ID: 1091838346

View in Genome Browser
Species Human (GRCh38)
Location 12:3601799-3601821
Sequence CTCTGTGAGGGGAGAAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 1, 2: 3, 3: 37, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091838338_1091838346 2 Left 1091838338 12:3601774-3601796 CCTCTGGCAATGTGGTTTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG 0: 1
1: 1
2: 3
3: 37
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091838346 Original CRISPR CTCTGTGAGGGGAGAAGAGT GGG Intergenic
900649789 1:3725222-3725244 CTGTGTCAGGGGAGAAGGTTGGG + Intronic
901624055 1:10613566-10613588 CTCTGTGAAGGCTGAAGAGACGG - Intronic
902337277 1:15760802-15760824 CTCTCTGGGGGAGGAAGAGTGGG + Intronic
902693866 1:18127279-18127301 CTATGTGAGGGGAGTACAGCAGG + Intronic
902694011 1:18128252-18128274 CTCTGTGAGGGGAGTAAAGCAGG + Intronic
903080816 1:20810862-20810884 CACTCTGAAGGTAGAAGAGTCGG + Exonic
903212386 1:21825596-21825618 CTCTGGCAGGGGACAAGAGTAGG + Intronic
903579019 1:24357350-24357372 CTCTGGGAGGGGAGCTGGGTGGG - Exonic
903774504 1:25783933-25783955 CTCTGTGAGGAGACAAGACTTGG + Exonic
903795060 1:25922691-25922713 CTCTGTGCTAGGAGAAGAGAAGG + Intergenic
904537400 1:31208935-31208957 CCCTGGGAGGTGAGAAGGGTAGG - Intronic
904633332 1:31860129-31860151 GTCTGTGAGGGTGGAAGAGACGG - Intergenic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905644232 1:39613595-39613617 CTGCGTGAGGGGAGAAGAAAAGG + Intergenic
905880216 1:41458178-41458200 CTCTGCGATGGGAGAGGAGGAGG + Intergenic
906542677 1:46599973-46599995 TTGTGGGAGGGGAGAGGAGTTGG - Intronic
906637591 1:47419437-47419459 CTCTTTGAGGGGAGGGCAGTAGG + Intergenic
907547731 1:55276923-55276945 CTCAGAGAGTGGGGAAGAGTGGG + Intergenic
907834648 1:58097532-58097554 CCCTGAGGGGGAAGAAGAGTTGG + Intronic
908999933 1:70205896-70205918 CTAGGAGAGGGGAGAAGAGAGGG - Intronic
909532591 1:76698496-76698518 CTCAGGAAGGTGAGAAGAGTAGG + Intergenic
910857492 1:91710261-91710283 CTTTTTGAGGGGGTAAGAGTAGG - Intronic
911084942 1:93968537-93968559 CTCTGAGAGGGAAGAAGAGCTGG - Intergenic
911484561 1:98489224-98489246 CTCAATGTGGGGAGAAGAGTGGG - Intergenic
912596070 1:110877661-110877683 CGCTGTTAGGGGAGAGGATTTGG - Intronic
912741007 1:112197394-112197416 CACACTGAGGGTAGAAGAGTTGG - Intergenic
913491217 1:119381653-119381675 TTGAGTCAGGGGAGAAGAGTTGG + Intronic
914343063 1:146776574-146776596 TTCTGTGAGGGGAACAGAGACGG - Intergenic
915117819 1:153611350-153611372 GTCTGTGGGGTGAGAAGAGAAGG - Intronic
915958776 1:160246260-160246282 CTCTGGGAGTGGATAATAGTGGG - Intronic
916795812 1:168166163-168166185 CACTCTGAGGAGAGAAGAGCTGG - Intergenic
917921632 1:179755518-179755540 CTCAGTGAGTGGAGAAGAGTTGG + Intronic
920225941 1:204439070-204439092 CCCTGTGAGGGGAGAAATGGGGG + Exonic
920675771 1:208037666-208037688 CCATGGGAGGGGAGAAGAGGCGG + Intronic
920846276 1:209595549-209595571 CTCTGTCAGGAGAGGGGAGTTGG + Intronic
920975826 1:210784210-210784232 CTCTCACATGGGAGAAGAGTAGG + Intronic
922855163 1:228768954-228768976 CTTTATGAGGGGAGTACAGTAGG - Intergenic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG + Intronic
923571903 1:235123593-235123615 CTCTATTATGGGAGACGAGTGGG - Intronic
923843084 1:237695997-237696019 CTCTGGGATGTAAGAAGAGTAGG - Intronic
924821153 1:247491847-247491869 CACTGTGAGGTGAGAAGAGCAGG - Intergenic
1062821413 10:537107-537129 CTCTGTGGGGGAAGAAGTGAGGG + Intronic
1062843165 10:686625-686647 CTCTCTGTGGGGAGAAGTGCTGG - Intronic
1063158891 10:3404841-3404863 CTCTGTGTGCTGAGAAAAGTGGG - Intergenic
1063333703 10:5188305-5188327 CACTGTGAAGGGAAAAAAGTAGG + Intergenic
1063434386 10:6018641-6018663 CTCTGCCAGGGGTCAAGAGTGGG - Intronic
