ID: 1091845570

View in Genome Browser
Species Human (GRCh38)
Location 12:3653764-3653786
Sequence AAGAGGGACCAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 540}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091845570_1091845580 14 Left 1091845570 12:3653764-3653786 CCTGCTTCCCTCTGGTCCCTCTT 0: 1
1: 0
2: 3
3: 52
4: 540
Right 1091845580 12:3653801-3653823 CTACACGACCACAGTCACTTAGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091845570 Original CRISPR AAGAGGGACCAGAGGGAAGC AGG (reversed) Intronic
900204826 1:1427384-1427406 AAGGGGGAGAAGAGGGGAGCAGG - Intronic
900666247 1:3817424-3817446 GAGAGGAACCAGGGAGAAGCAGG - Intronic
900690406 1:3977380-3977402 ACGAGGGAGCAGACGGAAGCAGG + Intergenic
900802764 1:4747535-4747557 AAGAGGGACAAGTGGGAGGATGG - Intronic
900830795 1:4963781-4963803 TAGAGGACCCAGAGGGCAGCTGG + Intergenic
901216776 1:7559499-7559521 ATCAGAGAGCAGAGGGAAGCGGG + Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901773044 1:11540483-11540505 AAGAGGAAGGAGAGAGAAGCGGG - Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902364084 1:15959498-15959520 AAGAGGGAGGAGAGGGAGGGAGG + Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
904745646 1:32709099-32709121 GAGAGGCACCAGAGGGCAGCAGG + Intergenic
905249534 1:36639002-36639024 AAGAGGAGCCAGAAGCAAGCTGG - Intergenic
905375593 1:37518252-37518274 AAGAGGCACGAGCGGGAACCCGG + Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905957878 1:42014302-42014324 AGAAGGGACCAAAGGCAAGCAGG + Intronic
906632226 1:47381086-47381108 AAGAGGAACCTAAGAGAAGCAGG - Intergenic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
907097304 1:51793422-51793444 CAGAGGCTCCAGAGAGAAGCAGG + Intronic
908175087 1:61547528-61547550 GAGAGGGACCAGAGGTGAGCAGG + Intergenic
909288630 1:73853991-73854013 AGGAGGAACCTGAAGGAAGCTGG - Intergenic
910405394 1:86883789-86883811 AAGTGGGGCCTGAGGTAAGCAGG - Intronic
910758511 1:90714339-90714361 GAGAGAGACCAAAGGGCAGCTGG - Intronic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
911733095 1:101309967-101309989 ATGAGGGACTCCAGGGAAGCTGG - Intergenic
912312916 1:108641220-108641242 GAGAGGCACCAGCGGGAACCGGG - Intronic
912897472 1:113608219-113608241 AAGAGGGAAGAGAGGGAGGGAGG + Intronic
913404432 1:118473867-118473889 AAGAAGGACCAGAAAGAACCAGG - Intergenic
914880632 1:151543942-151543964 AAGAAGGAAGAGAGGGAAGGAGG - Intronic
915444532 1:155967154-155967176 AGGGCGGACCAGAGGGGAGCAGG + Intronic
916291015 1:163166178-163166200 AAGAGGGTCCACAGGGAAAAAGG + Intronic
916490000 1:165293775-165293797 AAAAGGGGCCTGAGGGAGGCTGG - Intronic
916564195 1:165958862-165958884 AAGATGGATGAGAGGGAAGATGG + Intergenic
916683285 1:167123258-167123280 CAGAGGGACAAGAGAGAGGCTGG - Intronic
917362650 1:174194103-174194125 AAGAGGTACCAAAGCCAAGCAGG - Intronic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
918342943 1:183582206-183582228 AAGAAGGGCTAGAGGGAGGCGGG - Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918623869 1:186635983-186636005 AAGAGGGACAAGAGGGAGACAGG + Intergenic
918789938 1:188813088-188813110 GAGAGGCACGGGAGGGAAGCAGG + Intergenic
919097464 1:193055165-193055187 AAGATGGTCCAGAGCAAAGCTGG - Intronic
920291920 1:204929344-204929366 AGGAGGGAGGAGGGGGAAGCAGG + Intronic
920447335 1:206028640-206028662 AACAGGGGCAAGAGGGATGCAGG - Intergenic
921291796 1:213664236-213664258 AAGAGGGGGCAGCGGGAAGCAGG + Intergenic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
923372775 1:233328836-233328858 AAGTGGGGCCAGAGGGAGGTGGG + Intronic
923480329 1:234377640-234377662 CAGAAGGATCAGAGTGAAGCTGG - Intronic
924217836 1:241842817-241842839 AAGCGGAAGCAGAGAGAAGCAGG - Intergenic
924382268 1:243475445-243475467 AAGAGGCGCCGGAGGGAAGGGGG - Intronic
924536161 1:244937487-244937509 TAGGGTGACCAGTGGGAAGCTGG - Intergenic
1062857079 10:784762-784784 CAGAGGGGCCAGCGGGGAGCCGG - Intergenic
1063394946 10:5678004-5678026 AGGAAGGAGGAGAGGGAAGCTGG - Intergenic
1063789631 10:9427552-9427574 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1065723852 10:28651460-28651482 GAAAGGGACCAGGGAGAAGCTGG - Intergenic
1066072722 10:31836769-31836791 AGGAGGAACCAGAGGGCAGAGGG + Intronic
1067227925 10:44387301-44387323 AAGATGGAGCAGAGGAAAGTGGG + Intergenic
1067662060 10:48243603-48243625 AAGGGGAACCAGACGGGAGCAGG + Intronic
1068163907 10:53303602-53303624 AAGAGGGAACAAAGGACAGCAGG + Intergenic
1068650316 10:59515306-59515328 AAAAGGCACCAGAGAGAAGAAGG + Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069558895 10:69415907-69415929 AAGAGGGTCCTTGGGGAAGCTGG - Intronic
1069619494 10:69827910-69827932 AAGAAGGACCACAAAGAAGCGGG - Intronic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1071092608 10:81936476-81936498 AAGATGGATGGGAGGGAAGCAGG + Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071402116 10:85283630-85283652 AAGATGGAGCAGAGGGAATGAGG + Intergenic
