ID: 1091847619

View in Genome Browser
Species Human (GRCh38)
Location 12:3669533-3669555
Sequence GTGCAAAAGGACAAGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091847611_1091847619 15 Left 1091847611 12:3669495-3669517 CCCACAAGGGGCTCAAATCCGAA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1091847619 12:3669533-3669555 GTGCAAAAGGACAAGGGTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 182
1091847612_1091847619 14 Left 1091847612 12:3669496-3669518 CCACAAGGGGCTCAAATCCGAAA 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1091847619 12:3669533-3669555 GTGCAAAAGGACAAGGGTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 182
1091847613_1091847619 -3 Left 1091847613 12:3669513-3669535 CCGAAATTTCTTCAACCTCTGTG 0: 1
1: 0
2: 0
3: 29
4: 613
Right 1091847619 12:3669533-3669555 GTGCAAAAGGACAAGGGTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091847619 Original CRISPR GTGCAAAAGGACAAGGGTGT GGG Intronic
901777096 1:11567543-11567565 GTGGATAAGGACATGGGGGTTGG - Intergenic
906383605 1:45348303-45348325 CTCCAAGAGGACAAGGGTTTTGG - Intronic
908360746 1:63367015-63367037 ATGCAAAAGGAAAAGTGTGCAGG + Intergenic
909865941 1:80671768-80671790 GTGCAAAAGGGGAAGAGTGTGGG - Intergenic
912199499 1:107440250-107440272 GTCCAAAAGGACTTGGGTTTGGG + Intronic
912474717 1:109928158-109928180 GGGCAAGAGGACAAGGATGGGGG + Intronic
915931147 1:160061741-160061763 GTGCAAAAGGGAAAGGGGGGTGG + Intronic
915951544 1:160192814-160192836 GTCCTAGAAGACAAGGGTGTTGG + Exonic
916318482 1:163477293-163477315 ATGCTAAAGGAAAAGGGTTTGGG - Intergenic
916515449 1:165512509-165512531 GAGCAAATGGAACAGGGTGTTGG - Intergenic
917957361 1:180113769-180113791 GTGAAAGAGGATGAGGGTGTAGG - Exonic
918530515 1:185515384-185515406 GTGCAAAAGGTTAACAGTGTAGG - Intergenic
919055592 1:192565843-192565865 GTACAAAAATACAAGGGTTTTGG + Intergenic
919882849 1:201912242-201912264 GTGCGAAGGGACAATGTTGTAGG - Intronic
920380775 1:205533354-205533376 GGGCAGCAGGACGAGGGTGTGGG + Intergenic
921295245 1:213695219-213695241 GTGAAAAAGGTCAGTGGTGTGGG + Intergenic
923383065 1:233440816-233440838 GTGCGTATGGAAAAGGGTGTAGG - Intergenic
923708366 1:236364338-236364360 CTGCCAAAGGACAAAGGTGGAGG - Intronic
924074886 1:240323493-240323515 GTGAAAAAGGTCAAAGGTCTGGG - Intronic
924132378 1:240924929-240924951 GTTCAAATGGACAAGGATTTGGG + Intronic
1062946994 10:1468906-1468928 GTGCAAAATAACAAAAGTGTTGG - Intronic
1063267388 10:4468883-4468905 GTTCAAAAGGTGAAAGGTGTGGG - Intergenic
1065023383 10:21518682-21518704 TTCCAAAAGGAAAAGGGGGTGGG - Exonic
1065155223 10:22862720-22862742 GTGTAAAAGGACCAAGGTGCGGG - Intergenic
1065866652 10:29920491-29920513 GTGCAAATGGACATGAGTTTCGG + Intergenic
1068819131 10:61352807-61352829 AAGCAACAGGACAAGAGTGTAGG + Intergenic
1070778068 10:79121667-79121689 CTGCTAAAGGATCAGGGTGTGGG + Intronic
1070877086 10:79825376-79825398 GTGCAGAGGGATAAGGGTGAGGG + Intergenic
1071643581 10:87341420-87341442 GTGCAGAGGGATAAGGGTGAGGG + Intergenic
1073480750 10:103784783-103784805 GGGGAAAAGGAGAAGGGAGTGGG + Intronic
1074296788 10:112196828-112196850 GTGCAAAAGGAATGGGGTGAGGG - Intronic
1075888248 10:125921522-125921544 GTGCAAATGACTAAGGGTGTAGG + Intronic
1080785043 11:35467375-35467397 GTGCATAAGGACAAGAATTTGGG - Intronic
1087242035 11:95790566-95790588 ATGGAAAAGGGCAAGGGTGCTGG - Exonic
1090264791 11:125347123-125347145 TGGCACAAGGACAAGGGTGAGGG - Intronic
1091847619 12:3669533-3669555 GTGCAAAAGGACAAGGGTGTGGG + Intronic
1092014885 12:5150209-5150231 GAGAAAAATGACAAGAGTGTGGG - Intergenic
1092182861 12:6457989-6458011 GTCCAAAAGGACTGGGGTGATGG - Intronic
1093123028 12:15295558-15295580 ATTCAAAAGGACTTGGGTGTTGG - Intronic
1094488515 12:30943838-30943860 GCACAGAAGGACAAGGCTGTTGG + Intronic
1095421532 12:42029066-42029088 GAGCAAAAGGAAAAAGGTTTAGG - Intergenic
1096633407 12:52944020-52944042 GTGCAAAAGAACAAGGGGGCTGG + Intronic
1096847756 12:54417463-54417485 GGGCAAAAGGCCAGGGGGGTGGG + Intronic
1103133402 12:118487747-118487769 GTGGAGAAGGACGTGGGTGTTGG + Intergenic
1105846378 13:24297714-24297736 GTGCAAGAGGACAAGGAGATGGG + Exonic
1106177165 13:27341409-27341431 CTGCAAAATTACCAGGGTGTGGG - Intergenic
1106937762 13:34742898-34742920 GGGCAAAAGGACAAGAGAATTGG - Intergenic
1107283341 13:38761790-38761812 AGGCAAGAGGACAAGGGTGATGG + Intronic
1110408107 13:75173599-75173621 GTGCAAATGAACAGGGGAGTAGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112833456 13:103482485-103482507 GTGAAATATGACAAGGGTTTAGG + Intergenic
1112856619 13:103778370-103778392 GTGCTAAATGATCAGGGTGTTGG + Intergenic
1113896432 13:113767344-113767366 TTGCAAGAGGCCAATGGTGTGGG + Intronic
1117821550 14:59655522-59655544 TTGAAAAAGGACAAAGTTGTAGG + Intronic
1122045589 14:99020947-99020969 GGGCAAAGGGCCTAGGGTGTGGG + Intergenic
1123708908 15:22972097-22972119 GAGCAAAAGAACAAGGCTGGAGG + Intronic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1126387789 15:48111680-48111702 CTGGGAAAGGACAAGGGTCTGGG + Intergenic
1126684159 15:51232791-51232813 GTGCAAGAGGACAAGGGATGGGG - Intronic
1128137564 15:65275198-65275220 GGGCTAAAGGAAAAGGGGGTGGG + Intronic
1129681641 15:77661681-77661703 GGGAAAGAGGACAAGGGTCTAGG - Intronic
1131651781 15:94407756-94407778 GTGCACAAGTACATGTGTGTTGG - Intronic
1132357538 15:101183713-101183735 GTGCAAACGGGGGAGGGTGTGGG + Intronic
1133122355 16:3617634-3617656 GTGCATAAGGATAAGGATGGAGG + Intronic
1133752644 16:8736633-8736655 GTGCAAGTGGCCATGGGTGTGGG - Intronic
1135689285 16:24523216-24523238 GTTCAATAGGAGAAGTGTGTTGG + Intergenic
1135967526 16:27048440-27048462 GAGAAAAAGGCCAAGGGTGGTGG - Intergenic
1137551584 16:49441045-49441067 GTGCAGAAGTACAATGGGGTTGG + Intergenic
1137605025 16:49781517-49781539 GTGCAGAAGCGCAGGGGTGTGGG + Intronic
1141218332 16:82045645-82045667 GTGCAAAAGAACAAAGGAGCAGG - Intronic
1142901665 17:3015960-3015982 ATGCAGAAGGACTAAGGTGTGGG - Intronic