1063970889 10:11380549-11380571 CTCGGGGAGGGGAGAAGGGCTGG + Intergenic
1064152216 10:12874591-12874613 CTCTGCAAAGGGAGAAGAGAAGG - Intergenic
1065029127 10:21567514-21567536 CTGTGTCAGTGGAGAAAAGTAGG - Intronic
1065758005 10:28951986-28952008 ATCTGTCAGGCTAGAAGAGTAGG + Intergenic
1066325888 10:34357705-34357727 ATCTCAGAGTGGAGAAGAGTGGG - Intronic
1067207971 10:44235764-44235786 CTCTGTGAGGGGATAGGGCTGGG + Intergenic
1067251497 10:44590458-44590480 CTCTGTGTGGGATGAAGAGCTGG - Intergenic
1070741400 10:78905630-78905652 CTCTGTGAAGGAGGCAGAGTGGG + Intergenic
1070767152 10:79063363-79063385 CTCGGTGGGGGGACAAGAGGGGG - Intergenic
1070844811 10:79513344-79513366 TAGTGTGAGGGGAGAAGAGGAGG - Exonic
1070928993 10:80246967-80246989 TAGTGTGAGGGGAGAAGAGGAGG + Intergenic
1071415957 10:85441614-85441636 CTTTGTGTGGGGAGAAGGATGGG - Intergenic
1073033921 10:100549710-100549732 CTCTGGAAGGGAAGAGGAGTTGG + Exonic
1073215527 10:101834081-101834103 ATCTGGGAGGGGTGAAGAGGAGG - Intronic
1073478844 10:103772766-103772788 CTCTGGGAGGGGCGAGGAGCCGG - Intronic
1074188734 10:111117672-111117694 CCCAGAGAGGGGAGCAGAGTGGG + Intergenic
1074291928 10:112144108-112144130 CACTGTGAGGGGCTAAGACTTGG - Intergenic
1074897731 10:117791611-117791633 CTCTGTGTGGGCAGGAAAGTGGG - Intergenic
1076796012 10:132798851-132798873 CTCTGTGGCGGGAGAAGGGGAGG + Intergenic
1076823204 10:132952294-132952316 CTCCAAGAGTGGAGAAGAGTGGG - Intergenic
1077010645 11:377742-377764 CACTGCGAGGGGAGAGGAGGAGG - Intronic
1077157982 11:1099864-1099886 CTCCGTGAGAGGGGAAGAGGTGG - Intergenic
1078459283 11:11501059-11501081 CTCTGTGAGTGGAAACGAGAGGG - Intronic
1079794665 11:24785794-24785816 ATCTGTGAAAGGAGAAGTGTGGG - Intronic
1080685705 11:34513280-34513302 TTCAGTCAGGGGAGAAGGGTAGG + Intronic
1080793402 11:35541038-35541060 GTCCCTGAGGGCAGAAGAGTGGG + Intergenic
1081734525 11:45393840-45393862 TTCTGCGAGGGGACAACAGTGGG + Intergenic
1081973176 11:47214218-47214240 CTCTGTGAAGGGAGAATGATTGG - Intergenic
1083433872 11:62629685-62629707 CTGGGTGAGGAGAGAAGAGACGG + Intronic
1083864551 11:65446455-65446477 CTCTGTGGGGTCAGAAGAGATGG - Intergenic
1084004332 11:66315154-66315176 CTCTGAGAGGGCAGGAGGGTGGG + Exonic
1084024288 11:66438258-66438280 CTCTGTGAGGGAAGCAGAGGGGG + Exonic
1086139413 11:83478394-83478416 CTATGAGAAGAGAGAAGAGTTGG - Intronic
1086750923 11:90492401-90492423 CTTAGTGAGGGGAGAGGAATTGG - Intergenic
1086945693 11:92841914-92841936 ATATGGGAGGGGTGAAGAGTTGG - Intronic
1090226181 11:125073456-125073478 CTCTGTTAGGGGAGCCGAGTAGG - Intronic
1090254055 11:125270835-125270857 CTGAGTCAGGGGAGAAGAGCAGG - Intronic
1090416229 11:126542361-126542383 CTTTGTTAGTGGAGAAGAGCAGG + Intronic
1090979296 11:131703571-131703593 TTCTGTGAGGAGACAAGAGCTGG - Intronic
1091077305 11:132632392-132632414 CTCTGTGACACGAGAAGAGGAGG + Intronic
1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG + Intergenic
1092290689 12:7158084-7158106 CTCTGCGTGGGGAGAGGTGTAGG - Exonic
1092570425 12:9715592-9715614 CTCTGTGTGGGAAGAAGTATTGG + Intergenic
1096672081 12:53206055-53206077 CCCTTTAAGGGGAGATGAGTGGG - Intronic
1096770159 12:53930492-53930514 ACCTGTGAGGGGAGAAGAAAGGG + Intergenic
1096778182 12:53976342-53976364 CTCTGGGAAGGGAGCAGGGTGGG - Exonic
1096878480 12:54648442-54648464 CTCTGAGGTGGGAGAAGAGGAGG - Exonic
1097172211 12:57122464-57122486 TTCTGTGAGGGGATGAGAGGCGG - Intronic
1100246053 12:92757957-92757979 CACGGTGAGGTGAGAAGACTCGG + Intronic
1100333121 12:93604158-93604180 ATCTATGAGTGCAGAAGAGTAGG - Intergenic
1101524153 12:105512376-105512398 CTCTGTGAGGGGAACAGATGGGG + Intergenic