1071470658 10:85981876-85981898 GAGAGGGACCAGGGAGAAGGAGG + Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1072351055 10:94557608-94557630 AAGAGTCACCAGAAAGAAGCAGG - Intronic
1073399485 10:103245091-103245113 AAGAGGCACCAGTTGGAAGGTGG - Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074402269 10:113151925-113151947 GTGAGGGACCAGAGTGCAGCAGG + Intronic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075095624 10:119468931-119468953 AGGAGGGACCAGAGCGAGGGAGG + Intergenic
1075095630 10:119468951-119468973 AGGAGGGACCAGAGCGAGGGAGG + Intergenic
1075102138 10:119513876-119513898 CAGATGGACAAGAGGGAATCTGG + Intronic
1075725584 10:124609121-124609143 AAGAGAGACCAAATGGAAGCTGG - Intronic
1075845540 10:125542390-125542412 GTGAGGGAGAAGAGGGAAGCTGG - Intergenic
1076853560 10:133104607-133104629 AAGGGGGCCCAGAGGGCAGGGGG - Intronic
1077211013 11:1370974-1370996 ACCAGGGACTGGAGGGAAGCTGG + Intergenic
1078559730 11:12360687-12360709 AAGAGGGCCAAGAGAGAAGGTGG + Intergenic
1078822535 11:14896129-14896151 AAGATGGCCCAGTGGGTAGCTGG - Intergenic
1079321349 11:19454170-19454192 AAGTTGGAGCACAGGGAAGCTGG + Intronic
1080109144 11:28546114-28546136 AAGAAGGACGAGAGAGAAGAGGG + Intergenic
1081690310 11:45073622-45073644 TAGCTGGACCAGAAGGAAGCTGG + Intergenic
1081749551 11:45500146-45500168 AGAAAGGGCCAGAGGGAAGCAGG - Intergenic
1081757605 11:45555809-45555831 TAGAGGGACAAGAGAGAAGATGG + Intergenic
1081806342 11:45892869-45892891 TAGAGGAACCAGAGGGAAATGGG + Intronic
1083157815 11:60836117-60836139 AAGAGGTACAACAGGGAAGAGGG - Intergenic
1083733867 11:64668682-64668704 AGGAGGGGCCAGAGGGCAGCAGG + Intronic
1083776371 11:64896075-64896097 CAGAAGGACCCCAGGGAAGCTGG - Intronic
1083912683 11:65719409-65719431 AGCAGGGACCAGAGGGAGCCAGG + Exonic
1083944242 11:65915331-65915353 AAGGGGTGCCCGAGGGAAGCGGG + Intergenic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1086265368 11:84991587-84991609 AAGAGGGAACAGAGGAAAGTGGG + Intronic
1088321173 11:108555961-108555983 AAGGGGAGCCAGAGTGAAGCAGG - Intronic
1088816733 11:113426287-113426309 AAAAGGGACCAGAGGGGCTCAGG + Intronic
1088902623 11:114129546-114129568 AAGAGAGACCAGACAGAATCTGG - Intronic
1089326864 11:117663428-117663450 AAGAGCTCCCAGAGGGATGCTGG - Intronic
1089532997 11:119143841-119143863 AACAGGGCCCAGAGAAAAGCTGG + Intergenic
1089584097 11:119498991-119499013 AAGATGGAACAGAGAGAAGGTGG - Intergenic
1089746892 11:120623899-120623921 GGGAGGGCCCAGAGAGAAGCAGG - Intronic
1089757388 11:120696648-120696670 AAGGGGGACCTGGAGGAAGCTGG + Intronic
1090329102 11:125916182-125916204 GAGAGAGACCAGAGGGAAATCGG - Intronic
1090924215 11:131235502-131235524 GGGAGGGACCAGCCGGAAGCAGG - Intergenic
1091446370 12:546169-546191 AAGAGGGAGCAGTGAGAAGTGGG + Intronic
1091692818 12:2608723-2608745 AGGAAGGAGCGGAGGGAAGCGGG + Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1091891116 12:4055368-4055390 AAGGGAGAGCAGGGGGAAGCTGG - Intergenic
1091946466 12:4549159-4549181 AAGAGGCTCGAGAGGGAGGCTGG + Intronic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1092397000 12:8135483-8135505 AAGAGAGAGCACATGGAAGCTGG - Intronic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094479385 12:30869664-30869686 AGGAGGCACCAGAGGGAGGTTGG - Intergenic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095336510 12:41034478-41034500 AAGAGGGACAAGAGGATAGTAGG + Intronic
1095601780 12:44021691-44021713 TAGAGGGATCAAAGGGCAGCAGG - Intronic
1095732720 12:45522575-45522597 GAGAGGGACCAGAGGTGGGCAGG - Intergenic
1095863589 12:46947276-46947298 AGGAGGGAGCTGAGGAAAGCTGG - Intergenic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1097263097 12:57730717-57730739 AAGAGGGGTAAGAGGGAAGAGGG - Intronic
1098098801 12:66990478-66990500 AAGAGAGAAAAGAGGGAAGAAGG + Intergenic
1100449932 12:94696083-94696105 AGGAGGGAGAAGAGGGAGGCTGG + Intergenic
1100524001 12:95403144-95403166 AAGAGGGACTAGAGGATAGTGGG - Intergenic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1102028014 12:109724441-109724463 AAGAGGCACCACTGGGAAGAAGG - Intronic
1102039689 12:109792839-109792861 AAGAGAGGCCAGAGGGGAGAGGG + Intronic
1103889477 12:124227962-124227984 AAGAGGCAACAAAGGGGAGCTGG - Intronic
1104681456 12:130754861-130754883 AGCAGGAACCAGAGGGAAGCAGG + Intergenic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104877911 12:132049321-132049343 AAGAGTAAGCAAAGGGAAGCAGG - Intronic
1105778124 13:23681489-23681511 AAGAGGGAGCAGAGAGAATGAGG - Intergenic
1106790816 13:33153443-33153465 AAGAAGGACCAGAGAAACGCTGG + Intronic
1107542351 13:41403073-41403095 AGGAGGCACCAGAGGGGAGCCGG - Intergenic
1107994633 13:45848172-45848194 ATGAGGAAGCAGAGGGCAGCTGG + Intronic
1108061419 13:46537199-46537221 AAGAGAGACGAGAGGGAGGGAGG - Intergenic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1110852013 13:80257124-80257146 AAGATTGGCCATAGGGAAGCTGG + Intergenic
1111542551 13:89688515-89688537 AAAAGGGAAATGAGGGAAGCAGG + Intergenic
1112020396 13:95366402-95366424 AAGAGGGCGCAAAGGGCAGCTGG + Intergenic
