ID: 1091845104

View in Genome Browser
Species Human (GRCh38)
Location 12:3649712-3649734
Sequence CCATGCCAGGCACTGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 1, 2: 7, 3: 74, 4: 487}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091845104_1091845108 3 Left 1091845104 12:3649712-3649734 CCTCAACACAGTGCCTGGCATGG 0: 1
1: 1
2: 7
3: 74
4: 487
Right 1091845108 12:3649738-3649760 TGTAATCAGCAAATAGTTGTAGG 0: 1
1: 0
2: 2
3: 35
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091845104 Original CRISPR CCATGCCAGGCACTGTGTTG AGG (reversed) Intronic
900097074 1:944133-944155 CCTTCCCAGCCTCTGTGTTGAGG + Exonic
900345490 1:2208476-2208498 CCAGGCCAGGCACTGCCCTGCGG - Intronic
900630900 1:3634635-3634657 TCGTGCCAGGCACTGTGCTCTGG - Intronic
901739220 1:11331188-11331210 CTGTGCCAGGCTCTGTGTCGAGG + Intergenic
902623525 1:17664095-17664117 CCATGCCATGCACTGGGTGCTGG - Intronic
903325966 1:22568707-22568729 AAATGCCAGGCACCGTGCTGGGG + Intronic
903330132 1:22593036-22593058 CCATGCCGGGCCCTGGGCTGGGG + Intronic
903752690 1:25636862-25636884 CCATGCCTGGCCGAGTGTTGTGG - Intronic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
903856432 1:26340245-26340267 GCATGCAAGGCACTGTGCTAAGG + Intronic
904448105 1:30590828-30590850 CCATGCCTAGCACAGAGTTGGGG - Intergenic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
905186432 1:36200375-36200397 GCATGCCAGGCACTGGGCTAGGG - Intergenic
905318944 1:37101967-37101989 CTATGCCAGGCACTGAGTTAGGG - Intergenic
905485515 1:38293019-38293041 CCAAGCCAGGCCCTGGGCTGGGG - Intergenic
905527512 1:38650067-38650089 TTATGCCAGGCACAGTGCTGGGG + Intergenic
905805847 1:40877069-40877091 CTATCCCAGGCACTGTTTTAAGG + Intergenic
905924134 1:41737919-41737941 ACTTGCCAGGCCCTGTGCTGGGG + Intronic
906151484 1:43590384-43590406 CAATGCCAGACATTGTGCTGGGG - Intronic
906303635 1:44702180-44702202 ACATGCCAGCCACTGTGTTAGGG + Intronic
906704727 1:47886711-47886733 CACTGCCAGGCCCTGTGTTAGGG + Intronic
907049349 1:51319097-51319119 ACATGCCAGGCACTGTCCTAAGG + Intronic
907310687 1:53537333-53537355 GCACGCCAGGCACTGTGCTGGGG - Intronic
907372739 1:54013785-54013807 TGAAGGCAGGCACTGTGTTGGGG + Intronic
907392789 1:54169142-54169164 CCGTGCCAGGTGCTGTGTTTGGG + Intronic
907395211 1:54184987-54185009 CTGTGCCAGGCACCATGTTGAGG + Intronic
907427291 1:54388423-54388445 CCAGGCCAGGCACTGTGTGTGGG - Intronic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
909277801 1:73710168-73710190 CCTTGCCTGGCATTGTGCTGTGG + Intergenic
910239276 1:85069008-85069030 TCATGCTATGCACTGTGGTGTGG - Intronic
911949573 1:104155034-104155056 CGAGGCCAGGAACTCTGTTGGGG - Intergenic
912429035 1:109619594-109619616 TCGTGCCAGGCACTGTGTAAAGG + Intronic
912728634 1:112081560-112081582 ACATGCCAGGCACTCTGATAAGG + Intergenic
912826086 1:112904791-112904813 CCATGTCAGGCACTATGCTAAGG + Intergenic
913075950 1:115340431-115340453 ATATGCCAGGCACTGTGTGCTGG + Intergenic
914803695 1:150977452-150977474 CCATGCCAGCCTGCGTGTTGGGG - Intergenic
914830067 1:151164855-151164877 TTATGCCAGACACTGTGCTGAGG - Intronic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
915090414 1:153420223-153420245 CCAGGCCAGGCAGTGTGTTATGG + Exonic
915095077 1:153456870-153456892 CCAGGCCAGGCAGTGTGCTATGG - Intergenic
915443543 1:155961748-155961770 CCTTGCCAGGCACTGGGGTTTGG + Exonic
916045870 1:160999580-160999602 CCATGCCAGGCCCTGGGATGGGG + Intronic
916484048 1:165242150-165242172 GCATGCCAGGCACCATGTTAGGG + Intronic
916498129 1:165363827-165363849 TTATGCAAGGCACTGTGCTGAGG - Intergenic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
917635064 1:176927656-176927678 ACATGCCAGGCACTGTGTCAGGG + Intronic
917813384 1:178682832-178682854 CAATGCCAGGCACTGCGCTAGGG + Intergenic
918250619 1:182699939-182699961 CCAGGGCAGGCACTGTGTGAGGG - Intergenic
918466928 1:184830043-184830065 CTATGCCGGGCAATGTGCTGGGG - Intronic
919210104 1:194471461-194471483 TGAGGCCAGGCACTGAGTTGGGG - Intergenic
919592476 1:199521745-199521767 AAATGCTAGGCACTGTTTTGGGG - Intergenic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
920926730 1:210348533-210348555 ACATCCCAGGCACTGTGCTAGGG + Intronic
921290475 1:213652233-213652255 ACGTGCCTGGCACTGTGTTAAGG + Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923094951 1:230767729-230767751 CCATTCCAGGCACTATGCTGGGG + Intronic
923094956 1:230767761-230767783 GCATTCCAGGCACTATGCTGGGG + Intronic
923497879 1:234540743-234540765 GAGTGCCAGGCACTGTGCTGGGG - Intergenic
924225338 1:241917299-241917321 CCATGTGAGGCACTGTGCTGGGG - Intergenic
924300612 1:242633833-242633855 CTCTGTCAGGCACTGTGCTGAGG + Intergenic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
1062990463 10:1809877-1809899 CCAGGACAGCCACTGTGGTGAGG + Intergenic
1063019562 10:2114292-2114314 CCCTGCTGGGCACTGTGCTGGGG - Intergenic
