ID: 1091850479

View in Genome Browser
Species Human (GRCh38)
Location 12:3693122-3693144
Sequence CTGCCTGCACACACATGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 11, 3: 46, 4: 310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091850479 Original CRISPR CTGCCTGCACACACATGCAC CGG Intronic
900208440 1:1441407-1441429 CCCCCTGCACACACAGGCAGGGG - Exonic
900776008 1:4585929-4585951 CTTCCTGCACAGACATCCCCAGG - Intergenic
901880714 1:12192225-12192247 ATTCCTGTACACACATGCACGGG - Intronic
903364954 1:22800408-22800430 CTCCCTGCACACATATGCTGGGG - Intronic
904602909 1:31683597-31683619 CTGCCTGCCCCCAGAGGCACAGG - Intronic
906069432 1:43006593-43006615 CTGACCTCACACACGTGCACAGG - Intergenic
907704322 1:56819631-56819653 CTGCCTGGGCACAAATGCCCTGG - Intronic
908255472 1:62299952-62299974 CAGGCTGCACACACATGCCGAGG - Intronic
908783527 1:67713231-67713253 CAGTCTGCACAGGCATGCACAGG - Intronic
911107071 1:94142068-94142090 CTCCCTACTCATACATGCACTGG - Intergenic
912206833 1:107518139-107518161 CTTCCCACACACACATTCACTGG + Intergenic
912542357 1:110426650-110426672 CTGTGTGCACACACACACACAGG + Intergenic
913216260 1:116623383-116623405 CTGGCTAAACACACTTGCACTGG + Intronic
915074474 1:153297327-153297349 CTCTCTGCTCACACATGGACTGG - Intergenic
916312036 1:163408431-163408453 GTGCATGCACACACACGCCCAGG + Intergenic
917647843 1:177046667-177046689 ATACATGCACACACATGCAGAGG + Intronic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
919728672 1:200899607-200899629 CAGCCAGCACACACAAGCATCGG + Intronic
922680373 1:227590270-227590292 CTGCCTGCACATAGATGATCAGG - Intronic
922690489 1:227685409-227685431 CTGCCTGCACATAGATGATCGGG + Intergenic
922743777 1:228031591-228031613 ACACATGCACACACATGCACAGG - Intronic
922765611 1:228155184-228155206 CTCGCCACACACACATGCACAGG - Intronic
923665308 1:235993627-235993649 CGGCCTGCACCCACTTACACGGG + Exonic
924014591 1:239706818-239706840 ATGCATGTACACACATGCAGAGG + Intronic
924248463 1:242107605-242107627 CAGCTTTCACACACATGCAGAGG + Intronic
1063261970 10:4399851-4399873 CTGTCTGCACACACGTGTAGAGG - Intergenic
1064174937 10:13066720-13066742 GAGCCTGCCCACACGTGCACTGG + Intronic
1065183326 10:23148395-23148417 ATGCATGCGCACACATGCACAGG - Intergenic
1065183327 10:23148449-23148471 CCACATGCACACACACGCACAGG - Intergenic
1066567839 10:36738871-36738893 CTGTATGCACACATATGCAGGGG - Intergenic
1067556588 10:47277426-47277448 CTGCCTGGGCACTCATGGACAGG - Intergenic
1068195244 10:53707588-53707610 CTAGCTTCACAAACATGCACAGG + Intergenic
1068261976 10:54594664-54594686 CTGTCTGCAAACACATGTACAGG - Intronic
1069713944 10:70508842-70508864 AGGCCTGCACACACACACACAGG - Intronic
1071175642 10:82923797-82923819 ATGCGTGCACACACACACACAGG - Intronic
1071347527 10:84706966-84706988 CTGCCAGCACACAGAAGCACAGG - Intergenic
1071603359 10:86969665-86969687 CTGCCTGTCCACAGAGGCACTGG + Intronic
1072740806 10:97907999-97908021 CTGCCTCCACTCACCAGCACTGG + Exonic
1073214906 10:101830800-101830822 CGCCCTCCACACACATGCAGGGG + Intronic
1073894149 10:108134896-108134918 CACCCCTCACACACATGCACTGG + Intergenic
1074791924 10:116897843-116897865 GTGCCTGTCCACATATGCACAGG - Intronic
1075914472 10:126155594-126155616 CTGGGTGCACACACTTGCAAAGG + Intronic
