ID: 1091849277

View in Genome Browser
Species Human (GRCh38)
Location 12:3682191-3682213
Sequence CTGAGGGTGGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2651
Summary {0: 1, 1: 3, 2: 24, 3: 271, 4: 2352}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091849277_1091849287 9 Left 1091849277 12:3682191-3682213 CCTTCCTCCTTCCCCACCCTCAG 0: 1
1: 3
2: 24
3: 271
4: 2352
Right 1091849287 12:3682223-3682245 GCTGGATCTGATTCAAAATGTGG 0: 1
1: 0
2: 0
3: 7
4: 119
1091849277_1091849290 27 Left 1091849277 12:3682191-3682213 CCTTCCTCCTTCCCCACCCTCAG 0: 1
1: 3
2: 24
3: 271
4: 2352
Right 1091849290 12:3682241-3682263 TGTGGTCTCTCGCACTGGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 118
1091849277_1091849289 23 Left 1091849277 12:3682191-3682213 CCTTCCTCCTTCCCCACCCTCAG 0: 1
1: 3
2: 24
3: 271
4: 2352
Right 1091849289 12:3682237-3682259 AAAATGTGGTCTCTCGCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1091849277_1091849288 22 Left 1091849277 12:3682191-3682213 CCTTCCTCCTTCCCCACCCTCAG 0: 1
1: 3
2: 24
3: 271
4: 2352
Right 1091849288 12:3682236-3682258 CAAAATGTGGTCTCTCGCACTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1091849277_1091849284 -9 Left 1091849277 12:3682191-3682213 CCTTCCTCCTTCCCCACCCTCAG 0: 1
1: 3
2: 24
3: 271
4: 2352
Right 1091849284 12:3682205-3682227 CACCCTCAGACTAGGATTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091849277 Original CRISPR CTGAGGGTGGGGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr