ID: 1091852934

View in Genome Browser
Species Human (GRCh38)
Location 12:3714982-3715004
Sequence TTACTTCTCTTTACAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091852928_1091852934 8 Left 1091852928 12:3714951-3714973 CCATTATTCCACTGCCCATCTGT 0: 1
1: 0
2: 0
3: 21
4: 203
Right 1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG 0: 1
1: 0
2: 0
3: 22
4: 291
1091852930_1091852934 -6 Left 1091852930 12:3714965-3714987 CCCATCTGTAGCAGACCTTACTT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG 0: 1
1: 0
2: 0
3: 22
4: 291
1091852929_1091852934 0 Left 1091852929 12:3714959-3714981 CCACTGCCCATCTGTAGCAGACC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG 0: 1
1: 0
2: 0
3: 22
4: 291
1091852931_1091852934 -7 Left 1091852931 12:3714966-3714988 CCATCTGTAGCAGACCTTACTTC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG 0: 1
1: 0
2: 0
3: 22
4: 291
1091852927_1091852934 20 Left 1091852927 12:3714939-3714961 CCAATGTATTTTCCATTATTCCA 0: 1
1: 0
2: 2
3: 52
4: 582
Right 1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG 0: 1
1: 0
2: 0
3: 22
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091852934 Original CRISPR TTACTTCTCTTTACAGCTGA GGG Intronic
902076978 1:13794990-13795012 TCACTTCTCTTTAGTTCTGATGG - Intronic
902753625 1:18534886-18534908 AGACTTCTCTTTACACCTCAAGG - Intergenic
902944928 1:19828449-19828471 TTGCTTCTCTATTCATCTGATGG + Intergenic
903322366 1:22550787-22550809 TTGCTTCTCTCTCCAGCCGAGGG - Intergenic
905778878 1:40690528-40690550 TTAGATCTTTTTACAGATGAAGG + Intergenic
906053267 1:42892647-42892669 TAATATGTCTTTACAGCTGAAGG + Intergenic
907026408 1:51124514-51124536 TTACTGCTCTTTGCAGATCAGGG + Intronic
907537191 1:55174538-55174560 ATACTGCTCCTAACAGCTGAAGG + Intronic
907791370 1:57668319-57668341 CTACTGTCCTTTACAGCTGAAGG - Intronic
908116714 1:60948073-60948095 TTGATACTCTTTACAGCAGAGGG + Intronic
909913329 1:81287504-81287526 TTCCTTCTTTTTATAGGTGAAGG + Intergenic
910641646 1:89470151-89470173 CTATTTATCTTTAGAGCTGATGG + Intergenic
913124127 1:115769591-115769613 TTACTTCTCATTGGAGCTGGTGG + Intergenic
914395817 1:147267197-147267219 TGAGTTCTATTTACAGTTGAGGG + Intronic
916770809 1:167905783-167905805 TTCCTTCCATTTACAGCTTAAGG - Intronic
917045603 1:170856594-170856616 TTACGTCTCATTACTGGTGACGG - Intergenic
917083619 1:171282943-171282965 ATGCTTATCTTTTCAGCTGACGG + Intronic
917514503 1:175696326-175696348 TTCCTCCTTTTTACAGCTGTAGG + Intronic
917688682 1:177445029-177445051 TTACTTCCCTTTAGAGTAGAGGG + Intergenic
917946388 1:179975963-179975985 TTACCTCTCTTAACTCCTGATGG - Intronic
918013490 1:180609864-180609886 TTACTTCTGCTGACAGCTCATGG + Intergenic
918887521 1:190214425-190214447 TTACTTCTCTTCCCAGATGCAGG - Intronic
919393941 1:197021878-197021900 TGAGTTCTCTTGAGAGCTGATGG + Intergenic
919957458 1:202433022-202433044 TTTCTTCTCTATAGAACTGATGG - Intronic
919966300 1:202529516-202529538 TTATTTTTCTTAACACCTGATGG + Intronic
920986677 1:210897243-210897265 CTACTTCTCTTTTCTGGTGAAGG - Intronic
921418628 1:214920413-214920435 ATAATTCTCTTTACAGTTGATGG + Intergenic
921907089 1:220506440-220506462 TTATTGCTCTTTAAAACTGAAGG - Intergenic
922576443 1:226663972-226663994 TTGCTTCTCTGTAAATCTGAGGG - Intronic
922923506 1:229328711-229328733 CTACTTCCCTTTAAAGTTGAGGG + Intronic
1063167324 10:3475399-3475421 TTTTTTTTCTTTACAGCTGGGGG - Intergenic
1063519661 10:6729678-6729700 TTTATTTTCTTTACAGATGATGG - Intergenic
1065296422 10:24279758-24279780 TTACTTCTCTTTACAGTGACAGG + Intronic
1068230361 10:54163451-54163473 TGACTTCTCATGAGAGCTGATGG - Intronic
1071937602 10:90548652-90548674 TTACTAGTCTTTACTGCTGATGG - Intergenic
1072974441 10:100045421-100045443 TTACTTCTGCTTACAGTTGCAGG - Intronic
1074029881 10:109676585-109676607 TTTCTTCTCTTCACAGATGTAGG + Intergenic
1074787296 10:116852091-116852113 TGACTTCTCATGAGAGCTGATGG + Intronic
1074991061 10:118708438-118708460 TTACTGCTCTACAGAGCTGAAGG - Intronic
1075164644 10:120056115-120056137 TTAGTTGTTTTTTCAGCTGAAGG - Intergenic
1078097074 11:8305868-8305890 TTTCTTCTCTCTACAGCTTTGGG - Intergenic
1078905502 11:15684423-15684445 TTAGTTCTCATGAGAGCTGATGG + Intergenic
1080070640 11:28081305-28081327 TTACTTCTCTCTAGATATGAAGG - Intronic
1080168353 11:29268013-29268035 TAAGTTCTCTTTACTGCTCAAGG - Intergenic
1080676472 11:34432488-34432510 TACCTTCACTTTACATCTGAGGG - Intergenic
1081562953 11:44235879-44235901 TTTCTCCTCTTTCCAGCTAATGG - Intronic
1081652425 11:44833278-44833300 TTATTCCTCTTTACAGATGAAGG - Intronic
1081785021 11:45739858-45739880 TTACATCTCTATAAAGCTGGGGG - Intergenic
1082861620 11:57862548-57862570 TTACTACTTCTTACAGATGATGG + Intergenic
1083704476 11:64504522-64504544 TTAATTCCCTCTAAAGCTGAGGG - Intergenic
1085542703 11:77287414-77287436 TTATTTGTCTTTCCAGCTAAAGG - Exonic
1086204390 11:84240421-84240443 TTGTCTCTCCTTACAGCTGAGGG + Intronic
1086473042 11:87137943-87137965 TTACTTCTGTTTAGAGATGTGGG - Intronic
1086570956 11:88283834-88283856 TGACTTCTCCTGACATCTGATGG + Intergenic
1086739139 11:90344953-90344975 TAACTTCTCTTTATAGCTATTGG + Intergenic
1087862478 11:103177189-103177211 TTACTTCTCTCCAAAACTGAGGG - Intronic
1087893350 11:103560260-103560282 TTATTTCTCTAAACATCTGAGGG - Intergenic
1087906549 11:103704240-103704262 TTTCTATTCCTTACAGCTGAAGG + Intergenic
1090268158 11:125367830-125367852 TTTCTTCTCTCTGCAGATGACGG + Exonic
1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG + Intronic
1093508282 12:19895207-19895229 TTGATTCTCTTTACATATGAAGG - Intergenic
1094119653 12:26957185-26957207 TTCCTTCACTTTTCAACTGAGGG + Intronic
1094478341 12:30859731-30859753 TGCCTTCACTTTGCAGCTGAAGG + Intergenic
1097505013 12:60455835-60455857 TGAGTTCTCATGACAGCTGATGG - Intergenic
1097711536 12:62922890-62922912 TCACTCCTCTTTTCAGCTGGTGG - Intronic