1063046029 10:2393164-2393186 CCATGCCAGCCACCCTCTTGAGG - Intergenic
1064979035 10:21147924-21147946 CCATGCCAAGCATTGTCTTTAGG + Intronic
1065584242 10:27201974-27201996 ACATGCCAGACACTGTTTTGGGG + Intronic
1065841751 10:29707761-29707783 ATATGCCAGGCACTGTGCTAAGG + Intronic
1065849231 10:29772884-29772906 AGATTCCAGGCCCTGTGTTGTGG + Intergenic
1065863887 10:29896447-29896469 ATGTGCTAGGCACTGTGTTGAGG + Intergenic
1066329716 10:34407253-34407275 CAATGCCAGGCAGTCTGTGGGGG - Intronic
1067053360 10:43037764-43037786 CCCTGCCAGGCACGAGGTTGGGG - Intergenic
1067849126 10:49743929-49743951 CCCTTCGAGGCACAGTGTTGGGG + Intronic
1068934278 10:62621019-62621041 ACGTGCCTGGCACTGTGCTGGGG + Intronic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1069915808 10:71786009-71786031 ACACTCCAGGCACTGTGCTGAGG - Intronic
1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG + Intergenic
1071685631 10:87752434-87752456 CTGTGCCAGGCACTATGCTGAGG + Exonic
1071794747 10:88991933-88991955 CTATGCCTGGCACTTTGTTGGGG - Intronic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1072802292 10:98400685-98400707 CCATGCCAGGGACTGTACTAGGG + Intronic
1072961306 10:99931843-99931865 CCATGCCAGGGACTTTGCTTTGG - Intronic
1073029672 10:100515601-100515623 ACATGCCAGACACTGTGCTAGGG - Intronic
1074773324 10:116747631-116747653 GCAAGCCAGGCACTGGGCTGTGG - Intergenic
1074869833 10:117567896-117567918 CAATGCCTGGCATTGTGTGGTGG + Intergenic
1075016107 10:118910921-118910943 CCAGGCCAGGCAGTGGGGTGAGG + Intergenic
1075344582 10:121672919-121672941 CCATGGGAGGCGCTGTGGTGGGG + Intergenic
1075517127 10:123118169-123118191 CCAGTCCAGGCACTGGGTGGCGG - Intergenic
1075532528 10:123241867-123241889 GCGTGCCAGGCACTGTTCTGGGG + Intergenic
1076316586 10:129546290-129546312 CCCTGCCAGCCGCTGTCTTGAGG - Intronic
1076781435 10:132726936-132726958 TCATGCCTTGCTCTGTGTTGAGG + Intronic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078444060 11:11390952-11390974 ACATGCCAGGCATTGTCTTGTGG - Intronic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1080081934 11:28231098-28231120 CAATTCCAGACACTGTTTTGGGG + Intronic
1080646022 11:34188291-34188313 ACATGCCTGGGACTGTGCTGAGG + Intronic
1080989385 11:37511895-37511917 CCCAGCCAGGCCCAGTGTTGAGG + Intergenic
1081660814 11:44887328-44887350 ACAGGCCAGGCACTGGGTTAAGG - Intronic
1081737550 11:45414491-45414513 AAATGCCAGGCTCTGTGCTGAGG + Intergenic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1082629581 11:55526165-55526187 ACATGCCAGGGACTGTTGTGGGG - Intergenic
1082928048 11:58571743-58571765 ACATGCCAGGCACTGTGCTCAGG + Intronic
1083146854 11:60766453-60766475 CTATGCTAAGCACTGTGCTGGGG - Intronic
1083581216 11:63826793-63826815 TCATGCCAGGCACTGGGCTGTGG + Intronic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1085043273 11:73339234-73339256 AGATGCCAAGCACTGTGCTGGGG - Intronic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085374276 11:76044343-76044365 CCATGTCAGGCTCTGTGTGCTGG - Intronic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1088085000 11:105966936-105966958 CCATTCTAGGCACTGTCTTAAGG + Intronic
1088595466 11:111437397-111437419 TCCTGCCAGGAACTGGGTTGGGG + Intronic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1090589487 11:128250280-128250302 CCATGGAGGGCACTGAGTTGGGG - Intergenic
1090607557 11:128437134-128437156 GCTTGCCAGGCACTCTGTTCTGG + Intergenic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1093066593 12:14664881-14664903 CATTCCAAGGCACTGTGTTGGGG + Intronic
1095160747 12:38912224-38912246 GAAAGCCAGCCACTGTGTTGTGG - Intergenic
1095282817 12:40375762-40375784 ATAGGCCAGGCACTGTGTGGTGG - Intergenic
1095736799 12:45566441-45566463 CTGTGCCAGGCATTGTGTTAAGG + Intergenic
1095850522 12:46798726-46798748 ACATGCCAGCCACTGTTTTAAGG + Intronic
1095947665 12:47763023-47763045 TCATGCCAGACACTGTGCTGGGG - Intronic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1098150564 12:67542127-67542149 GGATGCCAGACACAGTGTTGAGG - Intergenic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1098929882 12:76398964-76398986 CCAGGCCAGGCAACGTGTTGGGG + Intronic
1099195514 12:79610083-79610105 CCTAGCCAGGCACTTTGGTGTGG - Intronic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1099981870 12:89613459-89613481 GAATGCCAGGCACTGTGCTTAGG + Intronic
1100587968 12:95996877-95996899 CTATGCCAGGTGTTGTGTTGAGG - Intergenic
1101579967 12:106033751-106033773 CCATGCCAGCCACTGGGCTAGGG + Intergenic
1102347479 12:112169167-112169189 CCATGAGAGGCAGGGTGTTGGGG - Intronic
1102396981 12:112594583-112594605 CCATGCTAGGACCTGTGCTGGGG + Intronic
1102507255 12:113391446-113391468 ACATGCCAGGCACTGTTATGAGG + Exonic
