ID: 1091841230

View in Genome Browser
Species Human (GRCh38)
Location 12:3622443-3622465
Sequence CTGAAATAACTGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091841230_1091841235 6 Left 1091841230 12:3622443-3622465 CCCTCCACCTTCAGTTATTTCAG 0: 1
1: 0
2: 0
3: 17
4: 280
Right 1091841235 12:3622472-3622494 TTCTGTGAACTTGAGCTTGTTGG 0: 1
1: 0
2: 2
3: 8
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091841230 Original CRISPR CTGAAATAACTGAAGGTGGA GGG (reversed) Intronic
901132381 1:6970214-6970236 CTGAAATCACTGAGAGTGGTAGG - Intronic
902117242 1:14131672-14131694 CTCAATTAACTGAAAGTGGAGGG - Intergenic
902203461 1:14851076-14851098 CTGACACATCTGATGGTGGAAGG - Intronic
903782494 1:25830294-25830316 CTCAAATCACTGAATGTGCAGGG - Intronic
905405698 1:37731039-37731061 CTGACTTCACTGAAGGTTGATGG - Intronic
908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG + Intergenic
908644140 1:66258962-66258984 CTGAAATGCCTCAAGCTGGAGGG - Intronic
909822818 1:80087363-80087385 CTGGAATATCTGATGGTGGCTGG - Intergenic
910337597 1:86153043-86153065 CTGAAAGAAATGAAGTTGGTTGG - Intronic
911269322 1:95781172-95781194 TTGAAATATCTGAAGTTTGATGG - Intergenic
911860708 1:102944481-102944503 CTGGGATAACTGAAAGAGGATGG + Intronic
914254088 1:145946496-145946518 CTGAAATGACTGAAGTTCTAAGG + Intronic
914395309 1:147261334-147261356 CTCACATGACAGAAGGTGGACGG + Intronic
914430252 1:147614104-147614126 CTGAAATAAGAGAAGTTAGAGGG + Intronic
914823767 1:151125961-151125983 CTGAGCTAACTGAAGGGGGAGGG + Intergenic
916764012 1:167842925-167842947 CTGGAATTACTGAAGGTGTGTGG + Intronic
916943920 1:169704866-169704888 ATGAAGAAACTGAAGTTGGAGGG - Intronic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
919411204 1:197245613-197245635 CAGAAATATCTCAAGGTGAATGG - Intergenic
919753064 1:201050263-201050285 CTCAGATAAATGAAGGGGGAAGG + Intronic
920081101 1:203373501-203373523 CTTAACTAACGCAAGGTGGAAGG + Intergenic
921296044 1:213704989-213705011 CTGAACAATCTGAAGCTGGAGGG + Intergenic
921421474 1:214953877-214953899 TTGAAATAAATGCATGTGGAAGG + Intergenic
921545369 1:216468262-216468284 CTGAAATAACTCAAATTGAACGG + Intergenic
921771962 1:219050833-219050855 TAGAAATAACTTAAGGTGCAAGG + Intergenic
922924886 1:229340601-229340623 TGCAAATAACAGAAGGTGGAGGG - Intronic
923885830 1:238154324-238154346 CTGAACTAACAGAAGCTGAAGGG + Intergenic
1064509699 10:16076659-16076681 CTGATATGACTGGATGTGGAGGG - Intergenic
1064629036 10:17290653-17290675 CTGCAAGAAGTGAAGGTGAATGG - Intergenic
1064823797 10:19371896-19371918 CTGAAATAAATGAATGAGAAAGG + Intronic
1068258481 10:54544698-54544720 CTAACAATACTGAAGGTGGAAGG - Intronic
1068697197 10:59980200-59980222 CTCACATAACAGAAGATGGAAGG - Intergenic
1068887206 10:62109877-62109899 CTGATATAACAGAAAGTGCATGG + Intergenic
1071919085 10:90329242-90329264 CTATAACAACTGAAGGTGGTGGG - Intergenic
1072519163 10:96215008-96215030 CTGAAAGAACTGTGGGTTGAGGG + Intronic
1073177724 10:101566637-101566659 CTGTAATAACAGAAGATGGATGG + Intergenic