1076534316 10:131167166-131167188 CTGCCTGCACACACAGGCACAGG - Intronic
1076806335 10:132861015-132861037 CTGCCTGCACACATCTGTAGAGG - Intronic
1077443919 11:2581436-2581458 GGGCCTGCACCCACATGCACAGG - Intronic
1077515599 11:3000229-3000251 CTGCCACCATCCACATGCACTGG + Intergenic
1079093708 11:17497611-17497633 CTGCCTGCATACAGTTGCACAGG + Intronic
1079320583 11:19448240-19448262 CTGCCTGCCCACACCTCCTCAGG - Intronic
1080313842 11:30925982-30926004 CTGCCTTCCCAAACAAGCACCGG + Intronic
1080833612 11:35919256-35919278 CAGCCTGCCCACACAGGAACCGG + Intergenic
1081687710 11:45054245-45054267 CTGTCTGCACTCACATCCCCGGG + Intergenic
1082098000 11:48146734-48146756 ATGCATGCACACACACACACAGG - Intronic
1082996679 11:59261103-59261125 CTGTCTCCACACAGATACACAGG + Intergenic
1083669157 11:64290990-64291012 CTGCCTGAACACCCAGGCCCTGG - Intergenic
1084126083 11:67099928-67099950 CTGCCTCCAAACACATGCACAGG - Intergenic
1084237195 11:67795937-67795959 CTGCCTGCACACAGAGACACGGG - Intergenic
1084401639 11:68947304-68947326 CTGCCTGCAAACACAGGCAGAGG + Intergenic
1084706353 11:70818281-70818303 ATGCATGCACATACATACACAGG + Intronic
1084949234 11:72655488-72655510 GTGCGTGCACACACACACACAGG - Intronic
1085457926 11:76675895-76675917 CTGCCTGGACTCACCTGTACTGG - Intergenic
1085458134 11:76677310-76677332 ATGCCTGTACACACAGGCACAGG + Intergenic
1086611107 11:88757272-88757294 CTACCTGCATACATGTGCACTGG - Intronic
1086741975 11:90379799-90379821 CTGCCTGCCCACACATGTTAAGG - Intergenic
1086759531 11:90610912-90610934 CCACATGCACACACATGCCCAGG - Intergenic
1090556613 11:127883253-127883275 CTGCCTCCAGGCACATGCCCTGG - Intergenic
1091432801 12:451180-451202 CTGCCTGCCCACGCATGCACTGG + Intergenic
1091755632 12:3049606-3049628 CTGCCTCCACACACTTGCCCTGG - Intergenic
1091767186 12:3129271-3129293 CTGCCTGCACACCCACCCACAGG + Intronic
1091850479 12:3693122-3693144 CTGCCTGCACACACATGCACCGG + Intronic
1092208693 12:6632506-6632528 CTGCCTGAACACAGAAGCAGAGG - Intronic
1094798125 12:34000298-34000320 CTGCCAGCTCACACATCCATGGG - Intergenic
1095043886 12:37477038-37477060 ATGCATGCACACACATGTTCAGG + Intergenic
1095110890 12:38294386-38294408 CTGCCAGCTCACACATCCATGGG - Intergenic
1096087188 12:48873613-48873635 ATGCATACACACACATGCACTGG - Intergenic
1096674288 12:53218244-53218266 CTGCCCGCACACACTTTCAGAGG - Intronic
1096780205 12:53987284-53987306 ATGCCCGCTCACACATGCACAGG + Intronic
1097985241 12:65776002-65776024 ATGCCTGCACCCACATGGAAGGG + Intergenic
1099277571 12:80597228-80597250 ATGCCTGCATACAAATGAACAGG + Intronic
1101803251 12:108041149-108041171 CAGTCTGCACACAGATCCACTGG + Intergenic
1102259775 12:111436908-111436930 CTCCCGCCACACACATACACGGG + Intronic
1102582379 12:113898180-113898202 CACCCTCAACACACATGCACAGG - Intronic
1107445842 13:40469833-40469855 CTGCCAGCACACACACTCCCAGG + Intergenic
1108166015 13:47693901-47693923 GTGCGTGCACACACATGCACAGG - Intergenic
1109058591 13:57582944-57582966 CTGCCAGCTCACACATCCATGGG + Intergenic
1109686858 13:65831561-65831583 CTCCCTGCAGATATATGCACAGG + Intergenic
1111171187 13:84528400-84528422 GTGCATATACACACATGCACTGG + Intergenic
1111346376 13:86960022-86960044 CTGCCAGCACAAAGAAGCACTGG - Intergenic
1112329423 13:98465421-98465443 ATGCCTGCACACATCTCCACTGG + Intronic