1099095228 12:78367494-78367516 TTCCTTCTCATTACTGCTTATGG + Intergenic
1101190714 12:102329592-102329614 TTACTGGCCTTTCCAGCTGAAGG - Intergenic
1101423285 12:104566619-104566641 TTTCCTCTCTTTGCAGCAGAGGG + Intronic
1102284012 12:111640475-111640497 TCACTTCTCTTGGCAGCAGAAGG - Intergenic
1102774728 12:115508546-115508568 TATCTCCACTTTACAGCTGAAGG - Intergenic
1103425440 12:120830258-120830280 TTCCATCTCGTTTCAGCTGATGG - Intronic
1106097164 13:26658177-26658199 TTAGTTTTCTGTACAGCCGAAGG + Intronic
1107362500 13:39634976-39634998 GTCCTACTCTTTAGAGCTGATGG - Intergenic
1108853732 13:54767654-54767676 TGAGTTCTCATTAGAGCTGATGG + Intergenic
1108874349 13:55026078-55026100 TGAGTTCTCTTGAGAGCTGATGG + Intergenic
1110814620 13:79847597-79847619 TTACTTCTATTTAGACATGAAGG + Intergenic
1111558903 13:89917896-89917918 GTGCTTCTCTTGATAGCTGAAGG - Intergenic
1112930771 13:104733567-104733589 TTACTTCTGTTTTCATCTGCAGG - Intergenic
1114188845 14:20425430-20425452 TTATTTGTCTTTAAAACTGAGGG - Intergenic
1114733500 14:25019304-25019326 TCACTTCTCTGTACAACTCAAGG - Intronic
1115177245 14:30577297-30577319 TTCCTTCTCATTCCAGCTGATGG - Intronic
1115764555 14:36609801-36609823 TTACTTCTCTTTTCTTCTAAGGG - Intergenic
1116189425 14:41645096-41645118 TAACTTCATTTTACAGTTGAAGG - Intronic
1116336082 14:43658373-43658395 TTAATTTTCTTTTCAGCTGGTGG - Intergenic
1116340407 14:43715804-43715826 TTACCTCACTTTACACCTCAGGG + Intergenic
1116514105 14:45785476-45785498 TTTCTTATCTGTACAGCTGTAGG - Intergenic
1118562380 14:67100299-67100321 TTTCTTCATTTGACAGCTGAAGG - Intronic
1118695210 14:68377811-68377833 CTCCTTCCCTTTACAGATGAAGG - Intronic
1119114604 14:72007879-72007901 TCTCTTTTCTTTCCAGCTGATGG - Intronic
1120768938 14:88357916-88357938 TTACTTCTCATGAGATCTGATGG + Intergenic
1121359314 14:93241988-93242010 TTATTTCTCTTTACAAATGATGG - Exonic
1121734974 14:96211783-96211805 CTACTACTATTTATAGCTGAAGG - Intronic
1122042882 14:99001738-99001760 GGACTTCTCTTTACATATGAGGG + Intergenic
1123186602 14:106523742-106523764 ATACTTCTCATTAGATCTGATGG + Intergenic
1124418770 15:29498088-29498110 TGAGTTCTCATGACAGCTGATGG + Intronic
1131806494 15:96127488-96127510 TTACTTCATTTTACATCAGAAGG - Intergenic
1132233438 15:100201282-100201304 TTAGTTCTCATGAGAGCTGATGG + Intronic
1133455077 16:5935052-5935074 TGAATTCTCTTAAAAGCTGAGGG - Intergenic
1135306651 16:21372947-21372969 TTAATTCTCTTCATAGCAGAGGG - Intergenic
1135582578 16:23641113-23641135 TTCCTTCTCCTCACAGCTGAGGG + Exonic
1136303394 16:29352089-29352111 TTAATTCCCTTCACAGCAGAGGG - Intergenic
1137638694 16:50009649-50009671 TGAGTTCTCATGACAGCTGATGG + Intergenic
1140869643 16:79094915-79094937 TTTTTTCACTTTACTGCTGAGGG + Intronic
1141359325 16:83380731-83380753 TTACCTCTGCTTACAGCTCATGG + Intronic
1144505088 17:15822564-15822586 CTTCTTCATTTTACAGCTGAGGG - Intergenic
1144573934 17:16417218-16417240 TTACTTCTCATTACTTCTAATGG - Intronic