1073400332 10:103251678-103251700 CTGATATAACTAAGGATGGATGG + Intergenic
1073775926 10:106785877-106785899 ATTAAATAACTGAAGAAGGAAGG - Intronic
1073849281 10:107595673-107595695 CCGAAAAAATTCAAGGTGGAAGG - Intergenic
1073940419 10:108691619-108691641 CTCACATAGCAGAAGGTGGAAGG + Intergenic
1074123004 10:110507165-110507187 CCAAAATAACTGAAGGGGAATGG - Intronic
1075141644 10:119842587-119842609 TTGAAACAACTGAAGGAGAAAGG + Exonic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076633477 10:131867367-131867389 CTGAAAGAACTGAAAGTAGAGGG + Intergenic
1078162764 11:8856067-8856089 CTGAACCAACTGAAGGTTTATGG + Intronic
1078667396 11:13338166-13338188 CTGAAATCACTGAAGTTTGTGGG + Intronic
1078947981 11:16093209-16093231 CTCATATATCTGAAGGTTGAGGG - Intronic
1080070037 11:28071707-28071729 CTGCTATAACAGAAGGTGGGAGG + Intronic
1082988063 11:59184946-59184968 CTGCAATGACAGAAGGTCGATGG - Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1086880235 11:92145280-92145302 TTGAGATAAATGAAGCTGGATGG + Intergenic
1086913088 11:92495720-92495742 CAGAAATCACTGGAGTTGGATGG - Intronic
1088602138 11:111489973-111489995 TTTAAATAACTGAAAGTGGCCGG + Intronic
1089323666 11:117643008-117643030 CTGAAATCCCTGCAGGCGGAGGG - Intronic
1089830688 11:121325184-121325206 CTGATTTAACTGAAGATGGGTGG - Intergenic
1090670180 11:128940507-128940529 CTCACATGGCTGAAGGTGGAAGG - Intronic
1090912238 11:131131445-131131467 CTGAAACAACTGAAGATGACTGG + Intergenic
1091841230 12:3622443-3622465 CTGAAATAACTGAAGGTGGAGGG - Intronic
1091942781 12:4504079-4504101 ATGGGATAACTGAAGGTGGGAGG + Intronic
1094196194 12:27752215-27752237 CTGAGATGAATGAAGGAGGAGGG + Intronic
1094353379 12:29551051-29551073 TAGAAGTAACTAAAGGTGGAGGG + Intronic
1094621095 12:32081312-32081334 CTGAAATATCTGAAAGTTGCAGG - Intergenic
1097417780 12:59334319-59334341 CTGAAACAATTCAAGGTAGAAGG - Intergenic
1097549719 12:61052102-61052124 CTCAAATAAAAGAAGGTAGAGGG + Intergenic
1098403322 12:70097267-70097289 TTGAAATAACTGAATGAGAAGGG - Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099193389 12:79584157-79584179 CTGAAGTATCTGCAGGTGAAAGG + Intronic
1101325877 12:103715650-103715672 CAGAAATAACTGAACTAGGAGGG - Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1103969538 12:124661398-124661420 CTGAAATAAATGAAGGCAGCCGG + Intergenic
1106202294 13:27549544-27549566 ATGAAATAGCTGAAAGTGGTTGG - Intronic
1107117898 13:36766720-36766742 AGGAAATAATGGAAGGTGGAGGG + Intergenic
1107423324 13:40269722-40269744 ATGACATGACTGAAGGTGCAGGG + Intergenic
1109387471 13:61651038-61651060 GTGAAATAAGTGAAGGAGAAAGG + Intergenic
1111153486 13:84291174-84291196 CTCAAATAAGTAAAGATGGAAGG + Intergenic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1111267464 13:85836127-85836149 ATGAAACAACTGAAGTTGCAAGG + Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112966840 13:105207482-105207504 CTGAACTAACTGAGGGTTCATGG - Intergenic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113266274 13:108621507-108621529 CAGAAAGAAATGAAGCTGGATGG - Intronic
