ID: 1091842111

View in Genome Browser
Species Human (GRCh38)
Location 12:3628643-3628665
Sequence CAAACATTCTTACAGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091842111_1091842114 -7 Left 1091842111 12:3628643-3628665 CCTGCATCCTGTAAGAATGTTTG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1091842114 12:3628659-3628681 ATGTTTGCAAAGGCATAAAGAGG 0: 1
1: 0
2: 2
3: 27
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091842111 Original CRISPR CAAACATTCTTACAGGATGC AGG (reversed) Intronic
905293872 1:36942037-36942059 CAAGCACTCTTTGAGGATGCAGG + Intronic
906800529 1:48733213-48733235 CAAATATATTTACATGATGCTGG + Intronic
907836026 1:58109325-58109347 CAAAGATTCTTAACAGATGCAGG - Intronic
908288894 1:62641322-62641344 CAAACTTTCTCACAGGCTTCAGG + Intronic
910278781 1:85475709-85475731 CAACCATTTTTGCATGATGCAGG - Intronic
912003220 1:104860228-104860250 CAAGCATTCTATCAGGATGTGGG - Intergenic
912478597 1:109960068-109960090 CATACATTCTTAAAGCATGCGGG + Intergenic
917879866 1:179324453-179324475 CAAATATGCCTACAGGATGATGG - Intronic
1065471808 10:26089699-26089721 TAAAGATTCTTACAGGATCTTGG + Intronic
1067700979 10:48571876-48571898 CAGACATTCTTACAGAATGGTGG + Intronic
1067715778 10:48690451-48690473 CCCTCATTCTTACTGGATGCAGG - Intronic
1069118001 10:64532309-64532331 AAAACATTATTACACTATGCTGG + Intergenic
1074052240 10:109890435-109890457 CAAACATACATACATGTTGCGGG + Intronic
1075019921 10:118944283-118944305 CAGACATTCTTATAGGTTTCAGG - Intergenic
1077406050 11:2383019-2383041 CACACATGCTCAGAGGATGCTGG - Intronic
1080529176 11:33157784-33157806 CAAAGAGTCCTACAAGATGCAGG - Intronic
1084283842 11:68118910-68118932 CAAACATTTTCACAGGCCGCAGG + Intronic
1084374342 11:68765757-68765779 CAAACATTCTAGCAGGAGACAGG + Intronic
1087238305 11:95746612-95746634 CAGAAATTTTTACTGGATGCTGG + Intergenic
1087736878 11:101843988-101844010 CACACATTTTTAAATGATGCTGG + Intronic
1091842111 12:3628643-3628665 CAAACATTCTTACAGGATGCAGG - Intronic
1094412136 12:30177885-30177907 CATGCATTCTTACAAGAGGCAGG - Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1098098335 12:66985087-66985109 CAAATTTTCTCACAGCATGCTGG + Intergenic
1098911575 12:76214525-76214547 CAAACATATTTACAGGTTTCAGG + Intergenic
1101323586 12:103695512-103695534 AAAACATGCTAACAGGATTCTGG + Intronic
1102670320 12:114613037-114613059 CAACCATTCTCACAGAATGGTGG - Intergenic
1104271679 12:127287984-127288006 CATCGATTATTACAGGATGCTGG - Intergenic
1105495102 13:20923533-20923555 TAAAAATTCTTGCAGGAGGCAGG - Intergenic
1109203672 13:59458401-59458423 TAAAGATTCTTAAAAGATGCTGG + Intergenic
1113767861 13:112892189-112892211 CACACATTCGTGCAGGGTGCAGG - Intergenic
1113781796 13:112981502-112981524 CACACTTCCTTACAGGATGGGGG - Intronic
1115448379 14:33518159-33518181 CAAGCATGCTAAGAGGATGCAGG + Intronic
1115731709 14:36276287-36276309 CACACATCCTTTGAGGATGCAGG + Intergenic
1126387046 15:48104244-48104266 CAAACAATCTTACAGAATATTGG - Intergenic
1127245182 15:57164985-57165007 CAAGAATTCTTACATGTTGCTGG + Intronic
1130747996 15:86676711-86676733 CAAATCTTCTTGTAGGATGCTGG - Intronic
1136091587 16:27924443-27924465 CATACATTTTTACATCATGCAGG + Intronic
1138461715 16:57152622-57152644 CTCACATTGTTACAGGAGGCAGG - Exonic