1101536182 12:105618820-105618842 CTGTGTGGGGGGACAGGAGTGGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102200947 12:111057359-111057381 CTATGTGAGTGGAGTGGAGTGGG + Intronic
1102360030 12:112277710-112277732 CTGTGTGATGTGAGAAGAGATGG - Intronic
1102497721 12:113330927-113330949 GTCTGTAAGGGGAGAAGAGGAGG - Intronic
1103121456 12:118383097-118383119 CTCTGTAAGGGGAGGAGAGTAGG - Intronic
1103678108 12:122672612-122672634 CTCTGGGAGGGGAGAGGGGCTGG - Intergenic
1105573059 13:21622390-21622412 CTTTATGAAGGGAGAAGAGATGG + Intergenic
1106433752 13:29706167-29706189 CTGTGTGTGGGGAGAAGGGGAGG + Intergenic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1110780042 13:79454832-79454854 CTCTTTGAGGAGGGAAGGGTAGG + Intergenic
1111661487 13:91217804-91217826 CTCTGTTAGGGGAAAGGAGTTGG - Intergenic
1111781497 13:92731960-92731982 TTGTGTGAGGGGAGTAGAGATGG + Intronic
1112421328 13:99252057-99252079 CTCTGAAAGGAAAGAAGAGTTGG - Intronic
1113039043 13:106084501-106084523 ATCTGTGAGTGGTGACGAGTAGG + Intergenic
1114805953 14:25837037-25837059 CTATGTGAGGGGAGAAATGGTGG + Intergenic
1116341116 14:43724348-43724370 CTCTGTGATAGGAGAAAAATTGG + Intergenic
1116728727 14:48595454-48595476 CTCTGTGAGGAGAGAACAACAGG - Intergenic
1116868714 14:50051988-50052010 CTCTCTGAAAGGAGAAGAGACGG - Intergenic
1117826238 14:59706518-59706540 GTCTGTGACTGGAGAAGTGTAGG - Intronic
1119776873 14:77254414-77254436 CTCTGAGAGGGGACAGGAGTAGG + Intronic
1121032076 14:90666796-90666818 CACAGTGAGAGGAGTAGAGTGGG + Intronic
1121174932 14:91883915-91883937 CTCTGTGTGTGATGAAGAGTTGG - Intronic
1121227769 14:92333942-92333964 CCCTGTGCGGGGAGCAGAGGTGG + Intronic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1123981651 15:25610225-25610247 CTCTGTGTGGAGGGAACAGTGGG - Intergenic
1124178398 15:27449019-27449041 CTCCAAGAGGGGAGTAGAGTGGG + Intronic
1124587923 15:31026272-31026294 CTGTGTGAAGGGAGAAGTGTCGG + Intronic
1124687566 15:31795543-31795565 TTCTGGGAGGTGAGAACAGTGGG + Intronic
1125936251 15:43638861-43638883 CTGGGTGAGGGGAGAAAATTTGG - Intronic
1125949026 15:43735386-43735408 CTGAGTGAGGGGAGAAAATTTGG - Intergenic
1126600736 15:50424619-50424641 CTCTGTCCGCGGAGAGGAGTGGG + Exonic
1126921498 15:53530917-53530939 ATCAGTGTGGGGAGAATAGTTGG + Intronic
1127314747 15:57784359-57784381 GAGTGTGAGGGGAGAAGAGAAGG + Intergenic
1128258252 15:66213967-66213989 CTCAGGGAGAGGAGAAGGGTTGG - Intronic
1128258359 15:66214551-66214573 CTCTGGGAGGAGAGAAGTGGTGG + Intronic
1128370570 15:67036215-67036237 CTCTTTGAGGTGAGCAGAGAAGG + Intergenic
1128456087 15:67832253-67832275 CTCTGTGAAAGGGGAAAAGTGGG - Exonic
1128767593 15:70260664-70260686 CACTGTGAGGGAAGGAGATTAGG + Intergenic
1128774576 15:70309802-70309824 TTCAGTGAGGGGAAAGGAGTTGG + Intergenic
1129001809 15:72341660-72341682 CTAGGTGAAGGGAGATGAGTTGG + Exonic
1129100504 15:73257988-73258010 CCGTGGTAGGGGAGAAGAGTTGG - Intronic
1129593281 15:76936882-76936904 CTCTGTAAGATGAAAAGAGTCGG - Intronic
1129858417 15:78841499-78841521 CTCTGTGCGGGGAGTAGGGGAGG + Intronic
1130190271 15:81728061-81728083 CTCTTTGCGGAGGGAAGAGTTGG - Intergenic
1130594452 15:85240177-85240199 CTCTGGGAGAGGAGAAGGGCTGG - Intergenic
1131278419 15:91001618-91001640 CTGTGGGTGGGGAGAAGGGTGGG - Intronic
1131386800 15:92014763-92014785 CTCTGTGGAGGGAGAAGGGTGGG + Intronic
1131521515 15:93119592-93119614 CTCTGAGAGGGGAGCAGAGATGG + Intergenic
1131760872 15:95621224-95621246 CTCTGTGGTGGGAGAAGGATGGG - Intergenic
1131769169 15:95716267-95716289 GTTTGTGAGGGGAGCAGAGGAGG - Intergenic
1132850436 16:2022633-2022655 CTCTGTGCTGGGTGAAGAGGTGG + Intergenic
1133222459 16:4324587-4324609 CGCTGTGAGGGCAGCTGAGTGGG - Intronic
1134330422 16:13245829-13245851 CTCTGGGAGGGGTGAAGAAATGG - Intergenic