1145169264 17:20640447-20640469 CTTCTTCATTTTACAGCTGAGGG - Intergenic
1145231721 17:21177924-21177946 TCACCTATCTTCACAGCTGAGGG - Intronic
1146495966 17:33322604-33322626 TTAATTCTGTATACAGCTCAAGG - Intronic
1147415530 17:40286682-40286704 TTATTTCACTTTACAAATGAGGG - Intergenic
1148784456 17:50139259-50139281 TTACCTTTCTTTTCAGCTGCTGG + Exonic
1149840186 17:59956547-59956569 TTATTTCTCTTTTCAGCTTTTGG - Exonic
1150370416 17:64632618-64632640 TATATTCTCTTTTCAGCTGAAGG + Intronic
1150661821 17:67087575-67087597 TTATTTTTCTTTAGACCTGATGG + Intronic
1150906471 17:69343737-69343759 TTATTTCTATTTCAAGCTGAAGG + Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155288287 18:24314245-24314267 TTACCTCTCTTGACTGCTGAAGG + Exonic
1156377404 18:36527221-36527243 GTACTGCTCTTTAAAGCCGAGGG + Intronic
1156703298 18:39850352-39850374 ATATTTCCCTTTCCAGCTGAGGG - Intergenic
1156864020 18:41868679-41868701 TTACTTCTCTTTAATTCTGATGG - Intergenic
1158472288 18:57747746-57747768 TTACCTCTCATTCCATCTGAAGG + Intronic
1159286907 18:66365675-66365697 TTAGTTCTCATGAGAGCTGATGG - Intergenic
1160342889 18:78104529-78104551 TTACTTCTGTTTGGAGATGAAGG - Intergenic
1164582283 19:29442062-29442084 TTATTTCCCTTTAAGGCTGATGG - Intergenic
925859451 2:8160657-8160679 GTATTTCTTTTTACAGCAGAGGG - Intergenic
926201195 2:10799408-10799430 TTATTTCATTTTACAGATGATGG + Intronic
926239937 2:11077694-11077716 CTCCTTCTCTTGACAGATGAGGG - Intergenic
930196398 2:48515157-48515179 TTACTTCTTATTATAGTTGAAGG + Exonic
930319177 2:49832496-49832518 TGAGTTCTCATGACAGCTGATGG - Intergenic
930591897 2:53337563-53337585 TTACTCCTCTTTTCATCTAAAGG + Intergenic
932263698 2:70347977-70347999 TTCCTTGTTTTTACAGCTGCTGG + Intergenic
932967181 2:76490316-76490338 TTAATTTTACTTACAGCTGAAGG - Intergenic
933182869 2:79246778-79246800 TTCCTTCTCTTTCAAGCTCATGG - Intronic
933265773 2:80179086-80179108 TTGCTGGTCTTGACAGCTGAAGG + Intronic
934674507 2:96240078-96240100 TCATTTCTCATTACAGCGGAGGG + Intergenic
938062429 2:128263764-128263786 CTGCTTCTCTTTAGAGTTGAAGG - Intronic
938201046 2:129373343-129373365 GTACATCACTTTCCAGCTGAGGG + Intergenic
938781763 2:134590923-134590945 TTTCTTATCTTTGCAGCTGTGGG - Intronic
939567097 2:143797944-143797966 TTACTTCAATGTAGAGCTGAAGG + Intergenic
940561743 2:155305586-155305608 TGACTTCTCACAACAGCTGATGG + Intergenic
940997760 2:160168478-160168500 TTACTTCTCTGTAAAACTGCAGG + Intronic
942500502 2:176585308-176585330 TTAACTCACCTTACAGCTGAAGG + Intergenic
945136929 2:206639460-206639482 TCATTTCTCCTTTCAGCTGATGG + Intergenic
945414146 2:209549912-209549934 TTACTCGTCTTTACAGTTGGTGG + Intronic
945614123 2:212046279-212046301 TCCCTTCACTTTACAGATGAGGG + Intronic
946642628 2:221800714-221800736 TTGCTTCTCTCTTCAGCTGAAGG - Intergenic
946933908 2:224699810-224699832 TGAGTTCTCTTGAGAGCTGATGG + Intergenic
1169497383 20:6128443-6128465 TTACCTCTCTTGTCAGCTGGAGG - Intergenic