1143775244 17:9195092-9195114 GGGGAAAAGGACGAGGGGGTGGG - Intronic
1147020101 17:37524513-37524535 GTGCAAAAGGACTCTGGTGTAGG + Intronic
1147788081 17:42994622-42994644 CTGCCAAAGGACAAGGCTGCAGG + Intergenic
1149060231 17:52412979-52413001 GTGCAAAAGGATAAGTGTGTAGG - Intergenic
1149775938 17:59357212-59357234 GAACAAAAAGACAAGGGGGTGGG + Intronic
1151445168 17:74158975-74158997 ATGCTAAAGGACTAGGGTATTGG - Intergenic
1151757682 17:76083909-76083931 GGGAAAAAGGAGAAGGGTGGTGG - Intronic
1152772651 17:82179658-82179680 GTGCAAAGGGACAGAGGGGTGGG + Intronic
1153699419 18:7677821-7677843 AGGCAACAGGACAAGGGAGTGGG - Intronic
1155178701 18:23324466-23324488 GTGAAAAAGGAAAAGGGCTTTGG + Intronic
1156544941 18:37955242-37955264 GTGCAAAAGGAAAAGTTTGATGG - Intergenic
1158323836 18:56293237-56293259 GTACAAAAGGAAAAGGGGGCAGG + Intergenic
1163643418 19:18474609-18474631 TTGGAACAGGACAAGGGAGTGGG - Intronic
1165379001 19:35464556-35464578 GAGCAAAAGGAAAAGGGGGTGGG + Intergenic
1167770204 19:51510110-51510132 GTGTAAACGGAGGAGGGTGTGGG + Intergenic
1167905228 19:52654894-52654916 GAACAAAAGGCCAAGGGTGGTGG + Intronic
1168083582 19:54028538-54028560 GGACAAGAGGCCAAGGGTGTGGG - Intergenic
929575847 2:43051187-43051209 GTGTAAAAGGGCAGTGGTGTAGG + Intergenic
930984090 2:57563811-57563833 GTCCAAAAGGATATGGGTGAAGG + Intergenic
934810766 2:97275108-97275130 TTTCAAAAGGACAAGGGGGCAGG + Intergenic
934826926 2:97432831-97432853 TTTCAAAAGGACAAGGGGGCAGG - Intergenic
934858289 2:97742473-97742495 GAGCAAAAGGCCAAGGGCGTAGG + Intergenic
934961401 2:98678348-98678370 GTGCAACAGTTCAAGCGTGTAGG - Exonic
938311565 2:130292539-130292561 GTGCAAAAGGCCTAGCGTGCTGG + Intergenic
939147606 2:138434828-138434850 GTACAAAAGAACAGTGGTGTGGG - Intergenic
947636411 2:231682770-231682792 GGCCAAAAGGAGAAGAGTGTGGG - Intergenic
1169757390 20:9057919-9057941 GAGGAAAAGGAGAAGGGCGTGGG + Intergenic
1170331219 20:15213019-15213041 GTGCAAAAAGAAAAGGTGGTTGG + Intronic
1173007803 20:39154097-39154119 GTACAAATGAACAAAGGTGTAGG + Intergenic
1173796796 20:45866484-45866506 TTACAAAATGAGAAGGGTGTGGG + Intronic
1175909855 20:62399941-62399963 GTGAAAAAGAACATGGTTGTAGG + Intronic
1177784601 21:25657379-25657401 GTTCAAAAGGACAGGGTTGGTGG + Intronic
1178364277 21:31975582-31975604 GTGCAACAGGCCCAGGGTGAAGG - Intronic
1180647797 22:17353933-17353955 GTGAAAAAGGAAAAGGATGGGGG - Intergenic
1180676480 22:17589957-17589979 GAGCAAGAGGCCAACGGTGTGGG - Intronic
1181020707 22:20100730-20100752 GTGGAGAAGGACATGGGGGTGGG + Intronic
1181270048 22:21653311-21653333 GTGCAACAGGGAAAGAGTGTCGG - Intronic
1184937474 22:47735654-47735676 TTGCAAAAGGACAGGGGTGTGGG + Intergenic
949506803 3:4736446-4736468 GTGCCAAGGCACAAGGGTGCTGG - Intronic
950098064 3:10341609-10341631 GTGCAAAAGGACACAGGACTTGG - Intronic
951121069 3:18929785-18929807 GAGCACAAGGACAATGGTGAAGG - Intergenic
952179541 3:30903112-30903134 GTCAAAAAGGACAAGGGTGCTGG + Intergenic