1116829145 14:49700674-49700696 TTGAAAAGAATGAAGGTGGAAGG + Intronic
1117527638 14:56625810-56625832 TTGAAATCATTGCAGGTGGATGG + Intronic
1119138504 14:72243148-72243170 TTGAAAGAAATGAAGTTGGAAGG - Intronic
1119928551 14:78521191-78521213 CAGAAATAAATGACGGTGAAAGG - Intronic
1120673104 14:87387202-87387224 GGGAAAGCACTGAAGGTGGAGGG + Intergenic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1123668061 15:22625314-22625336 CAGGCATAACTGAAGGTGAAAGG - Intergenic
1124524035 15:30431751-30431773 CAGGCATAACTGAAGGTGAAAGG - Intergenic
1124534631 15:30534465-30534487 CAGGCATAACTGAAGGTGAAAGG + Intergenic
1124764018 15:32473134-32473156 CAGGCATAACTGAAGGTGAAAGG - Intergenic
1124774610 15:32575914-32575936 CAGGCATAACTGAAGGTGAAAGG + Intergenic
1125091924 15:35802885-35802907 CTCACATAGCAGAAGGTGGAAGG + Intergenic
1126556751 15:49996716-49996738 CTGAAGTAACTGATAGTGCATGG + Exonic
1127251218 15:57240442-57240464 CTGATAACACTGATGGTGGATGG - Intronic
1129105954 15:73307406-73307428 CTGAAATAATTAGGGGTGGAGGG + Intergenic
1129890070 15:79066047-79066069 CTCAAATAACTGAATCTGAAAGG + Intronic
1133580705 16:7141923-7141945 CTGAAACATCTTAAGGGGGAAGG - Intronic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1138907025 16:61349309-61349331 CTGAAATAAATGAAGGAGCCAGG - Intergenic
1141116228 16:81312207-81312229 TTGAAGTAACTGGAGGTGAATGG - Intergenic
1141269072 16:82522528-82522550 CTGAAGTAAATGGTGGTGGAGGG + Intergenic
1141323380 16:83033230-83033252 CTGAAGTCACTGAAGGTCAATGG - Intronic
1144724012 17:17492328-17492350 CTGAAATGCCAGAAGGGGGAAGG - Exonic
1148477757 17:47940562-47940584 CTTAAATAAATGAGGCTGGAGGG + Intergenic
1148954980 17:51346077-51346099 CTGTAAGGACTGAATGTGGAAGG + Intergenic
1149022061 17:51979700-51979722 CTTAAATAACTGAGAATGGACGG + Intronic
1149341331 17:55689261-55689283 ATGAAGGAACTGAAAGTGGATGG - Intergenic
1151765018 17:76128923-76128945 GTGAAAGAACTGAAAGTGGTTGG + Intergenic
1153062386 18:1007565-1007587 CTGAAAGAACTGAAAGACGAAGG - Intergenic
1153519020 18:5934561-5934583 CTGAAATACCTCTAGATGGATGG - Intergenic
1154261887 18:12842261-12842283 CTAAACAAATTGAAGGTGGAGGG + Intronic
1154412951 18:14151132-14151154 CTGAAACAACTGGGGGTGGCAGG + Intergenic
1155546904 18:26924911-26924933 AATGAATAACTGAAGGTGGAAGG - Intronic
1155969431 18:32067588-32067610 CTGAAATATCTGAAGCTCAAAGG + Intronic
1157995872 18:52555009-52555031 TTCAAAAGACTGAAGGTGGAAGG + Intronic
1158193612 18:54859433-54859455 ATGAAATATTTGAAAGTGGATGG - Intronic
1159059893 18:63503565-63503587 TAGAAATAACTGAAGATGGTGGG + Exonic
1160482906 18:79259536-79259558 TTGAAAGCACTGAAGGTGAAGGG + Intronic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1162219935 19:9167792-9167814 ATGAAATAACAGGAGGTGGAGGG - Intergenic
1164851482 19:31487905-31487927 TTGCAATAGCTGAAGGTGGAAGG - Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926276903 2:11410832-11410854 CTGGGATAACTGGAGGTGGGAGG - Intergenic
930582024 2:53223346-53223368 CTGAAATAAGTGAGGGACGAAGG - Intergenic
931711774 2:64993974-64993996 CTGAAATAAATGAGGGTAGATGG + Intronic
931784695 2:65608556-65608578 CTAAAATAATGGAAGGGGGATGG - Intergenic
932880891 2:75500940-75500962 CAAAATTAATTGAAGGTGGAAGG - Intronic
932906044 2:75752767-75752789 CTGAGATAACTGAAGAAGAATGG - Intergenic
933583215 2:84150704-84150726 CTAAAAAAACAGAAGGTGAATGG + Intergenic
933673755 2:85034473-85034495 TTCAAATAAATGAAGGAGGATGG + Intronic
934720249 2:96569541-96569563 CTGAATGAACTGATGGGGGATGG + Intergenic
934919889 2:98334332-98334354 CTGAAACAAGAAAAGGTGGAAGG + Intronic
937869966 2:126779689-126779711 ATGAAATATCTGCAGCTGGATGG + Intergenic
938326429 2:130408005-130408027 CAGAAATAACTAAAGTTTGAGGG + Intergenic
938363509 2:130713454-130713476 CAGAAATAACTAAAGTTTGAGGG - Intergenic
939311191 2:140479648-140479670 CAGAGATAATTGCAGGTGGAAGG - Intronic
940418435 2:153449792-153449814 CTCACATGACAGAAGGTGGAAGG + Intergenic
941091044 2:161175926-161175948 CTGAAATCCCTGAAGGTAGCAGG - Intronic
941154898 2:161964533-161964555 CTGAATTAATTGAAGCTGGATGG + Intronic
941405445 2:165081632-165081654 CATGAATAACTGAAGGTGGTGGG + Intergenic
942480695 2:176385240-176385262 CTGAAACATCTGGATGTGGAAGG - Intergenic
942558950 2:177200188-177200210 TTAAAATAACTGAAGTTGGCCGG - Intergenic
942850748 2:180482495-180482517 CTCACATGATTGAAGGTGGAGGG + Intergenic
943190571 2:184673101-184673123 ATGAAATAAAAGAAGGAGGAAGG + Intronic
943594917 2:189844791-189844813 CTGATATGACTGAAAGAGGAAGG - Intronic
945200564 2:207277129-207277151 CTGAAATAGCTGAAGGCTGGAGG - Intergenic
947154343 2:227146380-227146402 GTGAAAGAAGTGAAGGTGGTGGG - Intronic
947989969 2:234479102-234479124 CTAAGATAACTGAAGGAGGCTGG - Intergenic
948222661 2:236285332-236285354 CTCACATAGCAGAAGGTGGAAGG - Intergenic
1169095707 20:2896806-2896828 CAGAAATAAGTGAAGGGGAAAGG - Intronic
1169496642 20:6122446-6122468 CTGGAATATCTGAAGGTGCTTGG + Intronic
1169855921 20:10102659-10102681 CTGAAATCACTGAAAGTTAATGG - Intergenic
1170422843 20:16209471-16209493 CTGAAATACCTCAATGTGGCTGG + Intergenic
1170531291 20:17295166-17295188 CTGAAACAACTGAAAATGCAGGG - Intronic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1172214289 20:33224079-33224101 TTGAAAGAAGAGAAGGTGGAAGG + Intronic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1174435048 20:50500176-50500198 TTGGAATAACTGAAAGTGGAGGG - Intergenic
1175583844 20:60121767-60121789 ATGAACTAACTGAAGCTAGAAGG + Intergenic
1176860059 21:14007120-14007142 CTGAAACAACTGGGGGTGGCAGG - Intergenic
1177892427 21:26822610-26822632 GTGAAAACACTGAAGGTGAAAGG + Intergenic
1180749124 22:18111928-18111950 CTGACAAAACTGAAGCTGGAAGG - Intronic
1182750198 22:32635459-32635481 TTGAAATAAGTGAAGGTAGTGGG - Intronic
1183055950 22:35305695-35305717 CTGATAGAACTGAATGTGCAGGG + Intronic
1184919623 22:47596534-47596556 CTTAGACAACTGCAGGTGGATGG + Intergenic
949340155 3:3020827-3020849 CTAAAATAACTGAAAGTGTTTGG - Intronic