1170574692 20:17653444-17653466 TTTCTGCTCTTTGCAGCTGACGG - Intronic
1171018992 20:21568037-21568059 TTACTCCTCCTGACATCTGAAGG - Intergenic
1171390708 20:24800009-24800031 ACACTTCTCTTTACATCTCATGG + Intergenic
1171399922 20:24866282-24866304 GTACCTCTCTGTACAGCTGGTGG + Intergenic
1171568872 20:26226269-26226291 GTAATTCTTTTGACAGCTGAAGG - Intergenic
1172219467 20:33263512-33263534 TTAGTTCTCATGAGAGCTGATGG + Intergenic
1173732154 20:45336531-45336553 TCACTTCTTTTTACAGCCGAGGG + Intronic
1173740989 20:45401611-45401633 TTACTTCTCATGAGATCTGATGG + Intronic
1175163020 20:57022670-57022692 TTGCTGCTGTTTACAGTTGATGG + Intergenic
1175695236 20:61098444-61098466 ATGCTTCTCTATGCAGCTGAAGG + Intergenic
1177271979 21:18860948-18860970 TTACTTTTTTTAATAGCTGAGGG - Intergenic
1177874050 21:26609697-26609719 TCACTCCTCTTTCCATCTGAGGG + Intergenic
1178849509 21:36201242-36201264 TTACCTCCATTTACAGGTGAGGG + Intronic
1179387042 21:40953463-40953485 TTAGTTCTCTTGAGATCTGATGG - Intergenic
1180282052 22:10709376-10709398 GTAATTCTTTTGACAGCTGAAGG + Intergenic
1181381732 22:22509768-22509790 TTACTTCTCATTACAACTTTTGG + Intergenic
1181693846 22:24583079-24583101 TTACTTCTCTTCTCATTTGAAGG - Intronic
1182202145 22:28584724-28584746 TTACTTCATTTTGCAGGTGATGG + Intronic
1185202448 22:49516557-49516579 TTCCTTCATTTTACAGATGAGGG + Intronic
1203239295 22_KI270732v1_random:40532-40554 GTAATTCTTTTGACAGCTGAAGG + Intergenic
949949752 3:9219451-9219473 TCACCTCTATTTACAGATGAGGG + Intronic
950022781 3:9800217-9800239 TTCCTTCTCATTCCTGCTGATGG - Exonic
950335865 3:12192396-12192418 TTCCTTCTGTTTCCAGCTGTAGG + Intergenic
950599786 3:14023234-14023256 TTTCTTCTTTCTACATCTGATGG + Intronic
951777587 3:26326396-26326418 TTTCTGCTCTTTATAGCTGATGG - Intergenic
952206694 3:31187443-31187465 TTACTCCACTTTACACATGAGGG + Intergenic
954848153 3:53577806-53577828 TTCCTTCCCTTTACTGCTTAAGG + Intronic
954864461 3:53717282-53717304 GTAGCTCTCTTCACAGCTGATGG + Intronic
955129377 3:56149274-56149296 TTATTTTTTTTCACAGCTGAGGG + Intronic
955645404 3:61132192-61132214 TTACTTCACTTGATTGCTGAAGG + Intronic
956229354 3:66997338-66997360 TTACTTCACGTTACAGATGAAGG + Intergenic
957257312 3:77854914-77854936 ACACTTCTCTTAAAAGCTGATGG - Intergenic
957581603 3:82079994-82080016 TTACTTCTCTCTACATTTAACGG - Intergenic
957954915 3:87173942-87173964 TGAGTTCTCATGACAGCTGATGG + Intergenic
959505470 3:107152088-107152110 TAACTTCACTTTACAGAAGAAGG - Intergenic
961342790 3:126240014-126240036 TTAGTTCTCGTGAGAGCTGACGG - Intergenic
962090527 3:132239652-132239674 CTTCTTCTCTCTGCAGCTGAAGG - Intronic
962143994 3:132820942-132820964 TCACTTCTCTTCTCAGCTCAGGG + Intergenic
963552294 3:146739543-146739565 CTTCCTCTCTATACAGCTGAGGG + Intergenic
964054958 3:152442953-152442975 TTATTTTTTTTTACAGCTTACGG - Intronic
964799763 3:160543284-160543306 TGAATTCTCTTTACAAGTGAAGG - Intronic
965152887 3:165004969-165004991 TTAGTTCTCATGAGAGCTGATGG + Intronic