1135189239 16:20341335-20341357 CACTGCCAGGGGAGAAGGGTTGG + Exonic
1136136672 16:28260466-28260488 CCCTGGGTGGGGAGAAGGGTAGG + Intergenic
1137330260 16:47487592-47487614 CTCTTTGAGGGTGGAAGGGTAGG - Intronic
1138344554 16:56311976-56311998 CTCTGGGAGCTGAGAAGAGCAGG + Intronic
1139990926 16:70938754-70938776 TTCTGTGAGGGGAACAGAGACGG + Exonic
1140473472 16:75227293-75227315 CTCTGGGAGAGGAGGTGAGTGGG + Intergenic
1140600832 16:76472989-76473011 CTCCGTGAGGGGGGCAGAGGGGG + Intronic
1140930478 16:79623103-79623125 CTGTGGGAGGGGACAAGAGGTGG - Intergenic
1141403568 16:83772044-83772066 CTCTGTGGGTGGAGAAGGATGGG + Intronic
1142285646 16:89170523-89170545 CTCTGTGATGGGAGCAGACCCGG - Intergenic
1142807620 17:2379768-2379790 GTGTGAGAGGGGAGCAGAGTAGG - Exonic
1143319784 17:6060684-6060706 CTCTGAGGGGTGAGAAGACTTGG + Intronic
1143495799 17:7312040-7312062 TAGTGTGAGGGGAGAAGAGGAGG - Exonic
1143551498 17:7633043-7633065 CTCTGGGAGGGAAGAAGAATAGG + Intronic
1143901247 17:10176365-10176387 CGCTGTGCAGGGAGGAGAGTGGG - Intronic
1144025187 17:11271132-11271154 CTATGTGAGGGGTGAAGGGTGGG + Intronic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1146075078 17:29720910-29720932 TTCTGTAAGGGGAAAAGACTAGG - Intronic
1147378315 17:40036125-40036147 GGCTGTGAGGACAGAAGAGTAGG + Exonic
1147462541 17:40582618-40582640 CTCTCTGAGGGGAGAAGTGGGGG + Intergenic
1148122124 17:45219467-45219489 TTCTGTGAGAGGAAAAGAGAAGG - Intergenic
1148353605 17:46958841-46958863 GTCTGGGAGGGGAGCAGAGCAGG - Intronic
1148733570 17:49851959-49851981 CTCTGGGAGGGGAAACGAGGTGG - Intergenic
1149696597 17:58621163-58621185 AGCTGTGATGGGAGAAGAGGGGG + Intronic
1150004210 17:61459844-61459866 GTCTGTGAGGGGTGAGGGGTTGG - Intronic
1151478118 17:74355114-74355136 CTGGGTGATGGGAGAGGAGTTGG + Intronic
1151543806 17:74779567-74779589 CTCTGTAAGACCAGAAGAGTTGG + Intronic
1151767088 17:76138220-76138242 CTCTGGCAGGGGAGAGGAGGGGG + Intronic
1152459488 17:80433688-80433710 CTCTGTGAGGGGGGCAGAGATGG + Intronic
1152975494 18:213494-213516 CTTTGAGAAGGGAGAGGAGTAGG + Exonic
1154312003 18:13274055-13274077 CTCGCTGAGGAGAGAAGAGAAGG - Intronic
1155371280 18:25103734-25103756 CTCTGTGATGGGAAGAGAGAAGG + Intronic
1156739375 18:40305251-40305273 CTCTGTTAGGGAGGAGGAGTGGG + Intergenic
1157221896 18:45834240-45834262 CTATGTGAGGACAGAAGGGTGGG - Intronic
1157235483 18:45961376-45961398 GTGAGTGAGGGGAGAACAGTAGG - Intronic
1157325876 18:46668667-46668689 CTCTCTGATGGGAGGCGAGTCGG + Intronic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159275842 18:66220410-66220432 CTGTTTTAGGGGAGGAGAGTGGG + Intergenic
1160280593 18:77486212-77486234 CTCTGTGAGGGCAGATGAGCTGG + Intergenic
1160956021 19:1692036-1692058 CTCTGTGTGTGGAGACGGGTGGG + Intergenic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161726363 19:5931532-5931554 CTGTGGGAGGGAAGGAGAGTGGG + Intronic
1161810366 19:6467879-6467901 CTCTGTGAGAGGAGAGGGTTTGG + Exonic
1162098487 19:8325010-8325032 CTCTGTGAGGCAGGAAGAGGAGG - Exonic
1162292831 19:9792313-9792335 CTCAGTGAGGGGAGAGAAGAGGG - Intronic
1162292893 19:9792523-9792545 CTCGGTGAGGGGAGAGAAGAGGG - Intronic
1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG + Intronic
1163002110 19:14375110-14375132 CTCTGGGAGGGGCCAAGACTGGG + Intergenic
1163586881 19:18169066-18169088 CTCTGTGGGGGCAGACGAGAGGG - Exonic
1163787210 19:19280974-19280996 CTCTGGGAAGGGAAAAGATTTGG + Intronic
1164589459 19:29498379-29498401 CTCTGTGAGGTCAGAACAGCAGG + Intergenic
1164834499 19:31349069-31349091 CTCAGTGCGGGCAGAAGAGCGGG + Intronic
1165193753 19:34085331-34085353 CTCACTGTGGGGAGAACAGTGGG - Intergenic
1166708986 19:44925259-44925281 CTCAGTGAGGGGCAAAGAGGGGG - Intergenic
1166840807 19:45695815-45695837 CTCTGTGCGTGGAGTAGAGTGGG - Intronic
1166893077 19:46006538-46006560 CTCTGTCAGGAGAGGAGAGGAGG - Exonic
1167000481 19:46743169-46743191 CTCTCTCAGGAGAGAAGAGCAGG + Intronic
1167909303 19:52689323-52689345 CGCTGAGATGGGAGAAGAGGCGG - Intronic
1168363193 19:55760416-55760438 CACTGTTAGGAGAGAAGTGTGGG + Intronic
1168364142 19:55770417-55770439 CACTGTTAGGAGAGAAGTGTGGG + Intronic
1168666672 19:58209790-58209812 TGCTGTGAGGGGAGCAGAGCTGG + Intronic
925749884 2:7078529-7078551 CCCAGGGAGGGGAGGAGAGTAGG - Intergenic
925881698 2:8358083-8358105 CTCTAGGAGGGAAGAGGAGTAGG + Intergenic
926342300 2:11913770-11913792 CCCTGTGAGAAGAGAAGATTAGG - Intergenic
926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG + Intergenic
926389229 2:12370496-12370518 CTGTGGGAGGAGAGAAGAGGAGG - Intergenic
926731380 2:16038280-16038302 CTCTGTCAGGGGAGGAGGGAGGG + Intergenic
927521839 2:23703698-23703720 GTCTGTGAGGAGAGCAGAGCAGG - Exonic
927697077 2:25246063-25246085 CTCTGCAAGGGGAGGAGAGCTGG + Exonic
928116049 2:28545834-28545856 CTCTGTGTGGGGAGCAGAGAGGG + Intronic
928379383 2:30804519-30804541 CTCTCTGAGGAGGGAAGAGTAGG + Intronic
929825539 2:45306816-45306838 CCCAGGGAGGGGAGAGGAGTTGG - Intergenic
930310349 2:49732160-49732182 CTCTGTGAGGGCAGTACAGAAGG - Intergenic
931424252 2:62156739-62156761 CTCTGTGAAAGGAGCAGAATTGG - Intergenic
931836318 2:66101835-66101857 TTTTTTGAGGGGAGATGAGTAGG - Intergenic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
933136636 2:78743571-78743593 CTGTGTTTGGGGAGCAGAGTTGG - Intergenic
933739933 2:85525365-85525387 CACTGGGAGGGGAGAAGGGCAGG + Intergenic
933746817 2:85577721-85577743 CTGTGTCGGGGGAGGAGAGTTGG + Intronic
934768742 2:96894837-96894859 GTCTGTGTGGGGGGATGAGTGGG - Intronic
936031283 2:109072744-109072766 CTCTGTGAGGAGAGATGAAATGG + Intergenic
937210411 2:120265619-120265641 CTCTATGAGTGGATTAGAGTGGG - Intronic
937786413 2:125904579-125904601 CTCTACGAGGAGAGAAGAGGAGG + Intergenic
938320445 2:130359055-130359077 CTCTGGGAGGAGAGCACAGTGGG - Intronic
939018922 2:136935782-136935804 CTCTGTGAAGGGGGGACAGTTGG + Intronic
939464895 2:142544541-142544563 ATCTCTGAGGGGAGCAGAGGAGG - Intergenic
939659296 2:144868438-144868460 CCCTGTGAATGGAGAAGACTAGG - Intergenic
940501144 2:154495081-154495103 CTCAGTTAGGGGAGAGGTGTTGG - Intergenic
940630313 2:156229990-156230012 CTCTGTGAGGGATGAGGAGGTGG - Intergenic
940916450 2:159261660-159261682 CCCTGTGAGGGGACAAGCATGGG - Intronic
942539236 2:176998216-176998238 CTGTGCTAGGGCAGAAGAGTGGG - Intergenic
944572589 2:201059569-201059591 CTCTGTGAGGGGAAAGGAAAGGG - Intronic
944682672 2:202091210-202091232 GTCTCTGAGTGGAGAAGATTGGG - Intronic
946196219 2:218034217-218034239 CTCAGGGAGGGGAGAAGGGAGGG + Intergenic
946355999 2:219185326-219185348 CAGGCTGAGGGGAGAAGAGTTGG + Exonic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
947320753 2:228915593-228915615 CTATGAGAGGTGATAAGAGTGGG - Intronic
948234614 2:236379108-236379130 CTCTCTGCGGGGGGAAGAGGAGG - Intronic
948362578 2:237433360-237433382 CTCTGGGAGGGGTGGCGAGTGGG + Intergenic
948525077 2:238566486-238566508 CTCTGTGGTGGGGGGAGAGTGGG - Intergenic
948923041 2:241075136-241075158 CACAGAGAGGGGAGAAGAGCCGG - Intronic
949049213 2:241888326-241888348 CTCTGAGAGGGCAGAAGGGCCGG - Intergenic
1169693030 20:8354655-8354677 CCCTCTGAGCGGAGGAGAGTTGG + Intronic
1173161167 20:40653496-40653518 CTCTGTGAGCCTAGAAGAGGAGG - Intergenic
1173644600 20:44625683-44625705 CTCTGTGTGAGGAGAGGAGTAGG + Exonic
1174271834 20:49374991-49375013 ATCTGTGAGGAGAAGAGAGTGGG + Exonic
1175838458 20:62011636-62011658 CCCAGTGAGGGTAGAAGAGCCGG + Intronic