949586969 3:5450587-5450609 CTAAAATAACAGAAGTTGAAAGG + Intergenic
950112382 3:10427742-10427764 GAAAAAGAACTGAAGGTGGAGGG - Intronic
950820574 3:15753940-15753962 CTCAAAAAACAGAAGGTGGCTGG + Intronic
951559048 3:23947362-23947384 ATGGAAGAACTGAAGGGGGAAGG - Intronic
952521907 3:34169379-34169401 CTTACATAACAGAAGGTGGAAGG + Intergenic
954804263 3:53206841-53206863 TTGGAATCACTGAAGGAGGAAGG + Intergenic
956011183 3:64833294-64833316 CTGAAATATGTGAAGGTTTAGGG + Intergenic
956324967 3:68042137-68042159 AGGAAAAAACTGAAAGTGGAGGG - Intronic
956795884 3:72718287-72718309 AAGAACTAACTGAAGTTGGATGG - Intergenic
962467473 3:135673833-135673855 CTGACATAGCGGAAGGTGGAAGG + Intergenic
963381255 3:144533373-144533395 CTGAAATAACTTCATTTGGACGG - Intergenic
965933941 3:174081920-174081942 ATTAAATAATTCAAGGTGGATGG - Intronic
966850058 3:184159075-184159097 CTCAAATAACTTAAGATGGCAGG - Intronic
970681470 4:18513388-18513410 CTGATATAACTGAAAGTCAAGGG + Intergenic
971199409 4:24498449-24498471 CTGAAACACCTGAAGCTGGCAGG + Intergenic
973916614 4:55640327-55640349 ATGAAATAATAGAAGGTGGCTGG + Intergenic
975293150 4:72700864-72700886 ATGAAATAACAGAGAGTGGATGG - Intergenic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977540068 4:98306364-98306386 CTCACATGACAGAAGGTGGAAGG + Intronic
977920906 4:102641436-102641458 CTGAGACTACTGAAGGAGGAAGG + Intronic
978099138 4:104815269-104815291 CTCACATGACAGAAGGTGGAAGG - Intergenic
980712039 4:136581571-136581593 CTGACATCACTGAAGGTGTCAGG + Intergenic
980741846 4:136960807-136960829 GTTAAGTAACTGAAGGTGAAAGG + Intergenic
981185776 4:141801200-141801222 CTGAAATGGCGGAAGGTGGAAGG + Intergenic
985933969 5:3080383-3080405 CTGGTATAAATGAAAGTGGAAGG - Intergenic
986508900 5:8481930-8481952 CTAAAATACCTGAAGGTTTATGG + Intergenic
986588329 5:9342421-9342443 CTTAATTAACTGAAGTTTGAAGG - Intronic
986922728 5:12707426-12707448 GTGAAATAATGGAAGGTGAAGGG - Intergenic
992933426 5:81675557-81675579 CTTAAATAAATGAAGTTTGAAGG - Intronic
993856938 5:93087781-93087803 GTGAAATGACTTACGGTGGATGG - Intergenic
993872901 5:93272944-93272966 ATCACATAACGGAAGGTGGAAGG + Intergenic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
994157947 5:96524348-96524370 GTGAAGTATCTGAAAGTGGAAGG + Intergenic
994581459 5:101648117-101648139 CTAAAATAGCTGCAGCTGGAAGG - Intergenic
995676514 5:114668510-114668532 CAGAAAGAAGTGAAGGTGGTGGG - Intergenic
996341152 5:122440439-122440461 CTGAAATGAATGAAAGAGGACGG - Intronic
996647470 5:125833936-125833958 CTCACATAATAGAAGGTGGAAGG + Intergenic
997003434 5:129789491-129789513 CTCAAAAAACTGAGGATGGAAGG + Intergenic
998068874 5:139180997-139181019 CTGAAATGAGTGCAGGGGGAAGG - Intronic
998571235 5:143259639-143259661 CTGAAAGAACTGAAGGTTCAGGG + Intergenic
998888083 5:146715764-146715786 AAGAAATAATAGAAGGTGGAGGG - Intronic
998941454 5:147287484-147287506 CTGTAATAATTAAAGATGGATGG - Intronic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