1141349713 16:83283176-83283198 CAAACATTCAGCCAGGATGGAGG - Intronic
1142963856 17:3568437-3568459 TAAGCATTATTACAGGATGCAGG + Intronic
1143997677 17:11021884-11021906 CTAACATGCTAACAGGATTCTGG + Intergenic
1149612893 17:57970569-57970591 AAGACATTCTTTCAGGATACAGG + Intergenic
1150065620 17:62106512-62106534 AACACATTACTACAGGATGCTGG - Intergenic
1152975359 18:211722-211744 CAAACATTTTTCCAGGAAGGTGG + Exonic
1156056639 18:33013282-33013304 GATACATTCTTTCAGGATCCAGG + Intronic
1159400685 18:67929695-67929717 TAAACATTTTTTCAGCATGCAGG - Intergenic
1161268508 19:3376105-3376127 CAGACAATCTTCCAGGAAGCAGG - Intronic
1166155357 19:40907736-40907758 GAAACATTCTGAGAGAATGCTGG - Intergenic
1168646226 19:58060648-58060670 CTGACATTCCTACAGGAGGCTGG - Intronic
925481624 2:4281721-4281743 CAAACAATCTTACACGTTTCTGG - Intergenic
932096789 2:68857425-68857447 CAAACATTCTGCCAGGGTCCTGG - Intergenic
933478988 2:82830620-82830642 CAAACATTCATGCAAGATGAAGG + Intergenic
934488684 2:94741452-94741474 TAAACATTTTTACAGTATCCAGG - Intergenic
935353956 2:102180811-102180833 GAAACATTCTTTCAGGTTGGGGG - Intergenic
942589309 2:177524105-177524127 CAAACGTTTTTAAAGGATGATGG + Intronic
943251717 2:185530038-185530060 CAGACATACTTGCTGGATGCAGG + Intergenic
948287451 2:236797153-236797175 CAAAGCTTCTTACAGCAGGCAGG - Intergenic
948431125 2:237919731-237919753 CAGACACTCTGACAGGAGGCCGG + Intergenic
1170445456 20:16422568-16422590 CAAACATCCATACTGGCTGCTGG - Intronic
1174539736 20:51279566-51279588 CAAACATTGCTACATGAGGCCGG + Intergenic
1175063147 20:56262038-56262060 CACTCATTCTTGCAGGCTGCAGG + Intergenic
1176661541 21:9639911-9639933 CTAACATTTTTGCAGGCTGCTGG - Intergenic
1178976262 21:37223777-37223799 CAAACACTGTTTCAGGATACTGG + Exonic
1181962963 22:26636244-26636266 CAAACACTGTTACAGGTTCCAGG + Intergenic
1183004193 22:34886966-34886988 CAAAGAATCTTAGAGGATTCTGG + Intergenic
1183178821 22:36244842-36244864 CACACATTATTACATGATGTGGG + Intergenic
1184825711 22:46949451-46949473 CAAACATTGTGGCAGGAGGCAGG - Intronic
949418628 3:3840678-3840700 CATACATTCTTATAGAATGTAGG + Intronic
956173319 3:66450322-66450344 CAAACACTCCCACAGAATGCTGG + Intronic
960804153 3:121566731-121566753 CAACCATTCTAACAGAAGGCTGG + Intergenic
965049005 3:163619656-163619678 TAAACATCCTTATATGATGCTGG - Intergenic
965797424 3:172455584-172455606 TATACATTCTTACAGCTTGCTGG - Intergenic
966980758 3:185133198-185133220 CAGGCATTCTTACATGTTGCTGG + Intronic
969283661 4:6189072-6189094 CAAACCTTCTTTCTGGATGTTGG - Intronic
969957045 4:10901610-10901632 AAAAGATTCTTACAGGCAGCAGG + Intergenic
970442748 4:16096185-16096207 AAAATATTCTTACAGCATGAAGG + Intergenic
971603845 4:28631538-28631560 TAAACATTTTAACAGGAAGCAGG + Intergenic
971871551 4:32246373-32246395 CAAACATTTTTTAATGATGCTGG + Intergenic
973133816 4:46681057-46681079 AAAGCATTCTTAGAGGAAGCCGG - Intergenic
973830732 4:54756374-54756396 CAAACATTCTAACAGTTTTCAGG + Intergenic
978419979 4:108521416-108521438 CAAAGATTGTGACAGTATGCTGG + Intergenic
979815939 4:125104084-125104106 CAAACATTTTTACAGGGAGATGG + Intergenic
981906629 4:149928565-149928587 CAAACATTTTTACAAGATTTAGG + Intergenic
981942862 4:150303874-150303896 CAAAGATTCTTAAAGGGTGAGGG - Intronic