1176025417 20:62983027-62983049 CTCTGTGAGGGCAGGTGAGGAGG - Intergenic
1178156455 21:29859483-29859505 TTCTGTGAGGCTAGAAGAGAGGG - Intronic
1178743633 21:35226618-35226640 CTCTGAGAGGTGAGCAGAGTGGG - Intronic
1178932229 21:36829740-36829762 CTCTGGGAAGGGAATAGAGTGGG - Intronic
1179511606 21:41877451-41877473 CACTGTGAGGGGAGCTGAGCAGG + Intronic
1180741625 22:18057112-18057134 CTCTGTCAGGTGAGGAGAATGGG + Intergenic
1181593168 22:23896844-23896866 CTGTGTGAGGGCAGGAGGGTTGG + Intronic
1182486235 22:30640763-30640785 ATCTGTCAGTGGAGGAGAGTTGG + Intronic
1182557253 22:31135935-31135957 AGCTGTAAGGAGAGAAGAGTGGG + Exonic
1184249575 22:43252580-43252602 TTCCGGGAGGGGAGAAGGGTAGG - Intronic
1184802061 22:46767384-46767406 CTCTTTGAGGAGAAAAGAATGGG + Intronic
949202718 3:1398785-1398807 CTCTGGGAGATGAGAAGAGTTGG - Intronic
949673988 3:6431957-6431979 ATCTGTGAATGGAGAAGACTGGG + Intergenic
950104462 3:10379409-10379431 CTCTGTGTGGGGATACGGGTTGG + Intronic
951235827 3:20235364-20235386 CTCTGTGTGGGGAAGAGGGTGGG + Intergenic
952726814 3:36595210-36595232 CTCTGTGGGCAGAGTAGAGTGGG - Intergenic
953215275 3:40912493-40912515 CACTGTGAGGTGGGAACAGTAGG + Intergenic
953374989 3:42421040-42421062 CTGTGTGAGGGGTGAGGAGGTGG - Intergenic
953885979 3:46714573-46714595 TTCTGGGAGGGCAGCAGAGTGGG - Intronic
955371411 3:58355202-58355224 ATCTGTGAGGGCACAAGTGTAGG + Intronic
955897735 3:63718380-63718402 GTATGTGTGGAGAGAAGAGTGGG + Intergenic
956525721 3:70157927-70157949 AACTGTGAGGGTACAAGAGTGGG - Intergenic
956732602 3:72210459-72210481 CACTTTGGGGTGAGAAGAGTTGG + Intergenic
956841500 3:73144173-73144195 CTGTTTGAGGGGAGAGGACTTGG + Intergenic
957418889 3:79942724-79942746 CTCAGGGAGGAGAGAAGGGTAGG - Intergenic
957716776 3:83938315-83938337 TTCTCTGAGAGGTGAAGAGTGGG - Intergenic
958163508 3:89849415-89849437 TTTTGTGAGGGGTTAAGAGTGGG - Intergenic
961098059 3:124174705-124174727 CTCTGTAGGGGGAGAGGAGTTGG - Intronic
961171217 3:124799109-124799131 CTCTGTGGGGTAGGAAGAGTAGG + Intronic
961502008 3:127342871-127342893 CAATGTGAAGGGGGAAGAGTAGG + Intergenic
962926079 3:139994554-139994576 CTCAGTGAGGGCAGAGTAGTAGG - Intronic
962931518 3:140041877-140041899 CTGTGTGAGGAGGGAAGAGGGGG + Intronic
963266724 3:143247105-143247127 CTCTCTGTGGGGAGAGGGGTAGG - Intergenic
963865245 3:150353732-150353754 CTCTGTGAGGATAGAAGAAGTGG - Intergenic
964682867 3:159361712-159361734 CACAGTGGGAGGAGAAGAGTTGG + Intronic
965089398 3:164143713-164143735 ATCTGTGAGGAGAGAAGAGAGGG - Intergenic
966381280 3:179347516-179347538 CACTTTGAGGGGAGAAGGGAGGG + Intergenic
967610853 3:191504301-191504323 CTCATGGAGGGGAGAAGAGCTGG + Intergenic
967776206 3:193388637-193388659 AGCAGTGAGGGGAGAAGAGGTGG - Intergenic
968045928 3:195623941-195623963 GTCTGTGAGGTGAGAAGGGCCGG + Intergenic
968234671 3:197024484-197024506 CTCTAGGAGGGGAGGGGAGTGGG + Exonic
968308726 3:197666146-197666168 GTCTGTGAGGTGAGAAGGGCCGG - Intergenic
968576927 4:1371022-1371044 CTCTGTTTGGAGAGAAGAGCTGG - Intronic
968981645 4:3853413-3853435 CTCTGATCGGGGAGAAAAGTGGG - Intergenic
972177042 4:36420445-36420467 CCCTGTCAGGGGAGGCGAGTGGG - Intergenic
973726859 4:53785742-53785764 CTCTGTCAGGAGAGGAGAGATGG - Intronic
976677515 4:87719667-87719689 TCCTGTGAGGGGAGAAGGGCTGG - Intergenic
979353484 4:119674174-119674196 CCATGTGAGGGAAGAACAGTAGG + Intergenic
982452320 4:155568122-155568144 CTCTGTGAAGGGAGTTGAGTAGG - Intergenic
983122618 4:163906231-163906253 CTCTGTGAGCAGAGAAAAATGGG - Intronic
984915551 4:184719740-184719762 TTCTGTGAGAGGAGAGGAGAGGG + Intronic
985066412 4:186126556-186126578 ATGTCTGAGGGCAGAAGAGTTGG - Intronic
985376181 4:189341394-189341416 CTCTGAAAAGGGAGAAGAGTGGG + Intergenic