999075899 5:148795062-148795084 CTGAAATAACTGAAGTTTTGTGG + Intergenic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1002169391 5:177366877-177366899 CTGAGCTAGCTGAAGGAGGAGGG - Exonic
1003206023 6:4012702-4012724 CTGAAGTAACTGAAAGTTGCAGG + Intergenic
1003617430 6:7668357-7668379 CTGAAATCACAGAAGGTGTTTGG + Intergenic
1003920255 6:10826131-10826153 CTGAAAGAAGTGTAGGTGGCTGG - Intronic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1003976476 6:11349758-11349780 GGGAACTAACTGAGGGTGGAGGG + Intronic
1004913716 6:20312022-20312044 ATGAAATAACTCAAGTTGCAAGG + Intergenic
1005076865 6:21917076-21917098 CTGAATTAACTGAGGGTCTAGGG - Intergenic
1006707301 6:36031703-36031725 CTCAAAAAAATGAAGATGGATGG - Intronic
1008170603 6:48201185-48201207 CTGAAATGCCTGAAGGGGCATGG + Intergenic
1008204728 6:48640781-48640803 CTGAAATCACTGAACTTGAAAGG + Intergenic
1008610327 6:53179588-53179610 CTGAAATGATAGAAGGTGGGAGG - Intergenic
1009450894 6:63799412-63799434 CTGATCTAAATGAAGGGGGAGGG - Intronic
1010717829 6:79250238-79250260 CTGAAATCATTGAAGGAGGTGGG + Intergenic
1010903720 6:81459199-81459221 CTAAAATAAAGGGAGGTGGAAGG + Intergenic
1012761723 6:103310519-103310541 CTGATCTACCTGAAGCTGGAGGG - Intergenic
1013687680 6:112603823-112603845 CTCAAAAAACTGAGGGTAGAAGG + Intergenic
1014031560 6:116711395-116711417 TTGTAATTTCTGAAGGTGGAAGG + Intronic
1015079575 6:129207268-129207290 CTGAAATAACTGGATTTTGAAGG + Intronic
1015246862 6:131084681-131084703 ATGAACTGACTGTAGGTGGAAGG - Intergenic
1015759623 6:136644563-136644585 CTGTATTGACTGAAGGTGGCAGG + Intronic
1016100183 6:140090384-140090406 CAGAAATAATTGGAGGTGGCCGG + Intergenic
1017699467 6:157054221-157054243 CTCAAAAAAAAGAAGGTGGATGG + Intronic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1017839021 6:158206166-158206188 CTGAAATGACTTAAGGCGTAGGG - Intergenic
1018040698 6:159919339-159919361 CTGAAAGATCTGAAGCTTGAAGG - Intergenic
1019658071 7:2208496-2208518 CTGATATAATACAAGGTGGACGG - Intronic
1021617534 7:22518346-22518368 ATGAAATGACTGAAAGTTGATGG + Intronic
1022199748 7:28104648-28104670 CTGAAATAAATAAAGTAGGAGGG - Intronic
1022597025 7:31722562-31722584 CTGACCTATCTGAGGGTGGATGG + Intergenic
1023284890 7:38608697-38608719 CTGCAAGAAGTGATGGTGGAAGG + Intronic
1023466180 7:40457638-40457660 CTGGCATAGCTGAAGATGGAAGG + Intronic
1023549873 7:41358025-41358047 CTGAAATCACAGCAGATGGAAGG - Intergenic
1023608731 7:41953714-41953736 CAGAACTAACAGCAGGTGGATGG + Intergenic
1023682053 7:42697125-42697147 CTGAAATAATTCAAGGAGGAAGG + Intergenic
1024756155 7:52534674-52534696 CTTAGATAACTGATGGTGCAAGG + Intergenic
1026471922 7:70701057-70701079 CTTAAACATCTGGAGGTGGAGGG - Intronic
1028375144 7:90137763-90137785 ATGAAATGACTGAATGTTGATGG - Intergenic
1030699171 7:112619968-112619990 GTGAGGTAACTGAAAGTGGAGGG + Intergenic
1033052910 7:138022567-138022589 ATGAAATGACTTAAAGTGGAAGG + Intronic
1033227083 7:139570882-139570904 CTGAAATATGTGAATGTGAATGG - Exonic
1034326786 7:150242875-150242897 CTGAAAAAACTAAAGGCAGAGGG - Intergenic
1034766420 7:153726390-153726412 CTGAAAAAACTAAAGGCAGAGGG + Intergenic