1113556427 13:111239348-111239370 ATGCCATCACACACATCCACGGG + Intronic
1113608105 13:111624717-111624739 CTGCCTGCTCACAGACCCACAGG + Intronic
1114006121 14:18314974-18314996 CTGTATGCACACATATGCAGGGG - Intergenic
1114569342 14:23655262-23655284 CTGCTTGCACAGACATAGACTGG - Intergenic
1118953469 14:70457370-70457392 CTGCCAGGACACAGATCCACAGG + Exonic
1119035590 14:71228004-71228026 GTGCGCACACACACATGCACAGG + Intergenic
1119436407 14:74600451-74600473 ATGCCCCCACACACATGCACTGG + Intronic
1120924516 14:89784349-89784371 CTACATACACACACATGCACAGG + Intergenic
1121559979 14:94867218-94867240 ATGCCCCCACACACATTCACAGG + Intergenic
1122309239 14:100784095-100784117 CTGCCAGCAGACACCTGGACAGG + Intergenic
1122436946 14:101706857-101706879 CTGCCTGCACACCCTGGGACAGG + Intergenic
1123941168 15:25217360-25217382 CTCCCTGCACAAACATCCAGTGG - Intergenic
1127312713 15:57766863-57766885 CTGGCAGCACACACATGTCCTGG - Intronic
1128156260 15:65393814-65393836 CTGCCAACACACACACACACGGG + Intronic
1128356680 15:66932632-66932654 ATGCTCACACACACATGCACAGG + Intergenic
1128532819 15:68466199-68466221 ATGCCTACACATACATACACTGG - Intergenic
1128707265 15:69845710-69845732 CTCCCTCCCCACACATACACAGG - Intergenic
1129018672 15:72493376-72493398 TTGCCTGAACAGACATGCACAGG - Intronic
1129059619 15:72850294-72850316 GTACCTGCACACACACACACAGG + Intergenic
1129387254 15:75202689-75202711 CTGCGTGCACACGTATGCCCGGG + Intronic
1129517984 15:76168519-76168541 GAGCCTGCAGACAAATGCACCGG + Intronic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1133391749 16:5415933-5415955 CTGAGTCCACACACATGCAGAGG - Intergenic
1133822836 16:9252216-9252238 ATGCATGCACACACACACACAGG - Intergenic
1134490660 16:14693494-14693516 CCGCCAGCACACAGATGCGCAGG - Intronic
1134496041 16:14732617-14732639 CCGCCAGCACACAGATGCGCAGG - Intronic
1134634797 16:15784173-15784195 CGCACTGCACACGCATGCACAGG + Intronic
1135513086 16:23105129-23105151 CTGCCCACATACACATCCACAGG + Intronic
1135665823 16:24334861-24334883 ATGCATGCACCCACATGCACAGG + Intronic
1136154758 16:28375183-28375205 CCGCCAGCACACAGATGCGCAGG + Intergenic
1136208334 16:28740075-28740097 CCGCCAGCACACAGATGCGCAGG - Intergenic
1136264419 16:29106756-29106778 CCGCCAGCACACAGATGCGCAGG - Intergenic
1136402189 16:30024961-30024983 CTTCCTGCACACCCTTGCGCTGG - Exonic
1137554321 16:49461139-49461161 CTGCCTTCTCACCCCTGCACAGG + Intergenic
1139898215 16:70305600-70305622 AAGCCAGCACACACAAGCACAGG - Intronic
1141360338 16:83389873-83389895 CTGTCTGCATGCAGATGCACAGG - Intronic
1141696324 16:85621369-85621391 CTCCCTGCACACCCCAGCACGGG - Intronic
1142504095 17:351950-351972 CGGCCTGTACGCACATGCAGGGG - Intronic
1143108726 17:4542039-4542061 CCACCTGCACACAAAGGCACAGG - Intronic
1143433997 17:6909177-6909199 TTGCCTGTAAACACATGCAGTGG + Intronic
1144625769 17:16843780-16843802 CGGCCTCCACACTCAGGCACAGG + Intergenic
1144880663 17:18428940-18428962 CGGCCTCCACACTCAGGCACAGG - Intergenic
1145151574 17:20515447-20515469 CGGCCTCCACACTCAGGCACAGG + Intergenic
1146248221 17:31310496-31310518 CTCCCTGCACTCACAAACACAGG - Intronic
1147418302 17:40309265-40309287 CTGCCAGCACACACCTGAGCAGG + Exonic
1149737924 17:59013951-59013973 CAAGCTGCACACACTTGCACAGG + Intronic
1151408443 17:73904407-73904429 CTGCCAGCACAGACAGGTACAGG + Intergenic