985413854 4:189716636-189716658 CTAACATTTTTGCAGGCTGCTGG + Intergenic
986204476 5:5610696-5610718 TAGACATTCCTACAGGAGGCAGG + Intergenic
986204489 5:5610768-5610790 TAGACATTCCTACAGGAGGCAGG + Intergenic
986204501 5:5610840-5610862 TAGACATTCCTACAGGAGGCAGG + Intergenic
986204514 5:5610912-5610934 TAGACATTCCTACAGGAGGCAGG + Intergenic
990285306 5:54295829-54295851 GAAACATTCATACAGGAAGAAGG + Intronic
994150482 5:96441891-96441913 CAAACCTTCCCACAGGAAGCTGG - Intergenic
997689611 5:135817824-135817846 CAAACAATCTTACAAGAAGTGGG + Intergenic
998719431 5:144927583-144927605 CAGACATTCCCACAGGATCCAGG + Intergenic
1001223253 5:169921581-169921603 CAGACATCTTTACTGGATGCAGG - Intronic
1002714852 5:181220475-181220497 AAAACATTCTTAAAGGATTCTGG - Intergenic
1004400491 6:15284001-15284023 TAAACATACTTAAAGGAGGCTGG - Intronic
1004832208 6:19489549-19489571 CAAAAATTTATACATGATGCAGG + Intergenic
1008027480 6:46653934-46653956 CTGACCTTCTTACAGGCTGCTGG + Intronic
1008132692 6:47736998-47737020 GAAACATCTTTACAGGCTGCGGG - Intergenic
1008477714 6:51950102-51950124 CAAAAATGTTCACAGGATGCAGG + Intronic
1008755102 6:54785567-54785589 TAAAAATTCTTACTGGGTGCCGG - Intergenic
1013585462 6:111574845-111574867 AAAACATTCATACAAAATGCTGG + Intronic
1013946810 6:115731371-115731393 CAAACATTTTTTTTGGATGCAGG - Intergenic
1015582350 6:134739466-134739488 TAAACATTCTTCCAGGTTGTAGG - Intergenic
1018436567 6:163764777-163764799 CAAACATCCTCACTGGCTGCAGG + Intergenic
1021079438 7:16346681-16346703 CAAACATTAGTACAGTAAGCTGG - Intronic
1021326805 7:19280834-19280856 GAAACATTCTTATAGGCTGCTGG - Intergenic
1027141230 7:75659179-75659201 CAAACATTTTTGCAGGCTTCAGG - Intronic
1027513683 7:79114609-79114631 CAAGCATGCTTACAGAATGTTGG - Intronic
1033386060 7:140876373-140876395 CAAACAATCTAAAAGAATGCAGG + Intronic
1033775005 7:144599932-144599954 CAAACATGCTTACATGAAACTGG - Intronic
1034886509 7:154802936-154802958 CAAACATTCCAGCAGGAAGCAGG + Intronic
1040896402 8:52373398-52373420 CAAAAATTAATACAGGATGGTGG - Intronic
1043930101 8:86081195-86081217 CAAACATTAGTTCAGAATGCAGG + Intronic
1046283529 8:112065499-112065521 GAAACATGCTTACAGCATCCAGG - Intergenic
1052959223 9:34280325-34280347 CATAAACTCTTCCAGGATGCAGG + Intronic
1053048654 9:34940331-34940353 CACACTCTCTTACAGGATTCAGG - Intergenic
1053669097 9:40342907-40342929 TAAACATTTTTACAGTATCCAGG + Intergenic
1053918898 9:42969155-42969177 TAAACATTTTTACAGTATCCAGG + Intergenic
1054380237 9:64482940-64482962 TAAACATTTTTACAGTATCCAGG + Intergenic
1054451692 9:65406725-65406747 CCAACATCCTTCCAGGAGGCAGG + Intergenic
1054515514 9:66033383-66033405 TAAACATTTTTACAGTATCCAGG - Intergenic
1058542597 9:106027445-106027467 CAAACTTTCTCACAGGATCAGGG - Intergenic
1058859293 9:109099071-109099093 CAAACATGCTTATTGGAAGCAGG + Intronic
1059876520 9:118641379-118641401 GAAACATTCTTACAGCCTACTGG + Intergenic
1203639104 Un_KI270750v1:141754-141776 CTAACATTTTTGCAGGCTGCTGG - Intergenic
1186314767 X:8357172-8357194 GAAACATTTTAGCAGGATGCAGG + Intergenic
1189237703 X:39500846-39500868 AAAACATTCTTACAACACGCTGG + Intergenic
1194662628 X:96643534-96643556 TAAACAGTCTTACAGGTAGCAGG - Intergenic
1196027341 X:111054882-111054904 TAAACATTGAAACAGGATGCTGG - Intronic