1113155454 13:107315274-107315296 CAGAGGGATAAGAGTGAAGCAGG - Intronic
1113322182 13:109244754-109244776 AAGCGGGAACAGAAGGGAGCAGG - Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1114560348 14:23585242-23585264 GAGAGGCACCAGTGGGAACCGGG - Intergenic
1115640512 14:35332810-35332832 AAGAGGGAACCCAGGGAAGAAGG + Intergenic
1115949775 14:38708070-38708092 AAGAGGGAGGGGATGGAAGCTGG - Intergenic
1115954149 14:38758872-38758894 AAGAGGGTCCAAAGGGATGGCGG + Intergenic
1116452319 14:45080437-45080459 GAGAGGAGCCAGCGGGAAGCGGG + Intergenic
1116484233 14:45427660-45427682 AAGAGGGACCTGGGGCAAGAAGG + Intergenic
1117785551 14:59280948-59280970 AACAGGGAACAGAGGGAAAGGGG - Intronic
1118245052 14:64102077-64102099 ACGAGGGCCCAGGGGGGAGCAGG + Intronic
1118899614 14:69975472-69975494 AAGAGGAATAAGAGAGAAGCAGG + Intronic
1119319506 14:73721345-73721367 AAGAGGGGCGAGAGCGCAGCAGG - Exonic
1119889431 14:78172003-78172025 AAGCGGGAACCGAAGGAAGCGGG - Intergenic
1120648558 14:87102703-87102725 AAGAAGGGCAAGAGGGAAGAGGG - Intergenic
1120811135 14:88804432-88804454 AAGAGGGAACAAGAGGAAGCTGG - Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122501354 14:102202154-102202176 AGGAGAGAGCACAGGGAAGCAGG - Intronic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1124504456 15:30261279-30261301 AAGAGGGGACGGAGGGAAACAGG - Intergenic
1124739095 15:32277356-32277378 AAGAGGGGACGGAGGGAAACAGG + Intergenic
1125778568 15:42242334-42242356 AAGAGGGACCAGAGCCAGGCTGG + Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1127458180 15:59173927-59173949 AAGAGGGTCAAGATGGAAGAAGG + Intronic
1127638520 15:60893641-60893663 AAGAGGCTCCTAAGGGAAGCGGG + Intronic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1127904416 15:63365728-63365750 AAGGGAGACCAGAGGGATGTAGG - Intronic
1128034073 15:64507775-64507797 AATAGAGAGCAGAGGGAAGATGG + Intronic
1128532615 15:68464912-68464934 GAGAGAGGCCAGAGGGAGGCTGG - Intergenic
1128944437 15:71811397-71811419 GAAAGGGACCCGAGGGAAGGAGG + Intronic
1129171836 15:73812636-73812658 TGCAGGGACCAGAGGGCAGCTGG - Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129718014 15:77863033-77863055 AAGAAGGCCCACAGGGAGGCAGG - Intergenic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1130106792 15:80934799-80934821 AAGAAGGACCAGAGGAAGACAGG + Intronic
1130331920 15:82929279-82929301 AAAAAGGACCAGGGAGAAGCTGG + Intronic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131545665 15:93313674-93313696 AAGAGGGAGAGAAGGGAAGCGGG - Intergenic
1132029291 15:98427301-98427323 AAGAGGGAAGAGAGGGAACAAGG - Intergenic
1132209242 15:100008076-100008098 AAGAGGCCTCAGGGGGAAGCAGG + Intronic
1132880883 16:2161214-2161236 GGGAGGGGGCAGAGGGAAGCAGG - Intronic
1133070611 16:3244298-3244320 GAAAGGGAGCAGAGAGAAGCTGG + Intronic
1133569609 16:7027854-7027876 GAGAGGGAGGAGAGGGAAACCGG + Intronic
1134225004 16:12382839-12382861 GAGAGGCACCAGAGAGAAGCAGG - Intronic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1134311168 16:13076462-13076484 AGGAGGGAGCAGGGGGAAGTGGG - Intronic
1135150670 16:20002528-20002550 GAGAGGGATCAAAGGGCAGCAGG + Intergenic
1135840089 16:25868369-25868391 AAGGGGGAAGAGAGAGAAGCAGG - Intronic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136014700 16:27388623-27388645 AAGAAGGACAAGATGGAAGCTGG + Intergenic
1136091151 16:27920913-27920935 ATAAGGGGCCAGATGGAAGCAGG + Intronic
1136163261 16:28435370-28435392 GAGAGGCACGAGTGGGAAGCGGG + Intergenic
1136199705 16:28679617-28679639 GAGAGGCACGAGTGGGAAGCGGG - Intergenic
1136216052 16:28793790-28793812 GAGAGGCACGAGTGGGAAGCGGG - Intergenic
1136229540 16:28878440-28878462 ATGAGGGAGCAGGGGGAGGCCGG - Exonic
1137636878 16:49994495-49994517 AAGAGGAACCAAGGAGAAGCAGG + Intergenic
1140411491 16:74743625-74743647 AAGAGGGACAAAGGGGAAGGGGG + Intronic
1141686914 16:85575464-85575486 AGGGGAGACGAGAGGGAAGCCGG - Intergenic
1141884041 16:86879585-86879607 GAGATGGACGTGAGGGAAGCAGG - Intergenic
1142402973 16:89870693-89870715 AAGGGAGAGCAGAGGCAAGCAGG - Exonic
1142470551 17:161125-161147 AAGAGGGAGGAGAGGGCAGGAGG - Intronic
1142505631 17:361594-361616 GAGAGGCACCAGTGGGAACCGGG + Intronic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1143839970 17:9724280-9724302 AACGGGGACCAGAGGAAAGTTGG + Intronic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145084545 17:19925787-19925809 AAGAGGGACCAGAATAAAGAGGG + Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1146925255 17:36740066-36740088 AAGAGGGAAGAGAGGGAGGGAGG + Intergenic
1148071291 17:44910393-44910415 AAGAGGGACCAGGGCCTAGCAGG + Exonic
1148240503 17:45996832-45996854 AAGAGGGTCCAGAGGGGACTGGG - Intronic
1148451551 17:47781312-47781334 AAGCGGGACCTGAGGAAGGCTGG + Intergenic
1148563421 17:48619389-48619411 GAGAGGGAGAAGAGAGAAGCCGG - Intronic
1148781310 17:50123628-50123650 AAGAGGGAAGAGATAGAAGCTGG - Intronic
1148822173 17:50366063-50366085 AAGAGGACCCAGACCGAAGCTGG + Intergenic