1036510277 8:9393616-9393638 CTGAATTCTCTGAATGTGGATGG - Intergenic
1037204322 8:16295320-16295342 CACAGATAAATGAAGGTGGATGG - Intronic
1037860401 8:22401033-22401055 ATGAGAAAACTGAAGGTAGAGGG + Intronic
1041307720 8:56480005-56480027 CACAAGTAACTGAAGGAGGATGG - Intergenic
1042891839 8:73621051-73621073 TTGAAATAAGTGAAAGTAGAAGG - Intronic
1042944922 8:74145097-74145119 CGGAAATCACTGGAGGAGGAAGG + Intergenic
1043004361 8:74799839-74799861 CTGGAAAAACTAAAGGTTGAAGG - Intronic
1043005654 8:74814997-74815019 CTGAAAGAAATAAATGTGGAAGG - Intronic
1043153440 8:76747427-76747449 GGGAATTAACTGAGGGTGGAGGG - Intronic
1043266802 8:78276961-78276983 CAGTAATACCTGAAGGTGGCTGG - Intergenic
1043578203 8:81681954-81681976 CTGAAATAAAAGAAGCTTGAAGG + Intronic
1043991047 8:86754836-86754858 CTGCAATGACTGAAAATGGATGG - Intergenic
1045970479 8:108074566-108074588 ATTAAATAACTGAAGGCTGAGGG - Intronic
1050105299 9:2159214-2159236 CTGAGATAAATGAAGTTGGGGGG - Intronic
1050159989 9:2708418-2708440 CAGAAATAAGTGAAGGTTGCTGG + Intergenic
1050263508 9:3866121-3866143 GTGAAATGAATGAATGTGGATGG - Intronic
1050630755 9:7555865-7555887 CTGTAAAAACTGAAGTGGGAGGG + Intergenic
1050796066 9:9543978-9544000 CTTACAAAATTGAAGGTGGAGGG - Intronic
1052228118 9:26114389-26114411 CTGAAAGAGGTGAAGATGGAGGG + Exonic
1055753719 9:79534748-79534770 CTAAAATGACTGGAGGTGAAAGG + Intergenic
1055902102 9:81252250-81252272 CTGAAATAAAGGAAGGTTAATGG + Intergenic
1056591288 9:87967856-87967878 CTGACATAAGTGAGGGTGGGGGG + Intronic
1058452087 9:105106526-105106548 CTTACATAACAGAAGGTAGAAGG + Intergenic
1058884688 9:109314326-109314348 TTGAAATAGCAGAAGGTCGATGG - Intronic
1062386781 9:136315426-136315448 CTAAAATAACAGAGGCTGGAGGG + Intergenic
1187002131 X:15193107-15193129 GAGACATAACTGAAGGCGGACGG - Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1188411671 X:29880093-29880115 CTGAAATACCTGTGAGTGGATGG - Intronic
1189191310 X:39109626-39109648 CTGAAATAACAAAAAGAGGAGGG - Intergenic
1189774519 X:44458405-44458427 ATGAAATGAGTGAAGATGGATGG + Intergenic
1190623067 X:52307993-52308015 CTGAAGCAACTGCAGCTGGAGGG + Intergenic
1191075481 X:56448796-56448818 CTGAAAAAATTTAAGGAGGAAGG - Intergenic
1191961974 X:66713452-66713474 TTGCAAAAACTGAAGTTGGATGG - Intergenic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1195020614 X:100823414-100823436 ATGAAACAAATGAAGGTGGGAGG + Exonic
1195765481 X:108292360-108292382 AGGAAATAGCTGAAGGCGGAAGG - Intronic
1196076180 X:111578743-111578765 CTGATGTACATGAAGGTGGAGGG - Intergenic
1196538182 X:116872470-116872492 CTCACATGACAGAAGGTGGATGG + Intergenic
1198602547 X:138299895-138299917 TTTTAATTACTGAAGGTGGAAGG + Intergenic
1199374665 X:147093467-147093489 ATGAAATGGCTGAAAGTGGATGG - Intergenic
1199604941 X:149569786-149569808 CTGACCTAACTGGAGATGGAGGG - Intergenic
1199908779 X:152262112-152262134 CTGAAGCAACTGAAGATGCAGGG + Intronic
1199973598 X:152878112-152878134 CTCTAAACACTGAAGGTGGAAGG - Intergenic