953198445 3:40755334-40755356 GTGCACACTGACAAGGCTGTTGG + Intergenic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
953966750 3:47313517-47313539 GGGCAAAAGGAAAAAGTTGTGGG - Intronic
955765856 3:62343325-62343347 GTGCAAAAGCACAGAGGTGGGGG - Intergenic
956000781 3:64727993-64728015 GTGTAAAAGGAGAAAGGTGGGGG - Intergenic
956618642 3:71198465-71198487 GTGCATAAGGAGAAGGGCCTTGG + Intronic
957239967 3:77646651-77646673 ATGCAAAGGAACAATGGTGTTGG + Exonic
957714147 3:83903296-83903318 GAGCAAGAGGCAAAGGGTGTGGG - Intergenic
959662434 3:108883942-108883964 GTGCAAAAGCACAAGGGGGAAGG - Intergenic
962456643 3:135571014-135571036 GTGGAAAAGGCCCAGGGTGAGGG + Intergenic
963343412 3:144065527-144065549 GTGAAAAGGGACGAGGGTGAGGG + Intergenic
963756977 3:149244816-149244838 GGGCAAAAGCACAAAGGTGAAGG - Intergenic
965006480 3:163032693-163032715 GTGCAAAGGGATAGAGGTGTTGG + Intergenic
965315784 3:167188817-167188839 GTGGAAAAGGTAAAGGGTGTAGG + Intergenic
967830592 3:193916109-193916131 GTCCAAAAGGACAAGGGATGTGG + Intergenic
969916755 4:10498977-10498999 GAGAAAAAGGACAAGGGTTGGGG - Intronic
970334387 4:15019714-15019736 ATGAAAAAGGAGAAGGGAGTTGG + Intronic
970638560 4:18037733-18037755 GTGCAAAAGGACAAGGCAATTGG - Intergenic
972593881 4:40513335-40513357 GGGCAATATAACAAGGGTGTGGG - Intronic
972843909 4:42964661-42964683 GTGCCAAAGAGCAAGGGTTTGGG - Intronic
976856190 4:89608213-89608235 TTACAAAGGGACAAGGGAGTTGG - Intergenic
981186281 4:141807677-141807699 GTGCAAAGGGATGAGGGTGTTGG + Intergenic
985295772 4:188435759-188435781 CTGCAAAAGGAAAACGGTGAAGG - Intergenic
985649060 5:1098942-1098964 GTGCAGAATGACAAGGGAGGAGG - Intronic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
989533842 5:42540783-42540805 GTGCAGAAGGACATGGGCATGGG - Intronic
992202614 5:74399233-74399255 GAGGAAGAGGACATGGGTGTTGG - Intergenic
993246347 5:85458362-85458384 GTGCAACAGGAGAAGGGACTTGG + Intergenic
994827220 5:104729214-104729236 GTGCAATAGGAAAAGGGGCTAGG + Intergenic
997801280 5:136865201-136865223 GCGCAAAAGGAAAAGGGAGCTGG + Intergenic
997883674 5:137612360-137612382 GGGCAAGAGGACAAGGTTGTTGG + Intergenic
999463086 5:151772943-151772965 GTGACAAAGGAAAAGGGTTTGGG + Intronic
1001319047 5:170665101-170665123 CTGCAAAAGGACCAGGGCTTGGG + Intronic
1001534083 5:172486423-172486445 GGGCAGAAGGACAAGAGCGTTGG + Intergenic
1002060817 5:176624926-176624948 GTGCAAAATGACAGGAGTGGAGG + Intronic
1002394168 5:178940619-178940641 GTGCGGGAGGACAAGGATGTCGG - Intergenic
1003410248 6:5855813-5855835 GTGCAGATGGACATGGGTGCAGG - Intergenic
1006215270 6:32436724-32436746 GTGCAGAAGGAAAAGGGGGTAGG + Intergenic
1006255258 6:32827645-32827667 ATGCAAAGGCACAAAGGTGTTGG + Intronic
1006338927 6:33435330-33435352 GGGCCAAAGGACAGGGGTGATGG + Intronic
1008530874 6:52457282-52457304 GGTCAGAAGGACAAAGGTGTGGG + Intronic
1014398866 6:120962383-120962405 TTTCAAAAGGACATAGGTGTAGG + Intergenic
1015615762 6:135073029-135073051 GTGGGAAATGACAAGGATGTGGG + Intronic
1016407495 6:143745840-143745862 GAGCAAAAGAACAAAGCTGTTGG + Intronic
1017786108 6:157758509-157758531 GAGCAAAATGACAAGGGCCTGGG + Intronic
1020605229 7:10328483-10328505 GTCAAAAAGGACAAGGGCTTTGG + Intergenic
1023739150 7:43262795-43262817 GTGCAAATGGACAAGGATAGTGG - Intronic
1023814195 7:43937120-43937142 GTGCAAAAGCATAGAGGTGTGGG + Intronic
1024226273 7:47328646-47328668 GAGGAAAGGGACATGGGTGTAGG - Intronic
1024288555 7:47782304-47782326 TGGCAACAGGACAAGGATGTTGG + Intronic
1024350169 7:48355391-48355413 GTGCACAAGGGCAAGAGGGTGGG + Intronic
1025606160 7:63041422-63041444 CTGCAAAAAGGCAAGGGGGTTGG - Intergenic
1026587029 7:71664149-71664171 ATGCAAAAGCCCAAGGATGTGGG - Intronic
1027582075 7:80010418-80010440 GAGCAAAAGGACAAAGCTGGAGG - Intergenic
1029192473 7:98781440-98781462 GTGCACAAGGTCTAGGGTGAGGG + Intergenic
1030493640 7:110269843-110269865 GTGAACAAGGACAAGGACGTTGG - Intergenic
1030761471 7:113357564-113357586 CTGCAAAGGGAAAAGGGTATGGG + Intergenic
1031643059 7:124189656-124189678 GTACAAAAGGCCAGGGGTTTTGG - Intergenic
1033764946 7:144478566-144478588 GTACAAACGTACAAGGGAGTTGG + Intronic
1035489351 7:159259087-159259109 TTGCACAAATACAAGGGTGTAGG - Intergenic
1035772103 8:2155918-2155940 GTGCAGAAGGCCAAGGGCATGGG - Intronic
1036778786 8:11631543-11631565 CTGCAAAAAGGCAAGGGGGTTGG + Intergenic
1037399775 8:18483778-18483800 ATGCAAAAGGATAAGGGTTTGGG - Intergenic
1039248862 8:35639196-35639218 GTGCAACAGCACAAGAGGGTGGG + Intronic
1039752253 8:40489379-40489401 GTTAAAAAGGCCAAGGTTGTGGG - Intergenic
1041830545 8:62148089-62148111 GTGCAAGAGGACAAGTCTGCTGG + Intergenic
1042203703 8:66307065-66307087 GTGGAAAGTGACAAGGGAGTAGG - Intergenic
1044043910 8:87405603-87405625 GTGAAAAACTACAAGGGTGATGG + Intronic
1048647163 8:136434871-136434893 GTGCAAATGGAGCATGGTGTAGG + Intergenic
1050570113 9:6928952-6928974 TTACTAAAGCACAAGGGTGTGGG - Intronic
1056922169 9:90801098-90801120 GTCCAAAAGGAAAAGGGGGATGG + Intergenic
1057360035 9:94364999-94365021 CAGCAAAAAGACAAGGGTCTCGG + Intergenic
1057663306 9:97023090-97023112 CAGCAAAAAGACAAGGGTCTCGG - Intergenic
1058447825 9:105069349-105069371 GTCCACAAGGACAAGGATTTTGG + Intergenic
1062513656 9:136921483-136921505 GTGCCAGAGGACCAGGCTGTGGG - Intronic
1185816071 X:3157221-3157243 GAGCAAAAGAAGAAGGGAGTAGG + Intergenic
1186951194 X:14627408-14627430 GTGAAAAAGGAATAGGGTTTAGG - Intronic
1190036806 X:47032753-47032775 TTGGAAAAGGACCAGGTTGTGGG + Intronic
1190776518 X:53556492-53556514 GTGCGAAAGGAGACAGGTGTAGG + Intronic
1191163833 X:57366369-57366391 GGGCAAAAGAACAAAGCTGTGGG - Intronic
1192057815 X:67790061-67790083 GTTCCAAAAGACAAGGGTGTAGG - Intergenic
1192214775 X:69150603-69150625 GGGCAAAAGGAGAGGGGTGAGGG - Intergenic
1192358063 X:70422075-70422097 GTGCTAAAGCACAGGGGTCTGGG - Intergenic
1195377269 X:104240026-104240048 GTGGAAAAGGAAGAGGGAGTGGG + Intergenic
1198532937 X:137563437-137563459 GCGCAAAAGGACGAGGCTGGGGG - Intergenic
1201601181 Y:15730221-15730243 GAACAAAAGGAGAAGGCTGTAGG - Intergenic