1149006828 17:51814911-51814933 AAGAGAGACAAGAGAGAATCTGG - Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149360463 17:55889617-55889639 AAGAGGAAGAAGAGGGAAGCTGG - Intergenic
1149556053 17:57574266-57574288 AATAGTGACGAGAGAGAAGCTGG - Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1150290450 17:63978508-63978530 AAGAGGGACCTGGGGGGAACGGG - Intergenic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151576212 17:74953745-74953767 TGGAGGTTCCAGAGGGAAGCAGG - Intronic
1151656791 17:75499890-75499912 AAGAGGCTCCAGGGCGAAGCGGG - Exonic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1152375275 17:79915673-79915695 GTGAGGGAGCAGAGGGACGCAGG + Intergenic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1153567356 18:6431774-6431796 AAGAGGGAGAGGAGGGGAGCGGG - Intergenic
1155298114 18:24403887-24403909 AATAGAGACCAGGGGGAAGGAGG + Intergenic
1155424220 18:25689457-25689479 AAGGGGGAAGAGAGGAAAGCAGG + Intergenic
1155434070 18:25792840-25792862 ATGAGGGACCAGATCGTAGCAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155772836 18:29723518-29723540 GAGAGGCACCAGTGGGAACCGGG + Intergenic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1157188786 18:45562866-45562888 CAGAGGGACCAGAGCAGAGCAGG - Intronic
1157482374 18:48063545-48063567 AAAAGGGAGGAAAGGGAAGCAGG + Intronic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1157856608 18:51110407-51110429 AGGAGGGAGGAGAGGGAAGAGGG + Intergenic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1158547512 18:58408718-58408740 ACGAGGGCCCTGAGAGAAGCTGG - Intergenic
1159466959 18:68796118-68796140 AAGATGGAGCAGAAGAAAGCTGG + Intronic
1159726995 18:71973563-71973585 AAGAGAGAACAGAGGGAAAAGGG + Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1160808865 19:1004423-1004445 AAGAGCGACCAGTGGGAATCGGG + Intronic
1161062596 19:2222602-2222624 AAGAAAGACCAGAGGGAGACCGG + Intronic
1161256548 19:3313142-3313164 AAGGGGGATGAGTGGGAAGCCGG + Intergenic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1162149090 19:8632197-8632219 TAGAGGAGCCAGAGGGAGGCAGG + Intergenic
1162530183 19:11231370-11231392 AAGACCACCCAGAGGGAAGCTGG + Intronic
1162839235 19:13343418-13343440 AAGAAAGACCAGAAGGAGGCTGG - Intronic
1163241348 19:16065767-16065789 GGGAGGGGGCAGAGGGAAGCTGG + Intergenic
1164888685 19:31804745-31804767 AGAAGGGACCAGAGAAAAGCTGG + Intergenic
1164960884 19:32428508-32428530 AAGAGGAACCACTGGGATGCGGG + Intronic
1165217095 19:34282877-34282899 AAGACAGACCAGAGCAAAGCTGG - Intronic
1166139844 19:40799817-40799839 AAAATAGACCGGAGGGAAGCTGG - Exonic
1166338871 19:42125492-42125514 AAGAAGGACAAGAAGGGAGCTGG + Intronic
1167636969 19:50660919-50660941 AAAAGGGGCAAGAGGGAAGGCGG + Intronic
1167689931 19:50979119-50979141 AAGAGGGAACAGAGAGGAGGTGG + Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
1168297950 19:55386830-55386852 AAGTCGGCCGAGAGGGAAGCCGG - Intronic
1168464982 19:56594989-56595011 AGGAGGGACAGGAGGGAAGGGGG - Intergenic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
925157708 2:1660242-1660264 AAGAGGGGCCAGAGTGACCCGGG + Intronic
925179498 2:1807776-1807798 AAATGGGACCAGAGGGTGGCAGG - Intronic
925373973 2:3368472-3368494 AAGATGGACCAGCGGCAAGCAGG - Intronic
925425639 2:3746973-3746995 GAGAGGGCCCTGAGGGAAGCAGG + Intronic
925716820 2:6791721-6791743 GAAAGGGACCAGAGAGAACCGGG + Intergenic
926210070 2:10862894-10862916 ATGAGGGTCCTGAGGGATGCAGG + Intergenic
926792080 2:16584305-16584327 ATGAGGGAACAGAGTGAAGCGGG - Intronic
926987843 2:18643445-18643467 AAGAGGGAGAAGAAGGAAGCAGG + Intergenic
927319733 2:21729215-21729237 AAGATGGACTAGAAGGAAGAAGG - Intergenic
927459939 2:23289815-23289837 GAGAGGAAGCAGTGGGAAGCTGG - Intergenic
927727351 2:25436445-25436467 AAGAGTGTACAGAGTGAAGCAGG - Intronic
927993192 2:27462668-27462690 AAGAGGGACAGGATGGAAGAGGG - Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928588374 2:32786581-32786603 TGGAGGGACCAGAGGCAAGGAGG - Intronic
929188423 2:39119332-39119354 AAGAGGGACCGGAGGAGAACAGG + Intronic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
930032106 2:47064647-47064669 AAGAGGTACCTGAGGAAACCAGG + Intronic
930485468 2:52006800-52006822 GAGAGGCACCAGTGGGAACCGGG + Intergenic
930919856 2:56739405-56739427 AAGAGAGAAGGGAGGGAAGCAGG - Intergenic
931824380 2:65984462-65984484 AAGAGATACCAGTGGGAAGAGGG - Intergenic
932097500 2:68864586-68864608 AAGATGGAGCAGAGGAAAGCAGG + Intergenic
932133664 2:69209983-69210005 TACAGAGACCAGAGTGAAGCCGG + Intronic
932331800 2:70901927-70901949 AAGAGGCAGCAGGAGGAAGCCGG - Intronic
932623921 2:73283833-73283855 AACAGGGGCCAGAGGGAGGGGGG - Intronic
932668608 2:73718106-73718128 AAAAGGGAACAGAGGGAGGAGGG - Intergenic
934708266 2:96499671-96499693 AAGAGGGGCCTGAAGGAAGGTGG - Intronic
936839633 2:116754180-116754202 AAAAGGGAAAAGAGGGAAACAGG - Intergenic
937339626 2:121082766-121082788 AAAATGGACAAGAGGGAGGCTGG + Intergenic
937666678 2:124495811-124495833 AACAGGGAAGAGAGTGAAGCTGG - Intronic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