1102532865 12:113559581-113559603 GCATGCCAAGGACTGTGGTGGGG - Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1104787820 12:131461226-131461248 CACTGCCAGGGACTGTGCTGAGG - Intergenic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105643214 13:22287548-22287570 CAAGCTCAGGCACTGTGTTGAGG + Intergenic
1105706339 13:22969712-22969734 CCATGCCAGGCACTGGCTCTTGG - Intergenic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1105858988 13:24393170-24393192 CCATGCCAGGCACTGGCTCTCGG - Intergenic
1105958198 13:25303817-25303839 CTATGCCAGGCACTGTCCTTGGG - Intronic
1106322555 13:28655767-28655789 GTATGCAAGGCACTGTGCTGTGG + Intergenic
1106559564 13:30836664-30836686 GCACGCCCGGCACTGTGTTAGGG - Intergenic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1106698558 13:32204821-32204843 ACATGCTAGGCACTGTGCTTGGG + Intronic
1107339075 13:39386955-39386977 CCAGGAAAGGCAATGTGTTGAGG - Intronic
1108364348 13:49694911-49694933 CCGTGCCAGGTACTGTGCTATGG - Intergenic
1108380125 13:49847202-49847224 TCATGCAAGGCTCTGTGCTGTGG - Intergenic
1108884717 13:55165627-55165649 CCAGCCAAAGCACTGTGTTGGGG - Intergenic
1109440907 13:62371911-62371933 CACAGCCAGGCACTGTGTTATGG + Intergenic
1110439018 13:75507302-75507324 GCATGCCAGCTGCTGTGTTGGGG + Intergenic
1112607445 13:100920912-100920934 CTATGCCAGGTACTGGGTGGGGG + Intergenic
1113104770 13:106760098-106760120 ACATGCCAGGCTCTGAGCTGAGG - Intergenic
1113415588 13:110126054-110126076 CCGTCTCAGGCACTGTGCTGGGG + Intergenic
1113476931 13:110590612-110590634 ACCTGCCAGGCATTGTGCTGAGG - Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1113975839 13:114226680-114226702 CCATTTCAGCCACTGTTTTGAGG - Intergenic
1114018095 14:18450510-18450532 ACATTCCAGCCACTGTGTTCTGG + Intergenic
1114669800 14:24403637-24403659 ACATGCCAGGCACTGTTTTAGGG - Intronic
1115494480 14:33989212-33989234 CCACCCAAAGCACTGTGTTGAGG + Intronic
1117024795 14:51608456-51608478 TCATGCCAGGCATTGTGTTAAGG - Intronic
1117718012 14:58600417-58600439 GCCTGCCAGGCTATGTGTTGTGG - Intergenic
1118055556 14:62076127-62076149 ATATGCCAGGCACTGTGATAAGG + Intronic
1118414591 14:65521813-65521835 ACATGGCAGGCAATTTGTTGTGG + Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119442826 14:74640086-74640108 TCTTGCCAGGCACTGGGTTACGG - Intergenic
1119537439 14:75413934-75413956 GTGTGCCAGGCACTGTGTGGGGG + Intergenic
1120780348 14:88480667-88480689 CCATTCAAGGCACTGGGCTGGGG + Intronic
1121111400 14:91315559-91315581 CCATTCCTGGTACTGTATTGTGG - Intronic
1121295044 14:92813729-92813751 GAATACCAGGCACTGTGCTGGGG - Intronic
1122014685 14:98784701-98784723 CCATGCCAGGCACTGTACTAGGG - Intergenic
1122805286 14:104253382-104253404 CCAGGCCAGGCCCTCTGCTGTGG + Intergenic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124627284 15:31315548-31315570 ACATGCCTGGCACTGTGTCAGGG + Intergenic
1124636448 15:31367759-31367781 ACGTGCCAGGCGCTGTGCTGAGG + Intronic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1125252489 15:37721404-37721426 CCATGCCAGGCTCTGTCTGATGG + Intergenic
1125695447 15:41633279-41633301 ATATGCCAGGCATTGTGTTAAGG + Intronic
1125796303 15:42406470-42406492 ACATTCCAGGCACTGTGCTTGGG + Intronic
1126581482 15:50246186-50246208 CCACCCCAGGCACTGTGCTAAGG + Intronic
1126865452 15:52932318-52932340 AAATGCCAGGCACTTTGCTGGGG + Intergenic
1127922956 15:63507689-63507711 CCATGGAAGGCACTGTGTGTTGG + Intronic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128290759 15:66476705-66476727 CCATGGCAGGCTCTGTGCAGGGG + Intronic
1129337765 15:74863734-74863756 CCATGCCAAGCACTGGGCTAGGG + Intronic
1129537546 15:76326562-76326584 CCATGCCAGGCTATTTTTTGTGG + Intergenic
1130003071 15:80064794-80064816 CCATGCCTGGCAATTTTTTGTGG + Intronic
1130150756 15:81309776-81309798 ACATGCCAAGCACTGTGCTCAGG + Exonic
1130913254 15:88285201-88285223 ACGTGCCAGACATTGTGTTGAGG + Intergenic
1130925060 15:88379160-88379182 ACTTGCCAGGCACTGTGCTATGG - Intergenic
1130938823 15:88491203-88491225 GCATGGCAGTCACTGTGCTGGGG + Intergenic
1130969364 15:88720155-88720177 GCATGCCAGGCTCTGTGCTATGG + Intergenic
1130969708 15:88722275-88722297 ACATGCCAAGCACTGTGCTAAGG - Intergenic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1131510965 15:93049240-93049262 CCATGCCAGGCCTGGTGCTGGGG + Intronic
1131563247 15:93462551-93462573 CCACGCCAGGGACTGTGGGGAGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1131960870 15:97789032-97789054 CTATGCCAGGCTTTGTGCTGAGG - Intergenic
1132238061 15:100236892-100236914 CCATTCCTGGCTCTGTTTTGGGG - Intronic
1132621687 16:870869-870891 CCCTGCCAGGCTCCGTGGTGCGG - Exonic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1133893958 16:9907931-9907953 ACATGCCAGACACTGTGCAGGGG - Intronic
1134661804 16:15989823-15989845 GCATACCAGGCACTGCGTTCAGG - Intronic
1135357156 16:21778948-21778970 CCATACCAGGGACTGGGGTGGGG + Intergenic