965972410 3:174576775-174576797 TTACTTCTCTTAAAATATGAAGG - Intronic
966212882 3:177471011-177471033 TTCCTACTCTTTATAGTTGAGGG + Intergenic
967131701 3:186476713-186476735 TTACTGCTCTTCAGAGCTGTGGG - Intergenic
967619202 3:191611993-191612015 TTACTTATTTTTAAAACTGAAGG + Intergenic
968557367 4:1253045-1253067 TTACTTCTCTTCCCATCTTATGG - Intergenic
968710835 4:2116083-2116105 TTCCAGCTCTTTGCAGCTGAAGG + Intronic
968892719 4:3379727-3379749 TGAGTTCTCATGACAGCTGACGG - Intronic
970303879 4:14710576-14710598 TCACTTCTGTTTACAGCCAATGG + Intergenic
970362759 4:15326347-15326369 TTCCTTTTCTTTACAACTGTAGG + Intergenic
971355400 4:25890625-25890647 TCTCTTTTCTTTACAGTTGATGG + Intronic
975187214 4:71417941-71417963 TTACATCATTTTACAGATGAGGG - Intronic
976275166 4:83268987-83269009 TTACTTCTCATTAAAGCTGGGGG + Intronic
978396133 4:108281988-108282010 TTACTTCTCAATAAAGCTGTTGG + Intergenic
978746313 4:112198089-112198111 TTACCTCGTTTTACAGATGAGGG - Intergenic
979355519 4:119698975-119698997 TTTATTATTTTTACAGCTGAAGG + Intergenic
979420417 4:120498278-120498300 TTAGTTCTCATGAGAGCTGATGG + Intergenic
981559961 4:146037124-146037146 TTCCTTCTATTTACAGAGGAGGG - Intergenic
981572415 4:146166696-146166718 TGAGTTCTCATGACAGCTGATGG + Intergenic
982105781 4:152010904-152010926 TTCTTTCTCTTGGCAGCTGAGGG - Intergenic
982576265 4:157113929-157113951 TCACTTCTCTTGACAGCTTCTGG - Intronic
982803748 4:159736630-159736652 TTAGTTCTCATGAGAGCTGATGG + Intergenic
984129015 4:175850209-175850231 TTCCCTCTCTTTATAGCTTAGGG - Intronic
984214200 4:176887965-176887987 TTAGTTCTCACAACAGCTGACGG + Intergenic
987286356 5:16461777-16461799 TATCTTCAGTTTACAGCTGAGGG + Intronic
987419092 5:17697351-17697373 TTAAGCCTCTTTCCAGCTGAAGG + Intergenic
988107673 5:26771842-26771864 TTGCTGGTCTTTCCAGCTGAAGG - Intergenic
989717293 5:44479296-44479318 TTTCTTATCTTTGCAGCTGTGGG - Intergenic
989746692 5:44838286-44838308 TGAGTTCTCATGACAGCTGATGG + Intergenic
990439608 5:55831740-55831762 TGAGTTCTCATGACAGCTGATGG + Intergenic
990806801 5:59672212-59672234 ATACTTCTCTTTGCAACTGAAGG + Intronic
992168375 5:74077140-74077162 TGAGTTCTCATAACAGCTGATGG + Intergenic
992410481 5:76500767-76500789 TTTCTTATCTTTAGAGCTCAAGG + Intronic
993845206 5:92933304-92933326 TCCCTTCTTTTTACAGATGAGGG - Intergenic
994090779 5:95808085-95808107 TTTCTTCTCCTTCCAGCTCAAGG + Intronic
996220508 5:120926672-120926694 CTACTTCTCTCTTCAGCTGCAGG + Intergenic
996336328 5:122387716-122387738 TTCCTTCACTTTACAACTGGGGG - Intronic
996867661 5:128145161-128145183 TTACTTCAATTTATAACTGATGG + Intronic
997663756 5:135610220-135610242 TTTCTTCTCACTACACCTGACGG + Intergenic
997777805 5:136627147-136627169 TTAGTTCTCATGAGAGCTGATGG - Intergenic
998736306 5:145145304-145145326 TTACTTCCCTTTCTAGCTTAAGG - Intergenic
1000778872 5:165454532-165454554 TTACATCTCTTTCAAGCTCATGG + Intergenic