940557401 2:155247939-155247961 AAGAGGCATCAGAGAAAAGCAGG + Intergenic
940822498 2:158372582-158372604 AAAAGGGACCAAGGGGAAGCAGG - Intronic
940843999 2:158619996-158620018 AATAGGGCCCAGAGGGAGACAGG + Intronic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
943178882 2:184515993-184516015 TAGAGAGACTAGAGAGAAGCAGG + Intergenic
943677439 2:190729799-190729821 AGAAGGGACCAAAGGGAAGGAGG + Intergenic
945722202 2:213431427-213431449 AACAGAGAGCAGAGGCAAGCAGG + Intronic
945745741 2:213718492-213718514 GAGAGGCACCAGCGGGAACCGGG + Intronic
946177128 2:217928757-217928779 AAGAGGAAGCAGTGGGCAGCTGG - Intronic
947455751 2:230252427-230252449 AAGAGGGAAATGAGGGAGGCAGG + Intronic
947556590 2:231098868-231098890 AAGAGGTACCACAAGGAAGGGGG - Intronic
947605055 2:231480901-231480923 GGGAGGGGCCAGAGGGAAGCTGG - Intronic
947625481 2:231615656-231615678 AAGAGGGTCGAGAGGGGAGGCGG - Intergenic
948251766 2:236535489-236535511 AGGAGGAATCCGAGGGAAGCTGG + Intergenic
948577655 2:238965014-238965036 AGGAGGGAGGAGGGGGAAGCAGG - Intergenic
948602936 2:239117536-239117558 AAGAGGGGAGAGAGGGATGCGGG + Intronic
948759900 2:240183961-240183983 AAGAGGGAGGAAAGGGGAGCCGG + Intergenic
949032212 2:241802549-241802571 AGGCGGGGCCAGAGGGAGGCCGG + Intronic
1169023573 20:2348641-2348663 AAGAGGGGCCAGAGTGAGACTGG - Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170669359 20:18416349-18416371 AGGTGGGACCGGAAGGAAGCTGG - Intronic
1171221384 20:23401072-23401094 AAGAGGGAGCTGAAGGAAGCAGG + Intronic
1171445587 20:25201581-25201603 AAGAGTGACCAAAGGAGAGCAGG - Intronic
1171905053 20:30893704-30893726 AGGAGAGAACAGAGGGAAGGAGG - Intergenic
1172307204 20:33889160-33889182 AAGGGGGCCCAGAGGAAAACAGG - Intergenic
1172704906 20:36876018-36876040 GAGAGGGAGCAAAGGGCAGCTGG + Intergenic
1174265584 20:49329378-49329400 GAGAGGGGTCAGAGGGAATCAGG + Intergenic
1174978935 20:55369882-55369904 AAGAAGAAGCAGAGGAAAGCGGG + Intergenic
1175542626 20:59757271-59757293 AAGAGGGCACTGAGGGGAGCAGG - Intronic
1175545404 20:59774911-59774933 AAGCAGGACGAGATGGAAGCAGG + Intronic
1177126349 21:17198035-17198057 AAGAGGGAACAGTGGGCAGATGG - Intergenic
1177166535 21:17611586-17611608 AAGAACCACCAGAGGCAAGCAGG + Intronic
1177894854 21:26845849-26845871 AAGAGGGAACTGAGGGAGGAGGG - Intergenic
1179150601 21:38805731-38805753 AAGCGGGAGGAGAGGGAAGGGGG - Intronic
1179959418 21:44759673-44759695 AAGAGGGGCCACGGGGCAGCAGG - Intergenic
1180161055 21:45998921-45998943 AAGGGGGACGAGGGAGAAGCCGG + Exonic
1180797356 22:18612547-18612569 AAGAGGAGCCAGACTGAAGCAGG - Intergenic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181224366 22:21382735-21382757 AAGAGGAGCCAGACTGAAGCAGG + Intergenic
1181254266 22:21552088-21552110 AAGAGGAGCCAGACTGAAGCAGG - Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181545325 22:23599199-23599221 AACAGGGCCCAGAGGGAACAAGG - Intergenic
1182016419 22:27043960-27043982 AAGAAGGACAAAAGGGAAGGAGG - Intergenic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182253095 22:29017550-29017572 AAGAGGGACCACAGAGAAGCTGG + Intronic
1182675318 22:32034701-32034723 GAGAAGGACTAGAGGGATGCTGG + Intergenic
1182962165 22:34485444-34485466 AGAAGGGAAAAGAGGGAAGCAGG + Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
1184250484 22:43257503-43257525 AATAGGGACCAGGAGGAAGGAGG + Intronic
1184530842 22:45054483-45054505 AAGGGGGCACAGAGTGAAGCTGG + Intergenic
1184532338 22:45064201-45064223 AGGAGGGACCAAAGGACAGCTGG + Intergenic
1184857911 22:47156584-47156606 AAGAGGGACCTGGGGCAGGCTGG + Intronic
1184907333 22:47497756-47497778 AAGTAGGCCCTGAGGGAAGCCGG - Intergenic
1185071494 22:48659168-48659190 ACGAGGGCCCAGAGTGAGGCAGG - Intronic
1185413785 22:50698853-50698875 AAGAGAGAACAAAGGGAAACTGG - Intergenic
949515352 3:4802410-4802432 AGGAGGGACTAGAGGCAAGGAGG + Intronic
949610333 3:5697714-5697736 CAGAGGGAACAGAGGGAGTCAGG - Intergenic
950613262 3:14139454-14139476 ATGAGGGAGCAGAGGAAGGCAGG + Intronic
951269645 3:20608468-20608490 GAGAGGGACCAGAGGTGGGCAGG - Intergenic
951358713 3:21700250-21700272 TATAGGGACCAGAAGGAAGTGGG + Intronic
951563694 3:23991870-23991892 AAGAGGAAACAGGGGAAAGCAGG - Intergenic
951651590 3:24956883-24956905 AAGCTGGACCAGAGAGAAGGAGG + Intergenic
952747031 3:36791145-36791167 TAGAGGGAGCAGGGGAAAGCAGG + Intergenic
952882100 3:37991514-37991536 AAGAAGAACCAGGGGGAGGCAGG + Intronic
952948401 3:38496710-38496732 AGGAAGGACATGAGGGAAGCTGG - Intronic
953550513 3:43898834-43898856 ATGAGGTAGGAGAGGGAAGCAGG + Intergenic
954258659 3:49423288-49423310 AGGAAGAACCAGAGGGAAACAGG + Exonic
954373847 3:50184123-50184145 AGGATGGGCCAGAGGTAAGCTGG + Intronic
954683570 3:52358771-52358793 GAGAGGGAGCAGAGGGGTGCAGG - Intronic
954873800 3:53787541-53787563 GAGAGGGACCAGAGGCTGGCTGG - Intronic
954881235 3:53837378-53837400 AAGAGGATCCAGAGGGCAGGTGG - Intronic