1135455660 16:22595064-22595086 CCATACCAGGGACTGGGGTGGGG + Intergenic
1136033202 16:27518456-27518478 CCATGCCAGGCGCTGTCCTAAGG - Intronic
1136374490 16:29857263-29857285 GCATGCCAGACTCTGTGCTGCGG - Intergenic
1137019126 16:35406125-35406147 CCATGAAAGGCCCTCTGTTGTGG + Intergenic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1138240059 16:55420202-55420224 CTATGCCAGGAACTGTAATGAGG - Intronic
1138444222 16:57053381-57053403 CCCTGCCAGTCACTGTGCTCTGG - Intronic
1138451400 16:57095166-57095188 CCCTGCCAGACACGGTGGTGTGG + Intronic
1138508505 16:57493014-57493036 CCATGCCCGGCCCTGTATTAAGG + Intergenic
1138607570 16:58098746-58098768 CTGTGCCAGGCACTGTCCTGGGG + Intergenic
1139503967 16:67389903-67389925 CCATGCCTGGGGCTGGGTTGGGG + Exonic
1139612407 16:68068545-68068567 ACATGCCAGGCACTGTGCCAAGG - Intronic
1140137341 16:72218894-72218916 ACATGCCATGCCCTTTGTTGGGG - Intergenic
1140734756 16:77888341-77888363 CCATGCCAGGCACTGGGGTCTGG - Intronic
1141159369 16:81618825-81618847 ACGTGCCAGGCACCGTGCTGAGG + Intronic
1141185512 16:81784246-81784268 CTATGCCAGGCACTGAGGTGGGG - Intronic
1141242258 16:82274826-82274848 CCATGCCAGGCACACAGCTGTGG + Intergenic
1141518118 16:84559825-84559847 TCACGCCAGGCACTGGGATGGGG + Intergenic
1141548971 16:84791863-84791885 CAATGCCTGGCACAGAGTTGGGG - Intergenic
1141791930 16:86242907-86242929 GCCTGCCTGGCACAGTGTTGGGG + Intergenic
1142211301 16:88809896-88809918 CCAGGCCAGCCCCTGGGTTGGGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1143100884 17:4504084-4504106 CTAAGCCAGGCCCTGTCTTGTGG + Intronic
1143457563 17:7077864-7077886 CAATGCAGGGCACAGTGTTGGGG - Intronic
1144628743 17:16858842-16858864 CCAGGTCACACACTGTGTTGGGG - Intergenic
1144652664 17:17017248-17017270 CCAGGTCACACACTGTGTTGGGG + Intergenic
1144930148 17:18852389-18852411 TCATGCCAGGCCCAGTGCTGAGG - Intronic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1146419931 17:32674143-32674165 CCTTGACTGGCACTGTGTGGGGG + Intronic
1146787019 17:35729718-35729740 ACATGCCAGGCATTGTGTTAAGG + Intronic
1147531400 17:41281586-41281608 CCATGACAGGCCCTGGGGTGTGG - Intergenic
1147916841 17:43892938-43892960 ACATACCAGGCACAGTGCTGGGG - Intronic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148552914 17:48561241-48561263 CCCTGCCAGGCACTGGGCTAAGG - Intronic
1148677147 17:49452076-49452098 CCATTACAGGAAGTGTGTTGGGG + Intronic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1150521477 17:65871354-65871376 GCAGGCCGGGCACTGTGCTGTGG + Intronic
1151296374 17:73189489-73189511 CCGGGCCAGGCACTGTGCCGGGG - Intergenic
1152070255 17:78130775-78130797 CCAAGCCAGGCAGGGTGGTGAGG - Exonic
1152178020 17:78800578-78800600 CCATGGAAGCCACTGTGTGGGGG - Intronic
1152620938 17:81364532-81364554 CCAGGACAGGGGCTGTGTTGGGG + Intergenic
1152631892 17:81414199-81414221 CCATGGCAGGACCTGTGCTGGGG + Intronic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1153263425 18:3246000-3246022 CATTGCCAAGCACTGTGGTGGGG - Intergenic
1153431752 18:5025043-5025065 CCATGGCATGCACAGGGTTGGGG - Intergenic
1153524867 18:5985455-5985477 ACATGCCAGGCACTGTTGTAAGG + Intronic
1153846526 18:9054622-9054644 CCTTGCTAGGCACTGTGATTTGG - Intergenic
1155073955 18:22339174-22339196 TCATGCCAGGCACTTGGCTGAGG - Intergenic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1156801947 18:41126240-41126262 AAATTCCAGTCACTGTGTTGGGG - Intergenic
1157042785 18:44060385-44060407 GCATGCCTGGCTCTGTGTGGTGG - Intergenic
1157208311 18:45719308-45719330 CCTTGCCATGCTCTTTGTTGAGG - Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG + Exonic
1160038240 18:75320791-75320813 CAATGCCAGGCACTGTGAATTGG - Intergenic
1161285607 19:3466883-3466905 CCATACCAGGCAGCATGTTGTGG + Intronic
1161482763 19:4519021-4519043 GTATGCCAGGCACTGTTCTGTGG - Intergenic
1161609283 19:5231915-5231937 CCATGCCAGAAACTGGGTGGGGG + Intronic
1161609634 19:5234680-5234702 GCGTGCCAGGCACTGTGCTAAGG + Intronic
1161673176 19:5625663-5625685 TGATGCCAGGCACTGTGCTGAGG + Intronic
1161778732 19:6278190-6278212 CCAGGCCAGGAAAGGTGTTGTGG - Intronic
1162104205 19:8360348-8360370 ATATGCCAGGCACTGTACTGGGG - Intronic
1163129700 19:15264839-15264861 CAAAGCCAGGCCCTGTCTTGGGG + Intronic
1163157116 19:15445638-15445660 ACATGCCTGGCATTGTGTTGGGG - Intronic
1164437051 19:28239528-28239550 GCATGCCAAGCCCTGTGCTGTGG - Intergenic
1164485669 19:28653721-28653743 AAATGCCAGGCACTGTTTTCTGG + Intergenic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1164925001 19:32123789-32123811 GCATGCCAGGTGCTGTGCTGTGG - Intergenic
1165834562 19:38746213-38746235 CCATGCCCGGCCCTGTTTTGGGG - Intronic
1165863607 19:38922498-38922520 CCATGCCAGGCTCTATGTACAGG + Intronic
1165953487 19:39487880-39487902 CCATGCCTGGCCCTCTGTGGGGG + Intronic
1166194682 19:41198003-41198025 CCATTCCAGGACCTGGGTTGGGG - Intronic