985747366 5:1654901-1654923 GTCTGTGAGGTGAGAAGAGCTGG - Intergenic
986865116 5:11976922-11976944 CTCTGGGAGCCGGGAAGAGTAGG - Intergenic
986922710 5:12707266-12707288 CTAAATTAGGGGAGAAGAGTAGG - Intergenic
987158804 5:15118331-15118353 CTCTGTGAGGCAAGTAGGGTGGG + Intergenic
989633709 5:43512581-43512603 CAATGTTAGGGGAGAAAAGTAGG - Intronic
990427899 5:55706794-55706816 CTCTGTGTGGGGAAAAAAGGAGG - Intronic
990814018 5:59763048-59763070 CTCTGCGAAGGAAGAAGAATAGG + Intronic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
991920300 5:71650105-71650127 CTCAGTGATGGGAGGAGAGCAGG + Exonic
994133937 5:96263292-96263314 ATCTGTGGGTGGAGAAGGGTGGG + Intergenic
994947672 5:106416738-106416760 CTGTGTGAAAGGAGAAGACTTGG - Intergenic
997338819 5:133126666-133126688 CTCTTTGAGGGGGAGAGAGTGGG + Intergenic
997363540 5:133310909-133310931 CTCAGTGAGGGGAGGTGGGTGGG + Intronic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
998849758 5:146341507-146341529 TTTTGTGAGGGAAGAGGAGTGGG + Intergenic
998967734 5:147559017-147559039 CACTGTGGGGGAAAAAGAGTAGG + Intergenic
999801344 5:155040611-155040633 CTCTGGGAGGAGAAAAGAGCTGG + Intergenic
999959374 5:156737570-156737592 CTCTCTGTGGGGAGCAAAGTAGG - Intronic
1000629184 5:163572561-163572583 ATCTTTGGGGGGAGAAGACTGGG + Intergenic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1002096980 5:176837235-176837257 CTCTGTGATGGCAGATGAGATGG - Intronic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003975951 6:11344840-11344862 CTCTGTAATGGGTGGAGAGTAGG - Intronic
1005483449 6:26276599-26276621 CTGTTTCAGGGGAGAAGAGTTGG - Intergenic
1005483464 6:26276690-26276712 CTGTTTCAGGGGAGAAGAGTTGG - Intergenic
1006378597 6:33685065-33685087 GGCTGAGAGGTGAGAAGAGTGGG + Intronic
1006597273 6:35202617-35202639 CTCTGTGTTAGTAGAAGAGTGGG - Intergenic
1006869952 6:37242472-37242494 CTCTCTGAGTGGGGAAGAGATGG + Intronic
1007882861 6:45186709-45186731 CTGGGTCAGGGGAGAAGAGCTGG - Intronic
1008614649 6:53214728-53214750 CTGTTTCAGGGGAGAACAGTGGG - Intergenic
1008840851 6:55902193-55902215 CTCTGAGAGAGGAGAACTGTAGG + Intergenic
1010804104 6:80214503-80214525 CTGTTTGAGGGGAGCAGAGGGGG + Intronic
1010963411 6:82174290-82174312 TTTTTTGAGGGGAGAAGATTGGG - Intronic
1011421329 6:87176504-87176526 CTGTTTCAGGGGAGAAGGGTGGG + Intronic
1011442668 6:87403782-87403804 ATCTGGGAGGGTAGAAGAGTGGG - Intergenic
1013093626 6:106923427-106923449 TTGTGTGTGGGGAGAAGATTAGG - Intergenic
1014082204 6:117300668-117300690 GTGTGTGGGGGGAGAAGAGAAGG + Intronic
1016527116 6:145014285-145014307 GAGAGTGAGGGGAGAAGAGTTGG + Intergenic
1016531714 6:145065682-145065704 CTCTGTGCAGGGAAAAGAGGAGG + Intergenic
1017525795 6:155240509-155240531 CTCTGAGAGAGGACAAGAGGTGG - Exonic
1017590296 6:155972167-155972189 AACTGTGAGGAGAGAGGAGTGGG + Intergenic
1017676836 6:156822892-156822914 CTCTGTAAAGGGAGAACAGGAGG - Intronic
1019765854 7:2849645-2849667 CTCTGTGGGGTGAGAGGACTGGG + Intergenic
1019875333 7:3805925-3805947 CTCTGTAAAGGAAGAAGAGGGGG - Intronic
1021990061 7:26132511-26132533 CTCTCTGAGGGGAAAAAAATGGG - Intergenic
1022323543 7:29309398-29309420 CTCTATGAGTGGAGAAGGGAAGG - Intronic
1022335283 7:29415982-29416004 CTGGGTTTGGGGAGAAGAGTGGG + Intronic
1023034206 7:36116551-36116573 CTCTGTGAGGGGATCAGGGAGGG - Intergenic
1024787121 7:52921240-52921262 TTCTGGGAGGGGAAAGGAGTAGG + Intergenic
1027441033 7:78219452-78219474 CTCAGTGAGAAGAGAAAAGTGGG - Intronic
1027631887 7:80617088-80617110 CTCAGTGAGGAGAGATGAGGTGG + Intronic
1028240786 7:88418189-88418211 CACTGAGGCGGGAGAAGAGTAGG - Intergenic