955470792 3:59283865-59283887 AAAAGGAACCAGAGGCAAGCTGG - Intergenic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
959348976 3:105236491-105236513 AAGAAGAACTAGAGGAAAGCTGG + Intergenic
959741904 3:109730139-109730161 AAGATGCACCACAGAGAAGCAGG - Intergenic
959970162 3:112400406-112400428 AAGAGCGATCAGATGAAAGCTGG - Intergenic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961381628 3:126499480-126499502 CACAGGGCCCAGAGGGAGGCTGG + Intronic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962389910 3:134962704-134962726 TAGAGGCCCCAGAGGTAAGCTGG - Intronic
962646985 3:137450036-137450058 AAGAGGTACCAGAGGGTTCCTGG + Intergenic
962888799 3:139652897-139652919 AAAAGTGACCAGAGAAAAGCAGG + Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
964406174 3:156351806-156351828 GAGAGAGACCAGAGGAAGGCAGG - Intronic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965619357 3:170627021-170627043 AAGAGGGAACTGAGGGAGGTGGG - Intronic
966183067 3:177204257-177204279 GAGAGGGACGAGCGGGAACCGGG - Intergenic
966857554 3:184205700-184205722 AAGATGGACTAGGGGGAAGGGGG - Intronic
967473417 3:189889269-189889291 AAGATGGACCACTGGGATGCTGG + Intronic
967734891 3:192941751-192941773 AAGAGGGAAGAGAGGGAGGGAGG - Intergenic
969206618 4:5652034-5652056 ACCAGGGAACAGGGGGAAGCTGG + Intronic
969523546 4:7692684-7692706 AAGATGGTCCAGAGGGACACAGG + Intronic
969537786 4:7767270-7767292 AAGAGGGAGCAAAAGGGAGCGGG + Intronic
973090018 4:46124381-46124403 AAGAGAGACCCGTGGGAAGCAGG + Intergenic
973229769 4:47827989-47828011 AAGACTGATCAGAGGAAAGCTGG - Intronic
974171043 4:58267943-58267965 AAGAGGGAACTGAGAGAATCAGG + Intergenic
975266967 4:72381293-72381315 ACCAGAGACCAGTGGGAAGCTGG - Intronic
976615232 4:87069455-87069477 AAGAGAGACGAGAGGGAGGGAGG - Intronic
977254427 4:94725353-94725375 ATGAGGGACCCCAAGGAAGCTGG - Intergenic
977303804 4:95298540-95298562 AGGAGGGGCAAGAGGGAATCAGG - Intronic
977313040 4:95410903-95410925 TAGAAGGTCCAGAGGGAACCAGG - Intronic
977805150 4:101288579-101288601 AAGAGGGAACAACGGGAAGGAGG + Intronic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
979507908 4:121519137-121519159 AAGAGGGAGGAGAGGTAAGTAGG + Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
984179564 4:176464958-176464980 AAGAGGGAACAGAGAAAAGAGGG - Intergenic
984455163 4:179957370-179957392 ATGAGGAACCTGAGGGAAGAGGG + Intergenic
985137484 4:186801781-186801803 AGGAGGGTCCAGAGGGAAGTTGG + Intergenic
1202764094 4_GL000008v2_random:136283-136305 AAGCGGGACCAGGGAGAAGAGGG + Intergenic
985748550 5:1661498-1661520 GGGAGGGACCACAGGGATGCTGG + Intergenic
987115913 5:14726553-14726575 AAGAGTGACGGGAGGGAGGCTGG + Intronic
988479615 5:31618960-31618982 AACAGGGGCCAGAGAGAGGCAGG - Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989478007 5:41896431-41896453 AAGAGGGAACAGAGGCCAGAAGG + Intergenic
989712088 5:44411447-44411469 AAAAGGCATCAGAGGGAAGCCGG - Intergenic
989734507 5:44687765-44687787 AAGAGGAAGCAGAGAGAAGTGGG + Intergenic
989997210 5:50849962-50849984 GAGAGGGATGAGAGGGAAGCAGG - Intergenic
990624786 5:57598689-57598711 AAGAGGAAGCAGAGGCAAGGAGG - Intergenic
991089375 5:62679215-62679237 AAAAGGGAAAAGAGGGAAGGGGG + Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992598977 5:78377278-78377300 AAAAGGGAGCAGAGAGCAGCAGG - Intronic
993031829 5:82714682-82714704 GAGAGGCACCAGTGGGAACCGGG + Intergenic
993418998 5:87676414-87676436 AGGAGCGCCCAGAGGGAAACAGG + Intergenic
996821978 5:127639608-127639630 AAGAGAGAGGAGAGGGAAGAAGG - Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997110111 5:131065589-131065611 AAGAAGGAAGAGAGAGAAGCAGG - Intergenic
997234476 5:132264864-132264886 AAGAGGGCAGATAGGGAAGCTGG - Intronic
997605485 5:135172994-135173016 AAGGGGGAAAAGAGGGAGGCAGG + Intronic
997629089 5:135353146-135353168 ACGAGGCACAAAAGGGAAGCAGG + Intronic
999079469 5:148829215-148829237 AACAGGGACCAAAGGAAAGAAGG - Intergenic
999248534 5:150167922-150167944 AAGCGGGAGCAGTGGGAAGGGGG + Intronic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
999702693 5:154242602-154242624 GAGAGTGACAGGAGGGAAGCAGG - Intronic
1000827081 5:166058417-166058439 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001586140 5:172834766-172834788 TAGAGGGAGGAGAGGGATGCTGG - Intronic
1001711139 5:173779139-173779161 AAGAGGTAGGAGAGGCAAGCAGG - Intergenic
1001877872 5:175216779-175216801 TAAAGGGATCAGAGGGAAGCAGG + Intergenic
1002056636 5:176601618-176601640 AAGAGGGTCCAGCAGGCAGCTGG + Intronic
1003975988 6:11345098-11345120 AAGAGGGACCGGGGTGAGGCAGG + Intronic
1004604075 6:17177326-17177348 AAGAAGGAACAAAGGGAAGAAGG - Intergenic
1004928951 6:20443139-20443161 AGCAGGGACAAGAGGGATGCAGG + Intronic
1005088744 6:22034303-22034325 AGGAGGGAGAAGAGAGAAGCTGG - Intergenic
1007763130 6:44145871-44145893 AAGACTGACCAGAGAGAAACTGG - Intronic
1007958906 6:45941150-45941172 TGTAGGGACCAGAAGGAAGCGGG + Intronic
1010253142 6:73729182-73729204 AAGAGAGACAACAGGGAAGAAGG + Intronic
1010677945 6:78766636-78766658 AAGAGGGACCTGGTGGAAGGTGG + Intergenic
1011354122 6:86456099-86456121 AATAGGGACCAGACTGAAGGTGG - Intergenic
1011610481 6:89146112-89146134 GAGAGGGCGCAGAGGGCAGCGGG + Exonic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012209511 6:96502430-96502452 AAGAGGCACCTGAGAGAATCAGG + Intergenic
1012760264 6:103292675-103292697 AAGAGGGACCCAGGGGAATCTGG + Intergenic
1013143604 6:107364603-107364625 GAGAGGCACCAGCGGGAACCGGG - Intronic
1013373973 6:109496323-109496345 GCGAGGGACCTGAGGCAAGCAGG - Intronic
1014564906 6:122936365-122936387 AAGAGGGGCAAGAGAGAAGGAGG - Intergenic
1015478415 6:133679580-133679602 AAGAGGGAAGAGAGAGAAGGAGG + Intergenic
1015793357 6:136986314-136986336 GAGAGGAAGCAGAGAGAAGCAGG - Intergenic
1015894815 6:138007098-138007120 ACGAGGGGGCAGAAGGAAGCTGG - Intergenic
1015955103 6:138590467-138590489 AGGAAGAACCAGAGGGAAGAGGG - Intronic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1017847760 6:158274316-158274338 GAGAGGGACAAGAGAGCAGCTGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018791044 6:167147983-167148005 AAGAGGGAGGAGGAGGAAGCAGG - Intronic
1019018815 6:168900664-168900686 AGGAGTGAGAAGAGGGAAGCAGG + Intergenic
1019085603 6:169473307-169473329 AAGAGTGACAAAAGGGAAGGAGG + Intronic
1019118346 6:169783740-169783762 AAGAGGGGCCAGAGCTGAGCTGG - Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1020276990 7:6630571-6630593 AAGAGTGATCAGAGGGCACCTGG - Intergenic
1020882590 7:13780726-13780748 AAGAAGGACAAGAAGGAAGTGGG + Intergenic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021428092 7:20526168-20526190 AAGAGGGTTGAGAGGCAAGCTGG + Intergenic
1022015512 7:26345564-26345586 CATAGGGAACACAGGGAAGCAGG - Intronic
1022251209 7:28610254-28610276 GGGAGGGGCCAGAGGGAAGGCGG + Intronic
1022740420 7:33114707-33114729 AAGAGGCAGCTTAGGGAAGCAGG - Intergenic
1024270138 7:47635767-47635789 GAGAGAGAGGAGAGGGAAGCAGG + Intergenic
1024825461 7:53385520-53385542 GAGAGGCACCAGCGGGAACCGGG - Intergenic
1024930574 7:54663888-54663910 CAGAGGGACATGAAGGAAGCAGG + Intergenic
1027226219 7:76245258-76245280 TTGAAGGAGCAGAGGGAAGCAGG + Intronic
1027239476 7:76317992-76318014 AAGACGGAGGAGAGAGAAGCGGG + Intergenic
1027530235 7:79322286-79322308 AAGAGGGAAAACATGGAAGCTGG - Intronic
1029288771 7:99485457-99485479 AAAAGGAACCAGAGGGAAGTAGG - Intronic
1029799007 7:102926012-102926034 ATGGGGGACCAGAAAGAAGCAGG + Intronic
1029991122 7:104963419-104963441 AAGAGGAGACAGAGGAAAGCAGG - Intergenic
1030138992 7:106285578-106285600 AGGAGGGACAAGAGGGATGGAGG - Intronic
1030264365 7:107603568-107603590 AAGAAGGAACAAAGGAAAGCAGG - Intronic
1031646193 7:124229161-124229183 AAGAGGCGACAGAGGTAAGCTGG + Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033609849 7:142954536-142954558 AAGAGAGACTGGAGAGAAGCAGG + Intronic
1033665296 7:143435562-143435584 AAGAGGGAAGAGAGAGAAGGAGG - Intergenic
1034549849 7:151813547-151813569 AAGGGCGACAAGAGGGATGCTGG + Intronic
1035188027 7:157140946-157140968 AGGAAGGGCGAGAGGGAAGCTGG + Intronic
1035306979 7:157939696-157939718 AAGATATGCCAGAGGGAAGCTGG - Intronic
1036213061 8:6858086-6858108 AAGAAGGACCAGGGTGAAACAGG - Intergenic
1036541461 8:9716663-9716685 AAGAGGGGAAAGAGGGAAGCAGG - Intronic
1037561405 8:20078079-20078101 ACGAGAGGCCAGTGGGAAGCTGG + Intergenic
1038342191 8:26695809-26695831 AACAGGGACCAGAGGCGAGAAGG - Intergenic
1039287723 8:36061062-36061084 AAAAGGGAACATTGGGAAGCTGG - Intergenic
1039314490 8:36356486-36356508 AAGAGAGACAAAAGGGAAGGAGG + Intergenic
1039722280 8:40176971-40176993 AAGAGGGAGCAGAGGAAATGGGG + Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041469336 8:58191358-58191380 AAGAGGGAACACAGAGAAGATGG + Intronic
1042605596 8:70542457-70542479 AAGGGGGACTAGAGTGAAGGGGG - Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1044511370 8:93083711-93083733 AATAGGGATAAGAGTGAAGCTGG - Intergenic
1044934091 8:97277270-97277292 AAGAAGGAAGAGAGGGATGCAGG - Exonic
1045455589 8:102375710-102375732 TACAGGGACCAAAAGGAAGCTGG + Intronic
1045551935 8:103180616-103180638 AACAGGGACCAGAAGGATGTAGG + Intronic
1047214579 8:122865962-122865984 AGGAGGGACCAGAGGGAGCCAGG - Intronic
1047235312 8:123036459-123036481 GACAGTGACCAGAAGGAAGCAGG + Intronic
1047372443 8:124267103-124267125 GAGAGGGTGCAGAGGGAATCTGG - Intergenic
1047878452 8:129166691-129166713 AAGAGGGATGGGAGGGATGCAGG - Intergenic
1048432418 8:134382561-134382583 AAGAGGGCCGAGAGGCGAGCTGG - Intergenic
1048432734 8:134385315-134385337 AAGAGGGACCTGGGAGAACCTGG - Intergenic
1049092683 8:140528515-140528537 AAGAGGGAACTGTTGGAAGCAGG - Intergenic
1049351490 8:142167105-142167127 AAGGCGGGCCATAGGGAAGCAGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049541531 8:143211296-143211318 AAGAGGGGCGACAGGGAGGCGGG + Intergenic
1049702228 8:144020528-144020550 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702275 8:144020687-144020709 AAGAGGATCCTGAGGGAAGAGGG - Intronic