1166320556 19:42015947-42015969 CTATGCTAGGCACTGGGATGGGG + Intronic
1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG + Intronic
1166971927 19:46574636-46574658 CCACGCCACACACTGTGATGTGG + Intronic
1167301164 19:48678572-48678594 CAATGCCAGGCACGGTGCTCAGG - Intergenic
1167808732 19:51809852-51809874 CCATGCCTGGAACGGGGTTGAGG + Intronic
1168281651 19:55309037-55309059 AGATGACAGGCTCTGTGTTGGGG + Intronic
925089531 2:1142450-1142472 CCATCCCAGGAACTCTGCTGTGG - Intronic
927140471 2:20126827-20126849 CCATGCCAGGGTCTATGTTAGGG + Intergenic
927199353 2:20568727-20568749 ATAGGCCAGGCCCTGTGTTGGGG + Intronic
927694172 2:25229267-25229289 CCTTACCAGGCCCTGTGCTGGGG - Exonic
927865060 2:26582950-26582972 CCATGTCAGGCAGTGAGGTGGGG + Intronic
927904221 2:26846039-26846061 CTATGCCAGGCAATGTGCTATGG + Intergenic
929093411 2:38241660-38241682 ACATGCCAGGCACTATGCTAAGG + Intergenic
929428197 2:41865090-41865112 CAATGCCAGCCCCTGGGTTGTGG - Intergenic
932886630 2:75554718-75554740 GGGTGCCAGGCACTGTGTTAGGG - Intronic
934780925 2:96969166-96969188 CCATGCCAGGCTCTGGATAGTGG - Intronic
934851991 2:97707435-97707457 CCATGCCAGGCACAGTGCCCTGG + Intergenic
935697655 2:105784043-105784065 CAATGCCACGCATGGTGTTGAGG - Intronic
936105426 2:109620126-109620148 ACATGCCAGGCACTGTGCAAGGG - Intergenic
936797838 2:116228406-116228428 ATATGCCAGGAACTGTGCTGGGG + Intergenic
936987143 2:118322191-118322213 CCATGCCATGCACTGTGCAAAGG + Intergenic
937096478 2:119238884-119238906 CCATGCCTGGCACACTGTAGAGG - Intronic
937442737 2:121930792-121930814 CCATGTCAGGCTCTATTTTGGGG + Intergenic
937750567 2:125472160-125472182 CCAGGGCAGCCACTGTGGTGAGG - Intergenic
937973597 2:127567619-127567641 CCACGCCATGGACTGAGTTGGGG - Intronic
938102987 2:128511167-128511189 CCATGCCTGGCAGTGTCTGGAGG - Intergenic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
939090717 2:137776957-137776979 CCCCGCCAGGCACTCTGCTGAGG - Intergenic
939212155 2:139189910-139189932 ACATGCCAGACACAGTGTTTAGG + Intergenic
940067949 2:149650858-149650880 ACATGTCAGGCACTGGCTTGTGG + Intergenic
940825227 2:158404103-158404125 CTATACCAGGCACTGTGTTAAGG - Intronic
941310016 2:163915703-163915725 ATATGCCAGGCAATGTGCTGAGG - Intergenic
942335306 2:174878070-174878092 CGATGGCAAGCACTTTGTTGGGG - Exonic
945010981 2:205463357-205463379 CCTGGCCAGGCACTGCCTTGCGG + Intronic
946070657 2:217031946-217031968 CCACTCCAGGCTCTGTGCTGTGG - Intergenic
947015210 2:225611767-225611789 GAATGCCAGGCACTGTGATCTGG - Intronic
948063116 2:235056477-235056499 CCATGCAGGGCACTTTGTTACGG - Intergenic
948097593 2:235348804-235348826 ACATGCCAAATACTGTGTTGAGG + Intergenic
948903871 2:240968758-240968780 ACATGCCAGGCTTTGTGCTGGGG + Intronic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168955580 20:1832259-1832281 CCATGCAAGGAACCGTGCTGGGG + Intergenic
1169409510 20:5355607-5355629 CTATCCCCAGCACTGTGTTGAGG + Intergenic
1169411479 20:5374215-5374237 GTATGCCAGGCACTGTTTTAAGG - Intergenic
1170879926 20:20287970-20287992 ATATGCCAGGCACTGTGTGAGGG - Intronic
1170903483 20:20488844-20488866 TCATGCCAGGTACTGTGTCAAGG - Intronic
1170907734 20:20530860-20530882 CTCTGCCAGGCGCTGTGCTGAGG - Intronic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172579381 20:36034848-36034870 CCATACCAAGCACTGTGTGGGGG + Intergenic
1172624912 20:36341418-36341440 ACATGCCAGGCACTTTGCTAGGG - Intronic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1172994981 20:39064136-39064158 CCATGCCTGGCCCTGTGCTGTGG + Intergenic
1173099832 20:40075587-40075609 ACATGCCAGGCACTATTCTGTGG + Intergenic
1173332768 20:42088853-42088875 CCATGCCTGGCACTGTGGTAAGG - Intronic
1173385683 20:42585572-42585594 ACATGCCAGGCACTTTTCTGAGG + Intronic
1173658834 20:44719211-44719233 GCATGCCAGGCCCTGTGCTGAGG + Intronic
1174086611 20:48013284-48013306 CTATGCCAGGCACTTTCTAGGGG - Intergenic
1175072806 20:56348697-56348719 CAATGCCAGGCACAATGCTGGGG - Intergenic
1175078372 20:56395289-56395311 GTATGCCAGGCACTGTGCTCAGG + Intronic
1175361742 20:58416891-58416913 CTATGCCAGCCACAGTGCTGGGG + Intronic
1175421101 20:58834306-58834328 CCATGCCAGCCAGTGAGCTGTGG - Intergenic
1175807125 20:61835853-61835875 TCCTGCCGGGCACTGTGTTAAGG + Intronic
1176244083 20:64089109-64089131 GCATGCCAGGGTCTGTGCTGGGG + Intronic
1176376582 21:6089685-6089707 GCATGGCAGGCACAGGGTTGAGG - Intergenic
1177848688 21:26321269-26321291 CTATGCCAGGCACTGCTTTGTGG + Intergenic
1178244531 21:30937830-30937852 CAAGGCCAGACACTGTGTGGAGG - Intergenic
1179344799 21:40546554-40546576 CCATGCCAGGAGCTGTGCTTGGG - Intronic
1179554615 21:42164247-42164269 CCATGCCAGACACTGGGTCAGGG - Intergenic
1179746893 21:43448559-43448581 GCATGGCAGGCACAGGGTTGAGG + Intergenic
1180135421 21:45859198-45859220 GAATGCCCGGCACTGTGCTGTGG + Intronic
