGCTCTGG + Intronic
1180071283 21:45436903-45436925 GGCTAGGGAGGGGCTGGCTAGGG + Intronic
1180372430 22:12054033-12054055 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1180390038 22:12221619-12221641 GCCCATGGAAGGCCTGCATAAGG - Intergenic
1180423169 22:12888697-12888719 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1181041629 22:20195139-20195161 GGCCATACAGGGCCTGGCCAGGG - Intergenic
1181643775 22:24219503-24219525 GTCCAGGGGTGGCCTGGCTGAGG + Intergenic
1183933032 22:41246903-41246925 GCCCTTGGAGAGCCTGGCTGAGG - Intronic
1185025163 22:48404797-48404819 GTCCCCGGAGGGCCTGGGTCAGG - Intergenic
1185241601 22:49750201-49750223 GTGCATGGGGGCCCTGGCTGAGG - Intergenic
950565035 3:13764326-13764348 GGGGATGGAGGGCCTGGCTGAGG - Intergenic
951291397 3:20875853-20875875 CACCAAGGATGGCCTGGCTACGG - Intergenic
952957413 3:38565694-38565716 GTCCAAGGAGGGCCTGGGGCAGG - Intronic
953444054 3:42947392-42947414 ATCCCTGGAGGGCCAGGCTGTGG + Intronic
954447365 3:50553880-50553902 GTCAATGGAGGGCCAGGGGAGGG + Intergenic
954649203 3:52149971-52149993 GTCCATGGAGCCACTGGCTGAGG + Exonic
954684876 3:52365040-52365062 GTTCGTGGAGGGGCTGGCCATGG + Intronic
955921694 3:63963741-63963763 GTCCATAGAGGGCCTGGCAGAGG - Intronic
956600468 3:71015610-71015632 GTCCATAGAGAGGATGGCTATGG + Exonic
956816899 3:72915908-72915930 GTCCATGGAGGACTTGGGAAAGG + Intronic
957101081 3:75829627-75829649 GCCCATGGAAGGCCTGCATAGGG - Intergenic
958962733 3:100525583-100525605 GCCCATGGAAGGCCTCGCTGAGG + Intronic
961344541 3:126255306-126255328 GTTCATGGGGACCCTGGCTAAGG + Intergenic
961454007 3:127015409-127015431 GGCTATGGAGAGCCTGGCTGGGG + Intronic
966071927 3:175888595-175888617 GTTCATGGGGACCCTGGCTAGGG + Intergenic
966686380 3:182700122-182700144 GTTCATGGGGACCCTGGCTAAGG - Intergenic
1202747772 3_GL000221v1_random:123829-123851 GCCCATGGAAGGCCTGCATAGGG - Intergenic
968652453 4:1765661-1765683 GCCCATGGCGGGCCTGGGTGTGG + Intergenic
969613636 4:8240281-8240303 GCCCATGGAGGGCCTGGAAATGG + Intronic
969877296 4:10145232-10145254 GCCCTTGGAGGGACTGACTAAGG + Intergenic
970679144 4:18487429-18487451 GTCCATGGGGGGCCATGATAAGG - Intergenic
970984096 4:22135420-22135442 GTCCATGGAAGGCAAGGCTACGG + Intergenic
978817912 4:112930369-112930391 GTCCAGGGAGGTCAAGGCTATGG + Intronic
983312360 4:166081001-166081023 GAACATGCAGGGCCTGCCTAAGG - Intronic
984863300 4:184258394-184258416 TTCCATGAAGGGCCTGGGAAAGG + Intergenic
1202754020 4_GL000008v2_random:39603-39625 GCCCATGGAAGGCCTGCATATGG + Intergenic
985680363 5:1252832-1252854 GATGATGGAGGGCCTGGCCAGGG - Intergenic
985837669 5:2282437-2282459 GCCCAAGGAGGGCCTGGGTCAGG - Intergenic
986171481 5:5318169-5318191 GTCCGTGCAGTGCCTGGCTGGGG + Exonic
994693258 5:103044113-103044135 GTTCATGGAGACCCTGGCTAAGG - Intergenic
995092446 5:108194117-108194139 GACAATGGAGGGCCTTGATAGGG - Intronic
998132489 5:139658493-139658515 CTCCAGAGAGGGGCTGGCTAGGG - Intronic
999326625 5:150648210-150648232 TGCCGTGGAGGGCCTGGCTCCGG - Exonic
999504364 5:152179826-152179848 GTCCATGAAGGAGCTGCCTAAGG - Intergenic