1029046513 7:97635087-97635109 CTCTTTGAGAAGAGAAGGGTTGG + Intergenic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1031904526 7:127446331-127446353 CTCTGTGAGGGAAAGACAGTGGG + Intergenic
1033616245 7:143017176-143017198 CTCTGTGAGTGAGGATGAGTGGG - Intergenic
1034294390 7:149959096-149959118 CCCTGTGAGAGGAGAAGTGGAGG + Intergenic
1034811679 7:154137776-154137798 CCCTGTGAGAGGAGAAGTGGAGG - Intronic
1034962859 7:155373348-155373370 CTGTGTGGGGGAAGAAGGGTGGG - Intergenic
1035064994 7:156097809-156097831 CTCTGTCATGGCAGAAGAGGAGG - Intergenic
1035400716 7:158563704-158563726 ATGTGTGAGGGGAGAAGAGAGGG + Intronic
1035414648 7:158672935-158672957 ATCTGTGAGGAGGGATGAGTGGG - Intronic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1037295091 8:17391155-17391177 ATCTGTGAGGGGAAACAAGTAGG + Intronic
1038749021 8:30279268-30279290 ATCTGTGAGAGGAGGAGTGTAGG - Intergenic
1039436917 8:37565737-37565759 CCCGGGGAGGGGAGAAGAGGGGG + Intergenic
1041077654 8:54183964-54183986 TTCTGTGAGGGGAGGAAGGTTGG - Intergenic
1041415427 8:57602772-57602794 TACTGTGAAGGGAGAAGAGAGGG + Intergenic
1044290648 8:90465036-90465058 TGCAGAGAGGGGAGAAGAGTTGG + Intergenic
1044546365 8:93464847-93464869 CTCTGTGAGGAGAGAAGCCCAGG - Intergenic
1044944443 8:97377580-97377602 CTCTGTGAGTTGAGAGGTGTTGG - Intergenic
1046042138 8:108918605-108918627 CTCCGGGAGAGGAGCAGAGTCGG - Intergenic
1046424388 8:114027545-114027567 CACTGTGAGGGGAAAATGGTTGG + Intergenic
1048197788 8:132346765-132346787 GTCTGGGAGGGGAGAAGAGGAGG + Intronic
1048724141 8:137362433-137362455 CTTTGTGAGGCTAGGAGAGTCGG + Intergenic
1048795004 8:138141566-138141588 CCCAGTCAGGGGAGAAGTGTGGG + Intronic
1049383159 8:142327534-142327556 CTCTGTGAGGGGGCCAGAGAGGG - Intronic
1049639156 8:143706749-143706771 GACTGTGGGGGGAGAAGAGCCGG + Exonic
1049720535 8:144113536-144113558 CTCTGGGAGGCGAGCTGAGTCGG - Intronic
1050137398 9:2480906-2480928 CTCTGTGGTGGGAGAAAACTTGG - Intergenic
1050332911 9:4563438-4563460 CCCTGAGAGAGGAAAAGAGTGGG + Intronic
1050913014 9:11099059-11099081 CTTGCTTAGGGGAGAAGAGTAGG - Intergenic
1052549757 9:29932657-29932679 TTCCATGAGGGGAGAAGAGAGGG - Intergenic
1053535376 9:38920345-38920367 ATGTGTGAGAGGAGATGAGTGGG - Intergenic
1054207597 9:62144749-62144771 ATGTGTGAGAGGAGATGAGTGGG - Intergenic
1054630755 9:67443605-67443627 ATGTGTGAGAGGAGATGAGTGGG + Intergenic
1060538168 9:124408946-124408968 CACTGTTAGGTGAGAAGACTAGG + Intronic
1060988637 9:127835813-127835835 GTCTGTGAGGGGTGACGAGGAGG + Intronic
1061168089 9:128936194-128936216 GTCTGTGAGGGGTGGGGAGTCGG + Intronic
1061474253 9:130853096-130853118 CTCTGGGAGCGGAGAGGACTGGG + Intronic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1061998740 9:134205029-134205051 CTCTGTGACAGGAGCAGTGTTGG - Intergenic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062444077 9:136586049-136586071 CTCTGTGTGGGGAGCAGGCTCGG + Intergenic
1187135917 X:16547176-16547198 CTTTGAGAGGTGAGATGAGTGGG - Intergenic
1187235683 X:17464882-17464904 ATCTGTAAAGGGAGAAGAGGAGG + Intronic
1188274655 X:28184942-28184964 TTCTGGGAGGTGAGAGGAGTTGG - Intergenic
1188393942 X:29656850-29656872 GTTTGTGTGGGGAGAAGAGATGG + Intronic
1191197677 X:57741849-57741871 ATCTGAGAGGGGACAAGTGTAGG + Intergenic
1191725196 X:64271887-64271909 CCCTGGGAAGGGAAAAGAGTTGG + Intronic
1191857960 X:65642934-65642956 CTCTCTGAGGGGATAGGGGTGGG - Intronic
1192366804 X:70480512-70480534 CGCTGTGAAGGGAGAATGGTAGG + Intronic
1194462580 X:94190581-94190603 GTGTGTGGGAGGAGAAGAGTGGG + Intergenic
1196764024 X:119226702-119226724 AACTGTGAGGGGAGCAGAATGGG - Intergenic
1197753932 X:129982341-129982363 CACTGGGAGGGGAGGAGAGGAGG - Intronic
1198128747 X:133673312-133673334 CTCTGTAAGAGGAGAACATTGGG - Intronic