1180442606 22:15381381-15381403 ACATTCCAGCCACTGTGTTCTGG + Intergenic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182022035 22:27089515-27089537 CCATGCCAGGCACTGTCCTAGGG + Intergenic
1182044804 22:27265968-27265990 CGATGCCAGGCTCTGTTTGGTGG - Intergenic
1182392529 22:30010927-30010949 GTATGCTAGGCACTGTGCTGGGG + Intronic
1183088383 22:35502680-35502702 CCAAGCCATGAACTATGTTGTGG + Intergenic
1183224222 22:36538290-36538312 TTATGCCAGGCACTGTGCTATGG + Intergenic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1183310462 22:37106876-37106898 ACCTGCCAGGCACTGGGTTCTGG + Intronic
1184681691 22:46075550-46075572 CCATTCCAGGCACGTTGTCGGGG + Intronic
1184739561 22:46419531-46419553 CCATCCCAGGCACTCTGTCCCGG - Intronic
1184775689 22:46621637-46621659 CCATCCCTGGCAGTGTGTCGCGG + Intronic
1184877146 22:47283097-47283119 CCCTGCCAGGCACAGTTCTGGGG - Intergenic
949506127 3:4729309-4729331 ACATTCCAGCCACTGTGTTAAGG - Intronic
949988022 3:9554429-9554451 TCATGCCAGGCGCTGAGCTGGGG - Intergenic
950105208 3:10384286-10384308 GCATACCAGGCACTGGGCTGTGG - Intronic
950423296 3:12911086-12911108 CCTTGCAAAGCACTGTGTTCCGG + Intronic
950563529 3:13749820-13749842 CACGGCCAGGCACTGTGCTGTGG + Intergenic
950640412 3:14344890-14344912 ACATGCCAGGCATGGTGATGGGG + Intergenic
951188009 3:19736307-19736329 CTATTCCAGGCCCTGTGCTGAGG - Intergenic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952422480 3:33144589-33144611 CCATGCATGGTAGTGTGTTGGGG + Exonic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
952761185 3:36915564-36915586 CTATGCTGGGCACTGTGCTGGGG + Intronic
953369685 3:42376730-42376752 CCAGGGCAGGCACCCTGTTGAGG - Intergenic
953481502 3:43256125-43256147 CTGTGCCAGGCACTGTGAGGGGG + Intergenic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
955118676 3:56032709-56032731 CCCAACCAGGCACTGTGGTGTGG + Intronic
955348729 3:58179175-58179197 CCATGCCAGGCCCCGGGCTGGGG - Intergenic
955378070 3:58414658-58414680 CTCTGCCAGGCATTGTGCTGGGG - Intronic
955406040 3:58626433-58626455 CACTGCCTGGCACTGTGTAGAGG - Intronic
955919009 3:63935044-63935066 ACATACCAGGCACTGTGCTCAGG - Intronic
956050286 3:65240687-65240709 TCATGCCAGGCCTTGTGCTGAGG + Intergenic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
958064698 3:88528576-88528598 CCATGGCAGCAACTGTGTGGTGG + Intergenic
958458240 3:94360298-94360320 ACATGCCAAGCAATGTGTTATGG + Intergenic
958505562 3:94973160-94973182 CCAAGCTAGGCATTCTGTTGAGG - Intergenic
961329436 3:126130058-126130080 CCATGCCAGGCATTGTTGTAAGG - Intronic
961685470 3:128627000-128627022 CCATCCCTGTCTCTGTGTTGTGG - Intronic
961854852 3:129859822-129859844 CCATGTCAGGCACTATGAAGAGG - Intronic
962151181 3:132895056-132895078 ACATGCCAGGGCCTGTGGTGGGG + Intergenic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
962711705 3:138091902-138091924 ACATGCCAGACATTCTGTTGGGG - Intronic
963907373 3:150783761-150783783 CCAAGGAGGGCACTGTGTTGAGG - Intergenic
965072376 3:163931353-163931375 ACATTCCAGGCATTGTGTTCAGG - Intergenic
965754902 3:172015813-172015835 CCGTGTCAAGCACTGTGCTGGGG - Intergenic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
967141893 3:186568494-186568516 CCATGCCAGGCACTGTTCTAAGG + Intronic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967615991 3:191567271-191567293 CCATGCCAGGCACTGTTAGAAGG + Intergenic
968596344 4:1487879-1487901 GCATGCCTGGCATTGTGCTGGGG - Intergenic
968624678 4:1621790-1621812 CCGTCCCTGGCACCGTGTTGGGG + Intronic
969282301 4:6178909-6178931 CCGAGCCAGGCACTGTGCCGGGG - Intronic
969482424 4:7453822-7453844 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482468 4:7454034-7454056 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969708102 4:8823993-8824015 CCATCCCAGCCACTCTGTTTTGG - Intergenic
970174274 4:13322821-13322843 GCATTCCAGGGAGTGTGTTGTGG + Intergenic
970425378 4:15940953-15940975 GCGTGCCAGGCACTGTGCTAAGG + Intergenic
971675745 4:29626402-29626424 CCATGCCAGGCACTGTTGTATGG - Intergenic
972708270 4:41567326-41567348 ACATGCCAGGCATTGTTCTGAGG - Intronic
973177763 4:47228989-47229011 TATTGCCAGGCACTGTGCTGGGG + Intronic
973210125 4:47606084-47606106 CTATGCCAAGCATTGTGTTAGGG + Intronic
973968375 4:56186596-56186618 ACATGCCAGACATTGTGCTGAGG + Intronic
975177779 4:71308226-71308248 CCCTACTAGGCACTGTGTTAGGG - Intronic
978054003 4:104240209-104240231 ATATGCAAGGCACTGTGTTAAGG - Intergenic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
980083929 4:128372152-128372174 CCATGCCAGGCACTGCGTTATGG - Intergenic
980190468 4:129518816-129518838 ATATGCCAGGCACTGTTTTAGGG + Intergenic
980264902 4:130502721-130502743 CTATGCTAGGCACTGTGATAGGG + Intergenic
980414892 4:132473690-132473712 CTATGCCAGTCACTGTGGTATGG - Intergenic
981059379 4:140404951-140404973 CCATGCCAGGCATGGTGGGGAGG + Intronic
981232942 4:142379809-142379831 CCACGTCAGGCACTGTGTAAGGG + Intronic
984090821 4:175373199-175373221 GTATGCCAGGCACTGTGCTATGG - Intergenic
984550172 4:181149965-181149987 CCACCTCAGGCACTGTTTTGGGG + Intergenic
984922595 4:184778685-184778707 ATATGTCAGACACTGTGTTGGGG - Intronic
984929477 4:184834104-184834126 AAGTGCCAGGCACTGTATTGGGG - Intergenic
984989713 4:185368393-185368415 CCATGGCAGGCAGTGTGTTATGG - Intronic
985817170 5:2135617-2135639 CCAGGCCCAGCACTGTGCTGAGG + Intergenic
985843359 5:2326201-2326223 CCATGTCTGGGACTGTGTTTGGG - Intergenic
986182027 5:5401901-5401923 CCAGGCCAGGCACTGCTCTGGGG - Intergenic
986605582 5:9520224-9520246 CCAGGCCAGGCACTGTTGTCAGG + Intronic
986643465 5:9893887-9893909 CCATGTTAGGTACTGTGTTTTGG - Intergenic
987066011 5:14290280-14290302 CCATGCCAGAAACTCTGTGGAGG - Intronic
988180819 5:27789405-27789427 TCGTGCCAGTCACTGAGTTGTGG + Intergenic
988609128 5:32709320-32709342 GGTTGCCAGGCACTGTGCTGGGG - Intronic
989529952 5:42496508-42496530 AAAATCCAGGCACTGTGTTGTGG + Intronic
990355889 5:54965813-54965835 CCATGGCAACCACTGTGTTATGG - Intergenic
991399721 5:66240088-66240110 CCACTTCTGGCACTGTGTTGAGG + Intergenic
991423142 5:66462162-66462184 CAATGCCAGGCACTGTGCTAGGG + Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
992197671 5:74355831-74355853 ACATGCCAGACACTGTACTGAGG - Intergenic
992226597 5:74624890-74624912 CTATGCCAGGGACTGAGTTAAGG - Intergenic
992780764 5:80124910-80124932 CCATCCCTGTCACTGTGTGGAGG + Intronic
992793904 5:80238492-80238514 CCATGCCTGGCTCTGGATTGGGG - Intronic
992822117 5:80507839-80507861 CCATGCAAGGCACTGCTGTGAGG - Intronic
994244075 5:97458868-97458890 ACATGCCAAGCACTGTTTTAAGG - Intergenic
994267656 5:97737757-97737779 CAAGGCCAGGACCTGTGTTGGGG + Intergenic
995500692 5:112803582-112803604 ATATGCCAGGGACTGTGTTAAGG - Intronic
995995356 5:118291739-118291761 CAAAGCAAGGCACTTTGTTGGGG + Intergenic
997375070 5:133391921-133391943 CCATGGCAGGTACAGTCTTGTGG - Intronic
997525421 5:134549910-134549932 CCTTGCCAGGTCCTGTGCTGGGG + Intronic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
998081324 5:139277288-139277310 CCAGGCCAGGCACGGTGCAGTGG - Intronic
998356447 5:141540770-141540792 CCATTTCAGGCCCTGTGTGGTGG + Intronic
998502494 5:142645626-142645648 ACATGCCAGGCATTGTGATAAGG - Intronic
998585548 5:143422853-143422875 TCATTCCAGGCACTGTTTTAAGG - Intronic
998930483 5:147175935-147175957 TCAGGCCACTCACTGTGTTGAGG - Intergenic
1002475289 5:179461758-179461780 CCATGCCAGGTGCTGGGATGTGG - Intergenic
1002962596 6:1930102-1930124 CCATGCCAAGGACTATGTGGAGG - Exonic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1003145381 6:3505847-3505869 CCCTGCCAGCCACTACGTTGTGG - Intergenic
1003171787 6:3726204-3726226 ACTGGCCAGGCACTGTCTTGGGG - Intronic
1005164885 6:22908466-22908488 GCATCCCAGGCACTGTGGTGTGG + Intergenic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006749810 6:36369724-36369746 GTATACCAGGCACTGTGCTGAGG - Intronic
1006967982 6:38009246-38009268 TGATGCCAGGTACTGTTTTGTGG + Intronic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007448983 6:41928883-41928905 CAATGCCAGGCACTGAGTTTGGG - Intronic
1007725870 6:43915252-43915274 ACATGCCAGGCACTGGGCTAGGG + Intergenic
1008328299 6:50214006-50214028 TCATGCCAGGCACTGTTGTAAGG - Intergenic
1008355718 6:50550571-50550593 CTCTGCCAGGGACTGTGTTTGGG - Intergenic
1012850558 6:104441872-104441894 CTACGCCAGGCACTGTGCTAAGG - Intergenic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016553989 6:145314619-145314641 GCATGCAAGGCATGGTGTTGTGG + Intergenic
1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG + Intergenic
1019701307 7:2476112-2476134 CTATGTCTGGCACTGGGTTGGGG - Intronic
1019746082 7:2701046-2701068 CCATCCCAGGCACTGTGCTGCGG + Intronic
1021978925 7:26035910-26035932 CCATGCCAGGCACTGTTTCCTGG - Intergenic
1022473192 7:30694281-30694303 CCATGCCAGGCACTGAGAGGCGG - Intronic
1023367296 7:39476519-39476541 ACAGGCCAGGCACTGTGTAAAGG + Intronic
1023680851 7:42685739-42685761 CTATGCCAGGTATTGTGATGGGG + Intergenic
1024083797 7:45877129-45877151 ACATGCCACACACTGTCTTGAGG - Intergenic
1024393858 7:48844250-48844272 CCCTGCCAAGCACTATGTGGTGG - Intergenic
1025284428 7:57650679-57650701 CCATGCCAGAAACCGTTTTGTGG + Intergenic
1026528176 7:71174061-71174083 CCATGCCTGGCACTGTGCCAGGG - Intronic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1027149047 7:75719557-75719579 ACATGTCAGGCACAATGTTGAGG + Intronic
1029655147 7:101919261-101919283 ACAGGCCAGGCACTGAGCTGAGG - Intronic
1031592693 7:123612559-123612581 CCATGGCTCGCACTGTGTTAAGG - Intronic
1032017047 7:128387076-128387098 CCATTCCAGGGACTGTGCAGAGG - Intergenic
1032875237 7:136031651-136031673 ATATGCCAGGCACTGAGTTAGGG + Intergenic
1034225157 7:149475802-149475824 CCATTCCCTGCACTGTGGTGGGG - Intronic