1001836306 5:174835663-174835685 TTAGTTCTCATTAGATCTGATGG + Intergenic
1002063139 5:176638331-176638353 TTTCTTCTCTTTGCATCAGAAGG - Intronic
1003220592 6:4157603-4157625 TTTCTGCTCTTCACAGCTCACGG + Intergenic
1003235142 6:4288763-4288785 TTAGTTCTCATCACAGCAGAAGG + Intergenic
1003529541 6:6926524-6926546 TTCCTTCCCTTTTCAGCTGCTGG - Intergenic
1004118367 6:12793971-12793993 TTATTTCTCTTTATAGCTCCAGG - Intronic
1004401015 6:15288772-15288794 TTTCTTCTCTCTACAGTTAAAGG + Intronic
1004457911 6:15808577-15808599 TGAGTTCTCATGACAGCTGATGG + Intergenic
1006996628 6:38267225-38267247 TTTCTTCTGTTAATAGCTGAAGG + Intronic
1007262872 6:40575886-40575908 TTACTTCATTTTACAGGTGAAGG - Intronic
1008267452 6:49446569-49446591 TTATTTCCATTTACAGATGAGGG - Intronic
1008283801 6:49625938-49625960 ATACGTCTCTTGAGAGCTGATGG - Intronic
1008479262 6:51968035-51968057 TTTCCTGTCTTTACACCTGAAGG + Intronic
1010028849 6:71251374-71251396 TTACTTTATTTTACAGATGAAGG + Intergenic
1012708386 6:102564802-102564824 TTACTTTTTTTTACAGATGGAGG - Intergenic
1012964816 6:105662215-105662237 GTTCTTCTCTTTACAGAAGAGGG - Intergenic
1015633164 6:135251251-135251273 TTACTTCGCACTACAGCAGAAGG + Intergenic
1015712977 6:136162381-136162403 TGAGTTCTCATTACATCTGATGG - Intronic
1016837007 6:148487598-148487620 TTTCTTCTTGTTACAGCTCAAGG + Exonic
1017654574 6:156615124-156615146 TTAATTCTCATGAGAGCTGATGG - Intergenic
1018809913 6:167291535-167291557 CTGCTTCTCTTTACAGCCTATGG + Exonic
1020507592 7:9013134-9013156 TTTCTTCTCTTTACTCCTGCTGG + Intergenic
1021864051 7:24937188-24937210 TTAGTTCTCACTACATCTGATGG - Intronic
1023034178 7:36116291-36116313 TAACTTATCTTTACCGCTAATGG - Intergenic
1024391852 7:48822786-48822808 GCACTTCTCTTTGCTGCTGAAGG + Intergenic
1024866007 7:53905663-53905685 TTACTGACCTTTCCAGCTGAAGG - Intergenic
1027254075 7:76419046-76419068 TTGCTCCATTTTACAGCTGAGGG - Intronic
1027736628 7:81940500-81940522 TGACTTCAGTTAACAGCTGAGGG - Intergenic
1028084095 7:86615845-86615867 TTAGTTCTCATGAGAGCTGATGG + Intergenic
1028726947 7:94098618-94098640 TGAGTTCTCTTTACAGCTGTGGG + Intergenic
1028970756 7:96856457-96856479 TTATTTCTCTTTACTTTTGAAGG - Intergenic
1029520914 7:101061640-101061662 TTTTTTGTTTTTACAGCTGAGGG - Intergenic
1030937458 7:115602814-115602836 TTACCTCCCTATACAGGTGAAGG - Intergenic
1030986344 7:116245930-116245952 TGAGTTCTCTTGAGAGCTGATGG - Intronic
1031616971 7:123893264-123893286 TGAGTTCTCATGACAGCTGATGG + Intergenic
1032092957 7:128920869-128920891 TTACTTCATTTTACAGATGAAGG - Intergenic
1034172651 7:149074532-149074554 TGACTTCTCTGTGCAGATGATGG - Exonic
1034379354 7:150676762-150676784 TATCTTCTCTTTAAACCTGATGG - Intergenic
1034626852 7:152500085-152500107 TAGCTTATCTTTACAGATGAGGG + Intergenic
1035150803 7:156870890-156870912 TAACCTCACTTTACAGCTCAAGG + Intronic
1036032005 8:4984403-4984425 TCATTGCTCTTTAAAGCTGAAGG - Intronic
1036190829 8:6669358-6669380 TTATTTTTCTTTACAGCTTTGGG - Intergenic