1152231081 17:79114505-79114527 GCCCCTGCCCACACATGCACCGG + Intronic
1152735268 17:81994171-81994193 ATACCTGCCCACCCATGCACGGG + Intronic
1153581899 18:6582235-6582257 CTGCCAGCTCACACATCCATGGG - Intronic
1153873522 18:9343938-9343960 CTGCCTGTGCACACAGGCAGTGG + Intronic
1154478917 18:14797316-14797338 CTGACTGCACATCCATTCACAGG + Intronic
1154531355 18:15349207-15349229 CTGTATGCACACATATGCAGGGG + Intergenic
1157557187 18:48620643-48620665 CTGCCTGCACAAGCATGTACAGG + Intronic
1157587474 18:48813917-48813939 CTGCCTTAATACACAGGCACAGG + Intronic
1158378420 18:56900700-56900722 CTGCCTCCACTCACAGGCAGCGG - Intronic
1160059662 18:75517575-75517597 CTGCCTGTGCCCACATCCACAGG - Intergenic
1160195607 18:76752592-76752614 CTGCCTGTCCAAACTTGCACTGG - Intergenic
1160386103 18:78497898-78497920 CGGCCAGCACACACCTGCCCAGG + Intergenic
1160585955 18:79913640-79913662 GTACTTGCACACACGTGCACAGG - Intronic
1160621866 18:80176845-80176867 CAGGATACACACACATGCACGGG + Intronic
1161593804 19:5141163-5141185 CTGCCTGCACAGCCCTGCCCAGG - Intronic
1163055852 19:14717081-14717103 CTGCCTGGGCTCACCTGCACAGG - Exonic
1164960221 19:32421755-32421777 CTGCCTGCACACCCATCCCATGG - Intronic
1165363421 19:35350479-35350501 CTGCCTGTTCACACCTGCGCTGG - Intergenic
1165365574 19:35362927-35362949 CTGCCTGTTCACACCTGCACTGG - Intergenic
1166054866 19:40282431-40282453 CTCCCAGCACACACCTGCCCAGG + Intronic
1167549236 19:50148119-50148141 CGGCCTGCACCCACCTGCTCCGG + Intergenic
1167621820 19:50564938-50564960 GTGCCTGCACACACACCCTCAGG - Intronic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
925841927 2:8000158-8000180 ATGCAAGCACACACATGCTCAGG + Intergenic
925955645 2:8961488-8961510 CTGTCAGAGCACACATGCACAGG + Intronic
926133352 2:10319341-10319363 CTGCATGCTCCCACAGGCACGGG - Intronic
926663596 2:15495208-15495230 CGGCCTGCACCCACTTGTACAGG + Intronic
928354870 2:30602533-30602555 CTGCCTAGACACACCTGCACTGG + Intronic
932279041 2:70473524-70473546 CTGCCTGCACACACAGCCCCAGG - Intronic
933117943 2:78497991-78498013 CTGCCTGAGCACACATGCACTGG - Intergenic
933239702 2:79906355-79906377 GTGCATGCACACACTTACACAGG + Intronic
934716394 2:96547089-96547111 CTACATGCACACACACACACAGG - Intronic
936009929 2:108919066-108919088 CTGACTGCACACACATCTCCAGG - Intronic
936122336 2:109757547-109757569 CTGCCTGAACCCACATGCTGGGG - Intergenic
936222357 2:110613927-110613949 CTGCCTGAACCCACATGCTGGGG + Intergenic
936374329 2:111927773-111927795 CTCCCTGCACACACACACTCAGG + Intronic
936531994 2:113282966-113282988 ACGCCTGCACCCACAGGCACGGG - Intergenic
937146797 2:119653770-119653792 CTGCCTGCATTCAAATGCCCTGG + Intronic
937426542 2:121804438-121804460 CTCCCTACACACACACACACAGG - Intergenic
937456513 2:122046124-122046146 GTGCATGCACACATGTGCACAGG - Intergenic
937731576 2:125237775-125237797 GTGCCTCCAGACACTTGCACTGG - Intergenic
938313467 2:130310283-130310305 CTGCATGCACATGCACGCACAGG - Intergenic
938530453 2:132180487-132180509 CTGTATGCACACATATGCAGGGG + Intronic
940431619 2:153598088-153598110 TTACATACACACACATGCACGGG - Intergenic
946577152 2:221087896-221087918 ATGCATGCACACATATACACAGG - Intergenic
947361832 2:229353243-229353265 ATGCACGCACACACAGGCACAGG + Intergenic