1034356282 7:150452986-150453008 ACATGCCAGGCACAATGTTAGGG + Intronic
1034512926 7:151551083-151551105 CCACACCAGGCACTGTTCTGGGG - Intergenic
1034588173 7:152114783-152114805 GTATGCCAGGCTCTGTGTTAGGG + Intronic
1034761356 7:153674843-153674865 CCACGCCAGGCACGGGGCTGCGG + Intergenic
1035644696 8:1210161-1210183 CCAGGCCAGGCTCTGTGGAGTGG + Intergenic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1037864610 8:22433273-22433295 GTGTGCCAGGCACTGTGTTAAGG - Intronic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1039799218 8:40939804-40939826 CCATGCCAGATGCTGTGGTGAGG + Intergenic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1040065296 8:43140296-43140318 CCATGCTAGGCCCTGCCTTGAGG - Intergenic
1040516114 8:48136464-48136486 CCCTGCCAGGCAGTGGGTTAGGG + Intergenic
1040941826 8:52842158-52842180 CCAGGCCAGGCACAGCGTGGTGG - Intergenic
1041222090 8:55662125-55662147 ACATACCAGGGCCTGTGTTGGGG + Intergenic
1041361732 8:57061828-57061850 GTGTGCCAGGCACTGTGTTAAGG - Intergenic
1041694432 8:60720822-60720844 ACATGCCAGGCCCTGTGCTAAGG - Intronic
1041727439 8:61031273-61031295 CCATGCCAGGTGTTGTGCTGAGG - Intergenic
1041890898 8:62867374-62867396 CTGTGCTAGGCACTATGTTGAGG - Intronic
1044349875 8:91151238-91151260 ACATGCAAAGCACTGTGTAGAGG - Intronic
1044353592 8:91194996-91195018 ACATGCAAAGCACTGTGTAGAGG - Intronic
1044379693 8:91520071-91520093 ACATTTCAGGCACTGTGCTGGGG - Intergenic
1045566763 8:103324984-103325006 CAATGGCTGGCACTGTGTGGTGG + Exonic
1046273331 8:111924768-111924790 TAATGCCAGGCACTGTGTTAAGG + Intergenic
1046647343 8:116800726-116800748 CTATGCCAGACACTGTTTTAGGG + Intronic
1046751180 8:117928337-117928359 ACATGCCAGGCACTGTGGACAGG - Intronic
1046792210 8:118334278-118334300 TTATGCCAGGTACGGTGTTGAGG - Intronic
1047416148 8:124666284-124666306 ACATGCAAGGCACTGTGCTCAGG + Intronic
1047516014 8:125555465-125555487 GCAGGCCAGGCAGTGTGCTGGGG + Intergenic
1048468109 8:134684208-134684230 CCAAGCCAGGCACTGGTATGGGG - Intronic
1048822345 8:138391710-138391732 CCATGTCAGGCACTGTTCTAAGG + Intronic
1049078565 8:140421638-140421660 CTATGCCAGGCACTGTGCGAGGG + Intronic
1049206668 8:141366776-141366798 CCAAGCCAGGGACAGAGTTGGGG - Intronic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1050566564 9:6890098-6890120 TCATGACAGGCCCTGTGTTGAGG - Intronic
1050654359 9:7809972-7809994 CCATGCCAGGCTCTGAGTGCAGG - Intronic
1050989172 9:12125423-12125445 TTATGCCAGGTAGTGTGTTGTGG - Intergenic
1050991189 9:12154465-12154487 CAATGACAGGCACTGTGTGGTGG + Intergenic
1052170526 9:25390116-25390138 CCATGCCAGGCCCTGTTTTAAGG + Intergenic
1052774065 9:32716209-32716231 ACATTCCAGGGACTGTGGTGGGG + Intergenic
1054953380 9:70879608-70879630 AGATGCCAGGCACTGGGGTGGGG - Intronic
1055073872 9:72194260-72194282 CAATACCAGGTACTATGTTGAGG - Intronic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057311607 9:93946560-93946582 GCGTGCCAGACACTGTGCTGGGG - Intergenic
1057442353 9:95091490-95091512 CCATGACAGTCACTGTATAGGGG + Intergenic
1058362659 9:104167926-104167948 ACATGCACGGCACTGAGTTGAGG + Intergenic
1058474942 9:105323536-105323558 CGATACCAGGCACTGTGCTAAGG - Intronic
1058718407 9:107742059-107742081 CCATGCCTGGCATAGTGCTGTGG + Intergenic
1059716472 9:116917849-116917871 CCATATCAGGCACTATCTTGAGG - Intronic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1060913244 9:127367903-127367925 TCATGTCAGGCAATGTGTTGTGG - Intronic
1061282126 9:129603390-129603412 CTATTTCAGGCACTGTGCTGTGG - Intergenic
1061866426 9:133493889-133493911 TCATACCAGGCACTGGGATGGGG + Intergenic
1062497531 9:136838771-136838793 CCACCCCAGGTGCTGTGTTGTGG - Intronic
1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG + Intronic
1185778665 X:2826864-2826886 GGATACCAGGCACTGTGCTGAGG - Intergenic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1190105780 X:47560553-47560575 CGATGCCAGTCAATGTGTGGAGG - Intergenic
1190522169 X:51291566-51291588 CCATGCTATGCACTGTGTAGAGG - Intergenic
1192194625 X:69019910-69019932 CCATGGCAGGCACTGTCTCAAGG + Intergenic
1192331152 X:70176260-70176282 GTTTGCCAGGCACTGTGTTTAGG - Intergenic
1192927114 X:75766982-75767004 CAATACCAGGCACTGGTTTGTGG + Intergenic
1193116400 X:77779686-77779708 CCAGGCATGGCACTGTGTTAGGG - Intronic
1193672757 X:84409705-84409727 ACATACCAGGCACTGTTGTGGGG + Intronic
1194934452 X:99931466-99931488 CTGTGCCAGGCACTATGTTAAGG + Intergenic
1195336002 X:103854952-103854974 ATATGCCAGGCACTCTGTTAGGG - Intergenic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1198639844 X:138744483-138744505 AAATGCCACGCACTGTGCTGAGG - Intronic
1198675512 X:139126518-139126540 CCAGGCCATGCCCTGTGTTCTGG - Intronic
1199822300 X:151461487-151461509 ACATGCTAGGCACTGTGCTGAGG - Intergenic
1200327776 X:155260575-155260597 CCAGGCCAGGCACTGTTTTGTGG - Exonic