1037372708 8:18197087-18197109 TTAGTTCTCATGAGAGCTGATGG - Intronic
1038719589 8:30022036-30022058 TTCCTTCTCATTTCAGCTGAAGG - Intergenic
1041963149 8:63643189-63643211 TTATTGCTCTTTACAAATGATGG + Intergenic
1042536162 8:69860720-69860742 TTAGTTCTCTTTTCAGGTTATGG + Intergenic
1042631801 8:70825580-70825602 TTACTTCTCTCTTCAGCTCCTGG + Intergenic
1042851230 8:73217936-73217958 TGAGTTCTCATGACAGCTGATGG + Intergenic
1044920794 8:97167472-97167494 TAACCTCTCTTTAGAGCTAATGG - Intergenic
1046037193 8:108857555-108857577 TTTCATCCCATTACAGCTGAAGG - Intergenic
1047178798 8:122567705-122567727 TGAATTCTCATTGCAGCTGATGG - Intergenic
1048748310 8:137641426-137641448 TAACTTCTCACTACATCTGATGG + Intergenic
1048978354 8:139688464-139688486 TGAATTCTCTCTAGAGCTGATGG - Intronic
1049050165 8:140188436-140188458 TTACTTCTCAGCACAGCTGTTGG + Intronic
1050073939 9:1844384-1844406 TGTCTCCACTTTACAGCTGAGGG - Intergenic
1050434925 9:5599097-5599119 TTTCTTATCTATGCAGCTGAGGG - Intergenic
1051159128 9:14185906-14185928 TTTCTTCTCTTTATAGGAGATGG - Intronic
1051263353 9:15287646-15287668 TTACCTCCCTTTACAGTTTATGG - Intronic
1052029078 9:23608282-23608304 TCACTTCTGTCTACAGATGATGG - Intergenic
1052479096 9:28998731-28998753 TAACTTCTCATTACAGTTAAAGG + Intergenic
1052541041 9:29811540-29811562 TGACTTCTCATGATAGCTGATGG + Intergenic
1052738817 9:32373742-32373764 TTACTACTCTTTACAGGAGGAGG + Intergenic
1052830639 9:33212402-33212424 TTACTCCACTTTACAGCTGGAGG - Intergenic
1058655704 9:107218651-107218673 TTCCATCTCATTAAAGCTGAGGG - Intergenic
1058899353 9:109428811-109428833 TTACTTCTCTGTAGAAATGATGG + Intronic
1060396787 9:123321856-123321878 TCACTTCCCTTCACATCTGATGG + Intergenic
1061084281 9:128390196-128390218 TTCCCTGTCTGTACAGCTGAGGG + Exonic
1061455806 9:130696672-130696694 TTATTTCTATTCACAGTTGACGG - Intronic
1185951498 X:4440383-4440405 TGAGTTCTCATGACAGCTGATGG - Intergenic
1188629389 X:32333711-32333733 TTATTCCCCTTTACAGCTGAGGG + Intronic
1190367217 X:49707104-49707126 TTGCCTATCGTTACAGCTGATGG + Intergenic
1191673240 X:63768724-63768746 TGAGTTCTCATGACAGCTGATGG + Intronic
1191680412 X:63834330-63834352 TCTCTTTTCTTTACAGATGAGGG - Intergenic
1191690046 X:63930202-63930224 TCACTTCACTTTACAGATGATGG - Intergenic
1191946273 X:66538308-66538330 TTGCTTGCCTTTCCAGCTGAAGG - Intergenic
1192086213 X:68100069-68100091 TAACTTCATTTTACAGATGAGGG - Intronic
1192562341 X:72135402-72135424 TCTCTTCCCCTTACAGCTGATGG - Intronic
1195938128 X:110144653-110144675 TCACTTCTCTTTACAATTGCAGG - Intronic
1196589676 X:117471903-117471925 TTTCTTTTCTTTCCAGCAGAGGG + Intergenic
1197088408 X:122507710-122507732 CTACTTCTCTGTAGAACTGATGG - Intergenic
1197300730 X:124777208-124777230 TTACTGCTCTTAACCTCTGAAGG + Intronic
1198663074 X:138991912-138991934 TTACTCCTCCTTATTGCTGATGG - Intronic
1200946161 Y:8840692-8840714 TTAGTTCTGTTTTCAGATGATGG + Intergenic