947579826 2:231308202-231308224 ATGCCTGCACACGGAAGCACTGG - Intronic
947651245 2:231787857-231787879 CTGCCTATACACAGAGGCACCGG - Intronic
948082876 2:235220728-235220750 CTGTCTCCACACAGATGCATTGG + Intergenic
1169241680 20:3986622-3986644 CTGCATGCACACTCATGCCTGGG - Intronic
1169308356 20:4514430-4514452 CTACATGCACACACACTCACAGG - Intergenic
1169479303 20:5963277-5963299 CTGCCTCGACACACAGGCACAGG - Exonic
1171262905 20:23748788-23748810 CTCCCTGCACACACTGGCACAGG + Intronic
1171320871 20:24242970-24242992 CTGCATACATGCACATGCACAGG + Intergenic
1172899572 20:38324667-38324689 CTGACTGCACACACAGACAGTGG - Intronic
1173075236 20:39812182-39812204 CTGTCTCCACACACATACCCTGG + Intergenic
1173793644 20:45843801-45843823 CAGTCTGCACACCCATGCACGGG - Intronic
1173929336 20:46805688-46805710 CTGACAGCACACACATTTACAGG + Intergenic
1175728113 20:61333223-61333245 ACGCATGCACACATATGCACAGG + Intronic
1175778504 20:61667670-61667692 GTGCATGCACACTCATGCCCTGG + Intronic
1176000555 20:62829582-62829604 GTGCCTGCCTACACCTGCACTGG - Intronic
1176229010 20:64021453-64021475 ATACATGCACACACATGCACGGG - Intronic
1176766001 21:13018944-13018966 CTGTATGCACACATATGCAGGGG - Intergenic
1176800677 21:13426663-13426685 CTGACTGCACATCCATTCACAGG - Intergenic
1179116200 21:38494817-38494839 GTGCATGCACACACAGGCAGAGG + Intronic
1180055024 21:45353175-45353197 GTATGTGCACACACATGCACAGG + Intergenic
1180430631 22:15245781-15245803 CTGTATGCACACATATGCAGGGG - Intergenic
1180958785 22:19753271-19753293 CTGCATGCAGACACACGGACTGG - Intergenic
1181474819 22:23161590-23161612 CTCCCTGCACACACACGGACAGG + Exonic
1182421961 22:30252938-30252960 CTCACTACACACACATGCTCAGG - Intergenic
1183104533 22:35606655-35606677 CTCTCTGCACACACAAGCCCAGG + Intergenic
1183250675 22:36728170-36728192 CACACTGCCCACACATGCACAGG - Intergenic
1184488523 22:44795881-44795903 CCACTTGCCCACACATGCACAGG + Intronic
1184727471 22:46355336-46355358 CTACCAGCACACACACACACAGG - Intronic
1184941330 22:47767600-47767622 CTGCCTGCAGAAACAAACACTGG + Intergenic
1184954613 22:47877432-47877454 CGTGCTGCACACACAGGCACAGG - Intergenic
1184990631 22:48167065-48167087 ACTCATGCACACACATGCACGGG + Intergenic
1185419105 22:50725501-50725523 CTGCCTGCAGCCAGAAGCACCGG - Intergenic
949390142 3:3552840-3552862 CTGACTGCCCACACAACCACGGG - Intergenic
949497263 3:4644296-4644318 CTCTCAGCACACGCATGCACTGG - Intronic
950979084 3:17282314-17282336 CTTTCTGAACACACATGCATAGG + Intronic
951040053 3:17980117-17980139 ATCTCTGGACACACATGCACTGG + Intronic
952181503 3:30921056-30921078 CTGCCAGCACCCAAAAGCACTGG + Intergenic
952669834 3:35953367-35953389 CTGCTGGCACACACATGCACAGG - Intergenic
953512456 3:43556310-43556332 CTGCCTGCACATCTCTGCACAGG - Intronic
955521262 3:59777767-59777789 CTGCCTGCTCACCAATGCTCCGG + Intronic
955751807 3:62191081-62191103 ATGCACACACACACATGCACGGG - Intronic
956665267 3:71636581-71636603 CTGCCTGCACACACGGTGACAGG - Intergenic
957322141 3:78645017-78645039 CTGGATGCACAAACATGCCCTGG + Intronic
960688072 3:120313802-120313824 CTGCCTTCATACACATACACTGG - Intergenic
960785800 3:121371991-121372013 CTACCTGCACACACATGTGCTGG + Intronic
960991121 3:123312047-123312069 CTGCCTGCAGCCACCTTCACTGG - Intronic
960993135 3:123324691-123324713 CTGCCTACACACACCGGGACAGG - Intronic
961301686 3:125925838-125925860 CTGCCTGCACACACAGACACGGG + Intergenic
961417273 3:126768377-126768399 CTTCCTGTACAGCCATGCACAGG + Intronic
962096362 3:132296891-132296913 CTGCCTGCACATAGATGATCAGG - Intergenic
965157094 3:165075529-165075551 CAGCCTTCACACACTTGCAAAGG - Intronic
965419216 3:168436411-168436433 CTCCCTCAACACACATACACTGG + Intergenic
966020824 3:175206976-175206998 CTGGATGCTCACACATACACTGG + Intronic
968134924 3:196214341-196214363 CTTCCTGCACACAAAGGCAATGG + Intronic
968522741 4:1041459-1041481 GCGCCAGCACACACATGCAGGGG - Intergenic
969238473 4:5884476-5884498 ATGCATGCACACACACACACGGG + Intronic
969504878 4:7579354-7579376 GTGCGTGCACACACACACACGGG - Intronic
969628980 4:8324374-8324396 CTGCCTGCAGCCACTTGCCCTGG + Intergenic
970128886 4:12844792-12844814 CTGCCTCCAAACAGCTGCACTGG - Intergenic
970401080 4:15718636-15718658 CTGACACCACGCACATGCACTGG + Intronic
971526077 4:27620695-27620717 CTGCCAGCTCACACATCCATAGG - Intergenic
975575547 4:75858902-75858924 CTGCCTACTCAAACATGAACTGG + Intergenic
979665285 4:123304363-123304385 CTGTTTGCGAACACATGCACTGG - Intronic
980253185 4:130344718-130344740 TAGCCTGCACACAAATGCCCAGG + Intergenic
981648572 4:147028596-147028618 CTCTCTGCAAACACATGCATAGG - Intergenic
982223207 4:153142139-153142161 CTGGCTGCACACCTGTGCACAGG - Intergenic
982584863 4:157222874-157222896 CTGCCTGCCCACGCCTGCGCGGG - Intronic
983593574 4:169441456-169441478 GTGCCTGCACACACAGTCAGGGG + Intronic
984097094 4:175447318-175447340 TTGCCTGAACACACAGGCACAGG - Intergenic
984126165 4:175813500-175813522 CAGCCAGCACACACACACACAGG + Intronic
985133775 4:186765333-186765355 CTGGCCGCACCCACATTCACCGG - Intergenic
985833225 5:2251445-2251467 CTGCCAGGACAAACATGCACAGG + Intergenic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
986053706 5:4114728-4114750 ATGCAGGCACACACGTGCACAGG + Intergenic
988172953 5:27682876-27682898 ATGCCTGGACACCCATGCAGAGG - Intergenic
988702606 5:33690130-33690152 ATGGATGCACACACCTGCACTGG - Intronic
990161436 5:52944235-52944257 CTGCCAGCTCACACATCCATTGG + Intronic
992169166 5:74085147-74085169 CTGCCTCAGCACACAGGCACTGG + Intergenic
992979446 5:82153018-82153040 CTGCCTTCACTCACATTCAAAGG + Intronic
993004400 5:82415094-82415116 CTGGCTTAACACACAAGCACAGG - Intergenic
994603971 5:101943228-101943250 CTGCCGGCTCACACATTCATGGG + Intergenic
994687370 5:102971964-102971986 TTGGCTGCACACAGTTGCACAGG - Intronic
997294124 5:132759416-132759438 CTGCCTGCACCCACCTTCACTGG + Intronic
997765873 5:136502456-136502478 ATGCTTGCACACACATGCTGTGG - Intergenic
997944534 5:138188009-138188031 CCTGCTGTACACACATGCACAGG + Exonic
1001016627 5:168147624-168147646 CTGGCTGCACACAAAAGCAATGG - Intronic
1001856135 5:175012462-175012484 CTGCCTGCACTCACAGGGCCTGG - Intergenic
1002060844 5:176625096-176625118 ATGCCTGCACACACATGTCATGG + Intronic
1002130762 5:177080125-177080147 CTGCCTCCACAAAAATGCCCTGG + Intronic
1002271987 5:178078580-178078602 CTCCCTGCACGCACGTCCACTGG + Intergenic
1004205428 6:13587586-13587608 CTGCCTGAACACAGACCCACAGG - Intronic
1005843267 6:29758479-29758501 CTCCCTGCAAACAGATGTACAGG + Intergenic
1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG + Intergenic
1007502966 6:42312744-42312766 TCGACTCCACACACATGCACTGG + Intronic
1007608261 6:43131836-43131858 GTGCCTGCATACACTTGCTCAGG - Intronic
1007719839 6:43878422-43878444 CTCCCGGCACACACCTCCACTGG + Intergenic
1008688118 6:53946309-53946331 GTGGCTGCCCACAGATGCACTGG - Intronic
1008904267 6:56658908-56658930 CTGGCTCCCCACTCATGCACTGG - Intronic
1010373743 6:75141754-75141776 ATACATGCACACACATACACAGG + Intronic
1011290547 6:85772522-85772544 CTGCCTATACACACATGTGCTGG + Intergenic
1011615414 6:89193550-89193572 CTTCCTGCACTCACATCCAGTGG + Intronic
1015236405 6:130976121-130976143 CTTCCTGAACAAACATGGACAGG + Intronic
1015923373 6:138287226-138287248 CAGTATGCACACACCTGCACAGG + Intronic
1018774555 6:167000753-167000775 ATGCCTGCACAGACATGGAAAGG - Intronic
1019528139 7:1490107-1490129 CTGCCTGGAGCCACATGCAGAGG + Intronic
1019586655 7:1808530-1808552 CTGCATGCACACGCACACACAGG - Intergenic
1019601769 7:1887404-1887426 ATGCACACACACACATGCACAGG - Intronic
1019601790 7:1887654-1887676 ATGCTCACACACACATGCACAGG - Intronic
1019601805 7:1887894-1887916 ATGCATGCACACACATGCACAGG - Intronic
1019601808 7:1887928-1887950 GTGCATACACACACGTGCACAGG - Intronic
1019601824 7:1888143-1888165 ACACATGCACACACATGCACAGG - Intronic
1019601827 7:1888205-1888227 ATGCATGCACACACATGCACAGG - Intronic
1019601832 7:1888273-1888295 ATGCATGCACACACATGCACAGG - Intronic
1019601835 7:1888341-1888363 ATGCATGCACACACATGCACAGG - Intronic
1019601841 7:1888437-1888459 ATGCGTGCACACACATGTACAGG - Intronic
1019601850 7:1888603-1888625 ATGCATGCTCACACATGCATAGG - Intronic
1020233830 7:6340390-6340412 GTGTCTGTACACACATGCAGTGG - Intronic
1020320220 7:6934431-6934453 CTGCCTGCACAGAGAGACACGGG - Intergenic
1022883242 7:34612844-34612866 CTGTCTGTACCCACATGCATGGG + Intergenic
1023386800 7:39666347-39666369 CTTCCAACACACACAGGCACAGG - Intronic
1024008532 7:45246163-45246185 ATGCATGCACAAACATGCACAGG + Intergenic
1024033394 7:45484305-45484327 CTGCCTGCTCACCCCTGCAGAGG + Intergenic
1024918832 7:54535428-54535450 GTGCATGCATGCACATGCACAGG - Intergenic
1030448353 7:109676189-109676211 AAACATGCACACACATGCACAGG + Intergenic
1030502296 7:110374894-110374916 CTGCCAGCACAGACTTGCAGGGG + Intergenic
1033601308 7:142890712-142890734 CTGCAGACACACACATGCACAGG + Intergenic
1033791369 7:144795884-144795906 CTGCCTGGAAACCCATGCTCAGG - Intronic
1034491048 7:151393285-151393307 CTGTGTGCACACACAGGCATAGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035353814 7:158265306-158265328 CTGCAGGCACACACCTGCAGGGG + Intronic
1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG + Intronic
1035448961 7:158962771-158962793 GTGTATGCACACACATACACGGG - Intergenic
1035623125 8:1050060-1050082 ATACGTGTACACACATGCACAGG + Intergenic
1035636243 8:1146594-1146616 GTGCATGCACACACATGCGCAGG - Intergenic
1040074003 8:43211258-43211280 GTGCCTCCACACCCTTGCACAGG + Intergenic
1040567307 8:48579319-48579341 CTGGCTGCACCCACATGGGCAGG + Intergenic
1041140524 8:54813689-54813711 CAGCATTTACACACATGCACTGG + Intergenic
1041569453 8:59320662-59320684 CTGCCCGCACATTCTTGCACTGG - Intergenic
1041832177 8:62166226-62166248 TTCCCTGCACACACAGTCACTGG + Intergenic
1042864276 8:73343953-73343975 GTCCCTACTCACACATGCACAGG + Intergenic
1042964102 8:74332699-74332721 CTGTCTGTATACACATGCCCAGG + Intronic
1044215329 8:89602772-89602794 CCTCCAGCACACACATGAACTGG - Intergenic
1044388697 8:91622774-91622796 GTGTCTGCACACACACACACAGG + Intergenic
1045994806 8:108350996-108351018 CTCCCTCCATACACAGGCACTGG - Intronic
1046492743 8:114974193-114974215 TTGCCAGCACACACTTGGACTGG - Intergenic
1047335678 8:123933545-123933567 GTGCATGTGCACACATGCACAGG + Intronic
1048251698 8:132871481-132871503 CTGCGTCCACACACCAGCACTGG - Exonic
1048882192 8:138880335-138880357 GCGCGTGCACACACACGCACAGG - Intronic
1049507067 8:143008505-143008527 CCACCTGCACAGACATGCACTGG + Intergenic
1049634399 8:143679231-143679253 CTGCCTGCACATACATGATCGGG + Intergenic
1050424840 9:5502238-5502260 CTGCCTGTACACGCAGGTACTGG - Intergenic
1051665342 9:19463347-19463369 GTGCTGGCACACACATGCCCAGG + Intergenic
1052112822 9:24609656-24609678 ATCCATTCACACACATGCACAGG + Intergenic
1052567687 9:30178747-30178769 CTGCCTGCTCACATCTGCATAGG + Intergenic
1053302692 9:36963080-36963102 CTGCACCCACACACAGGCACTGG - Intronic
1053709063 9:40786975-40786997 CTGTATGCACACATATGCAGGGG + Intergenic
1054205803 9:62129382-62129404 CAGCCTGCACACCCTTGCTCAGG + Intergenic
1054418972 9:64907776-64907798 CTGTATGCACACATATGCAGGGG + Intergenic
1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG + Intergenic
1059944788 9:119398463-119398485 TTTCCTCCACACACATTCACTGG + Intergenic
1060107985 9:120886288-120886310 TTCCCTGCACACACATGCCTGGG - Intronic
1060209861 9:121703042-121703064 CAGCCAGCACACACATACTCTGG - Intronic
1060488570 9:124065326-124065348 TGGGCTGCACACACCTGCACAGG + Intergenic
1061573646 9:131492861-131492883 CTGCCTTCACACACCAGCACGGG - Intronic
1062609136 9:137365660-137365682 CCACACGCACACACATGCACAGG + Intronic
1185931852 X:4212350-4212372 CTGCATGCACTCACCTGCAATGG + Intergenic
1185964900 X:4589571-4589593 CTGCCAGCACACCCCTCCACAGG - Intergenic
1187644176 X:21328588-21328610 CTGCCTGCACACAAATGTGCTGG - Intergenic
1188768553 X:34126064-34126086 CTGCCTGGGCATACATGCACAGG + Intergenic
1189192464 X:39122350-39122372 CTGCCAGCACCCACATCCCCTGG - Intergenic
1190397327 X:49998322-49998344 ATTCCTGCTCATACATGCACAGG + Intronic
1191800419 X:65073202-65073224 ATGCATGCACACACATACGCTGG + Intergenic
1192237093 X:69302857-69302879 CTGTCTGCTCACCCATCCACTGG - Intergenic
1192766643 X:74146695-74146717 GTGCATACACACACATGAACTGG - Intergenic
1193593530 X:83419311-83419333 GTGCATGCACACACGTGCACTGG - Intergenic
1194329251 X:92560643-92560665 CTGGCTGAACACCCATGAACTGG + Intronic
1194673392 X:96764374-96764396 CTGCCTCCACACACATGGTTTGG - Intronic
1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG + Intergenic
1196150254 X:112365746-112365768 CTGCCTGCCCACATAGGCAATGG + Intergenic
1196473731 X:116058731-116058753 TTGCATGCACACACATGTGCTGG + Intergenic
1196473738 X:116058774-116058796 CTGCCCACACACACATGCACTGG + Intergenic
1196760661 X:119198052-119198074 CTGCCTCCACACAGATGCAAGGG + Intergenic
1198300728 X:135332021-135332043 CTGCCTGGACACTCCTGCATCGG + Intronic
1199506161 X:148563490-148563512 CAGCATGCACACACACACACAGG - Intronic
1199849655 X:151716284-151716306 TTTCCAACACACACATGCACAGG - Intronic
1200067293 X:153509957-153509979 CTGTGTGCACCCACTTGCACTGG + Intergenic
1200637951 Y:5679832-5679854 CTGGCTGAACACCCATGAACTGG + Intronic