999868467 5:155727582-155727604 GCCCAGGGAGAGCCTGCCTAAGG + Intergenic
1000243075 5:159426568-159426590 CTACATGGGTGGCCTGGCTAGGG - Intergenic
1001424357 5:171613753-171613775 ATCCATGCAGTGCCTGGCCATGG - Intergenic
1001536085 5:172498814-172498836 GTCCCTCCAGGGCCTGGCTCAGG + Intergenic
1002061739 5:176629624-176629646 GTTCATGAAGGGCCTGTCCATGG - Exonic
1003137635 6:3445614-3445636 GTCCAGTGAGGGCTTGGATAAGG + Intronic
1005964275 6:30716004-30716026 GATCATGGAGGGTCTCGCTAAGG - Intronic
1006320186 6:33315478-33315500 GTCCCTGGAGGGACTGGCAGTGG - Exonic
1007087294 6:39157749-39157771 GTCACTGGAGGCTCTGGCTAGGG + Intergenic
1007292412 6:40797520-40797542 GTCCAGGGAAGGCCTGTCTGAGG - Intergenic
1007904975 6:45450633-45450655 GTCCAAGGAAGGCCTGTCTGGGG + Intronic
1011177562 6:84581601-84581623 TTCAAGAGAGGGCCTGGCTATGG - Intergenic
1013412592 6:109894826-109894848 GTTCATGGGGACCCTGGCTAAGG + Intergenic
1013484855 6:110587114-110587136 GTGCATGGGAGCCCTGGCTAAGG + Intergenic
1013533623 6:111042812-111042834 GTTCATGGGGACCCTGGCTAAGG - Intergenic
1018433824 6:163743973-163743995 GGCCATGGCTGGCCTGGCTTTGG - Intergenic
1019786783 7:2982254-2982276 CTCCATGGCGGCCCTGGCTGGGG - Intronic
1022090701 7:27106358-27106380 GTCCAGGGAAGGGCTGGCTCAGG + Exonic
1022965261 7:35466266-35466288 GTTCATGGCGGGCCTGGCCGGGG - Intergenic
1023852660 7:44158909-44158931 GGCCTTGGGGGTCCTGGCTAGGG - Intronic
1025158907 7:56636041-56636063 GTCCCTGGAGGCTCTGGCCAGGG - Intergenic
1029706894 7:102280873-102280895 GTCCAGGGAGGGGGTGGGTAGGG - Intronic
1031568647 7:123330522-123330544 GTGCATGTAGGTCCCGGCTATGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034234806 7:149558333-149558355 GAGCATGGAGGGAGTGGCTAGGG - Intergenic
1036008316 8:4692441-4692463 GTCCTTGAAGCTCCTGGCTATGG + Intronic
1044422245 8:92010543-92010565 GTCCAAGGTGTGCCTGGCTGAGG - Intronic
1049331956 8:142059369-142059391 GACCTTGGAGGCCCTGGCTCAGG - Intergenic
1053504488 9:38629921-38629943 GTCCCTGGAGGGAGGGGCTATGG - Intergenic
1058677174 9:107410202-107410224 GTCCAGGGAGAGGCTGGCTGGGG + Intergenic
1060044626 9:120330037-120330059 CTCCATGGTGGGCCTTGCAAGGG - Intergenic
1060188820 9:121579532-121579554 GTCCAGGTAGGGGCTGGCAAAGG - Intronic
1060722520 9:125988538-125988560 GTGCCTGGAGAGGCTGGCTAGGG - Intergenic
1061603802 9:131692980-131693002 GTTCATGGGGACCCTGGCTAAGG + Intronic
1062398171 9:136360932-136360954 CTCCATGGAGGCACTGGCTGGGG - Intronic
1203740386 Un_GL000216v2:172259-172281 CACCATGGAGGGCCTGGCGGCGG + Intergenic
1203716407 Un_KI270742v1:153910-153932 GCCCATGGAAGGCCTGCATAGGG - Intergenic
1203534808 Un_KI270743v1:24329-24351 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1185673959 X:1833511-1833533 ATCCATGGAGGCCATGGCAAAGG - Intergenic
1186283220 X:8016925-8016947 GTCCAAGGTTGGCCTGGCTGGGG - Intergenic
1191643855 X:63457433-63457455 GTTCATGGGGACCCTGGCTAGGG - Intergenic
1191684857 X:63879363-63879385 GTGCATGTAGGCACTGGCTATGG - Intergenic
1194626432 X:96231600-96231622 GTCCATCAAGGGCCTGGAAATGG + Intergenic
1195710401 X:107768631-107768653 GTCCATGGAAGGCCTAGCTTGGG - Intronic