1049702323 8:144020882-144020904 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702418 8:144021220-144021242 GAGAGGGTCCTGAGGGAAGGCGG - Intronic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049702438 8:144021284-144021306 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049702490 8:144021494-144021516 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702600 8:144021942-144021964 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702645 8:144022118-144022140 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049702697 8:144022341-144022363 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702752 8:144022563-144022585 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702850 8:144022966-144022988 AAGAGGGTCCTGAGGGAATAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049702974 8:144023383-144023405 AAGAGGGTCCTCAGGGAAGAGGG - Intronic
1049703056 8:144023715-144023737 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703150 8:144024051-144024073 AAGAGGGTCCTGAGGGAAGGTGG - Intronic
1049703237 8:144024373-144024395 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703244 8:144024389-144024411 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703290 8:144024525-144024547 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703345 8:144024748-144024770 GAGAGGGTCCTGAGGGAAGGAGG - Intronic
1049703361 8:144024800-144024822 AAGAGGGTCCTCAGGGAAGAGGG - Intronic
1049703366 8:144024816-144024838 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049703392 8:144024911-144024933 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049822647 8:144645512-144645534 AGGAGAGACCAGAGTGAGGCGGG - Intergenic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050664953 9:7925459-7925481 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1050846866 9:10232060-10232082 AAGAGGGACCAGACAGGAGGAGG - Intronic
1051044002 9:12851664-12851686 AAGAAGGAAAAGAGGGAAGTGGG + Intergenic
1052985389 9:34483123-34483145 GAGAGGCACCAGCGGGAACCGGG - Intronic
1053036172 9:34828149-34828171 CAGAGGGACAAGTGGGGAGCTGG - Intergenic
1053476330 9:38384548-38384570 AAGGAAGCCCAGAGGGAAGCAGG - Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1056183717 9:84111066-84111088 AAGAGGGGCAAGAGAGAAGGAGG - Intergenic
1056655131 9:88502840-88502862 AAGATGGACAGGAGGGCAGCGGG + Intergenic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1057865282 9:98675294-98675316 AGGAGGAACCAGAGGAAGGCAGG + Intronic
1058426088 9:104876291-104876313 AACGGGGAACAGAGGGAAGCTGG + Intronic
1059651627 9:116320845-116320867 TAGAGGCATAAGAGGGAAGCAGG + Intronic
1059709284 9:116852604-116852626 AGCAGGGATCAGAGAGAAGCTGG + Intronic
1060100129 9:120833175-120833197 AAGAGGGAGCAGAGGAGAGGGGG + Intronic
1060765705 9:126293848-126293870 AAGAGGGACCAGCGTGATGGAGG + Intergenic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1061009531 9:127946749-127946771 AAAAGGGAGTGGAGGGAAGCTGG + Intronic
1062514957 9:136928423-136928445 AAGAGGGCTGAGGGGGAAGCTGG + Intronic
1062523265 9:136968373-136968395 TGGAGGGACCTGAGGGAGGCTGG + Intergenic
1062569103 9:137176315-137176337 AAGAGGGTTCAGAGGGAACGGGG + Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185861407 X:3582957-3582979 AAGATGGAACACAGGGAAGGAGG + Intergenic
1185895406 X:3854160-3854182 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185900523 X:3892584-3892606 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185905639 X:3931015-3931037 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1189091839 X:38091593-38091615 GAGAGGGAGCACAGGGAAGTGGG + Intronic
1189316862 X:40062710-40062732 CACAGGCCCCAGAGGGAAGCCGG + Intronic
1190070084 X:47272452-47272474 AGGAAGAACCAGAGGGAAACAGG + Intergenic
1190109768 X:47582461-47582483 GAGAGACACCAGAGGTAAGCAGG + Exonic
1191067593 X:56367016-56367038 GAGAGGGACCAGTGGTAGGCAGG + Intergenic
1192156013 X:68747127-68747149 GAGAGAGTCGAGAGGGAAGCAGG + Intergenic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1192550878 X:72052621-72052643 GAGAGGGACATGGGGGAAGCTGG - Intergenic
1193107206 X:77689670-77689692 ACTAGGGACAAGAGGGAGGCTGG - Intronic
1193889215 X:87022509-87022531 AGGAGAGAGCAGAGGGAAGGAGG + Intergenic
1195067660 X:101252316-101252338 AAGGGAGACAGGAGGGAAGCAGG - Intronic
1195568862 X:106377129-106377151 AAGAGGTAGCAGAGGGAGCCTGG - Intergenic
1195970019 X:110462884-110462906 AAGAGGGAAGAGAGGGAAAGTGG + Intergenic
1196741480 X:119029515-119029537 GAGAGGCACCAGCGGGAACCGGG + Intergenic
1196775465 X:119333596-119333618 GAGAGGCACCAGTGGGAACCGGG + Intergenic
1197994023 X:132352839-132352861 AAGAGAGACAAGAGGGTAACTGG + Intergenic
1198176168 X:134157841-134157863 GAGAGAGAACAGAGGAAAGCAGG - Intergenic
1198320972 X:135518861-135518883 AAAAGGGAAGAGAGGGAATCTGG - Intergenic
1198609027 X:138376483-138376505 GAGAAGGACCAGTGGGAAGCTGG - Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1202100621 Y:21303925-21303947 GAGAGGGGCCAGCGGGAACCAGG - Intergenic