ID: 1091856229

View in Genome Browser
Species Human (GRCh38)
Location 12:3742531-3742553
Sequence ATTTCTCCCAGCAGGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091856229_1091856234 22 Left 1091856229 12:3742531-3742553 CCTGGCTCCCTGCTGGGAGAAAT 0: 1
1: 0
2: 0
3: 21
4: 251
Right 1091856234 12:3742576-3742598 ACTAGTCAGTGAAGGCCAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 104
1091856229_1091856235 25 Left 1091856229 12:3742531-3742553 CCTGGCTCCCTGCTGGGAGAAAT 0: 1
1: 0
2: 0
3: 21
4: 251
Right 1091856235 12:3742579-3742601 AGTCAGTGAAGGCCAGCAGGAGG 0: 1
1: 0
2: 3
3: 36
4: 325
1091856229_1091856233 14 Left 1091856229 12:3742531-3742553 CCTGGCTCCCTGCTGGGAGAAAT 0: 1
1: 0
2: 0
3: 21
4: 251
Right 1091856233 12:3742568-3742590 GATTATGAACTAGTCAGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091856229 Original CRISPR ATTTCTCCCAGCAGGGAGCC AGG (reversed) Intronic
900408550 1:2502826-2502848 ATCTCTCCCTGCAGGGCCCCCGG - Intronic
900430764 1:2602163-2602185 ACTTCTCCCTGGAGGGAGGCCGG - Intronic
900986729 1:6077604-6077626 TTTCCTCCCAGGAGGGAGCCAGG + Intronic
902833990 1:19035060-19035082 ACTTGCCCCAGGAGGGAGCCGGG + Intergenic
904353528 1:29924160-29924182 AATTACCCCAGCAGGCAGCCAGG - Intergenic
905284153 1:36868379-36868401 CTTTCTCCCAGCATGGCTCCTGG + Intronic
905920677 1:41716669-41716691 CTTTCTCCCAGCAGGGTCCAGGG - Intronic
907279803 1:53340013-53340035 ATATCACCCAGCATGGGGCCTGG - Intergenic
907349094 1:53811342-53811364 TTCTCTCCCAGCTGGGAGGCGGG + Intronic
907427280 1:54388348-54388370 ATTTCTCCGATGAGGAAGCCAGG - Intronic
907849795 1:58245267-58245289 GTTGATCCCAGGAGGGAGCCAGG - Intronic
910394076 1:86774398-86774420 CTTTCTGCCAGCAGGAAGCGGGG - Intergenic
910428448 1:87138637-87138659 AGTTCTCCTGGGAGGGAGCCTGG + Intronic
911015192 1:93324711-93324733 TTATCTCCCAGCATGGTGCCTGG + Intergenic
912319137 1:108693413-108693435 AATTTTCCCAGCAGGAAGTCAGG + Intronic
912628446 1:111226238-111226260 ATTTCTCACAGTTGGGAGGCTGG + Intronic
914335909 1:146714821-146714843 AAGTGTTCCAGCAGGGAGCCAGG - Intergenic
915639278 1:157209746-157209768 CTTTCTCTTAGCAGGGAGCTGGG + Intergenic
916156417 1:161854273-161854295 TTTTCTCCAAGCAGGGAGTAAGG + Intronic
916725217 1:167517253-167517275 TCTGCTCCCACCAGGGAGCCAGG - Intronic
918075001 1:181163566-181163588 ATTGCTTCCAGCTGTGAGCCAGG - Intergenic
918261309 1:182798854-182798876 AATTCTTTCAGCAGGGAGGCAGG - Intronic
918589310 1:186222579-186222601 ATCTCTCCCAGCAGGGCTACTGG - Intergenic
919005947 1:191899789-191899811 ATTTCACCCAGCAGGTAAACTGG - Intergenic
919842406 1:201618994-201619016 ATTGCCCCCAGGTGGGAGCCTGG - Intergenic
919980987 1:202642960-202642982 ATCTCTCCCCGCGGAGAGCCCGG - Intronic
920039733 1:203087634-203087656 ATTATTCACAGCAGGGAGCCAGG + Intergenic
920951460 1:210575151-210575173 ATTTCTCCCACCACAGAGTCAGG - Intronic
923877754 1:238068191-238068213 AATTCTGCCACCAGGGAGTCAGG + Intergenic
924739246 1:246785383-246785405 TTTTGTACCAGAAGGGAGCCTGG - Intergenic
1067082779 10:43221077-43221099 TCTTCTCCCAGCAGGGCGTCTGG - Intronic
1068299668 10:55121890-55121912 ATTTCTCACAGCTCTGAGCCTGG - Intronic
1068470396 10:57454713-57454735 TTTTCTACCAGCAGGGAATCTGG - Intergenic
1071505881 10:86231258-86231280 GTGTCTCCCAGGAGGGAGGCAGG + Intronic
1071565032 10:86667357-86667379 GTTTCTCCAACCAAGGAGCCAGG + Intergenic
1072758860 10:98039489-98039511 ATCTCACCCAACAGGAAGCCTGG - Intergenic
1074788243 10:116860780-116860802 ATTTCTCCCTCCAGGGAGGAAGG + Exonic
1075182957 10:120228226-120228248 TTTTCACCCATCAGGGAGCTTGG + Intergenic
1075480726 10:122779792-122779814 ATTTCTGTCCTCAGGGAGCCTGG - Intergenic
1075952835 10:126496866-126496888 ATCTTACCCAGTAGGGAGCCAGG - Intronic
1076017714 10:127041667-127041689 ATTTCTACCAGCAGTGTGCAAGG + Intronic
1076440270 10:130476678-130476700 TTTTCTCCAAGCAAGGACCCAGG - Intergenic
1076488106 10:130837151-130837173 GTTTCTCCCTCCAAGGAGCCTGG + Intergenic
1078466214 11:11552441-11552463 ATACCTCCCAGCACGGGGCCTGG + Intronic
1079330953 11:19532696-19532718 ATCAATCCCAGCAGGGAGGCAGG - Intronic
1079343666 11:19633502-19633524 ATTTCTCAGATGAGGGAGCCAGG - Intronic
1080438691 11:32270385-32270407 ATTTCTGCCAGCTGGGATCCTGG + Intergenic
1083291886 11:61695136-61695158 ATTCCAGCCAGCAGGGAGGCTGG - Intronic
1084445430 11:69200766-69200788 AGGTCTCCCGGCAGGGAGGCAGG + Intergenic
1084915506 11:72426188-72426210 CCTTCTCCCAGCAGGGGGCTAGG - Intronic
1088042836 11:105408624-105408646 ACATCTCACAGCAGGGAGTCAGG + Intergenic
1090064950 11:123494756-123494778 ATTTCTCCCAGCAGGAAGTAGGG - Intergenic
1091137610 11:133205974-133205996 ATCTCACCCATCAGGGAGCTGGG - Intronic
1091856229 12:3742531-3742553 ATTTCTCCCAGCAGGGAGCCAGG - Intronic
1094039336 12:26106536-26106558 ATTTCCCCAGGCAGGGAGCCAGG - Intergenic
1094661552 12:32474134-32474156 ATTTCTACCAGCAGTGTGTCAGG - Intronic
1096262584 12:50102430-50102452 AGTGCTCCCAGCTGGCAGCCTGG + Intergenic
1096884196 12:54700106-54700128 CTCTCTCCCACCATGGAGCCTGG - Intergenic
1101052391 12:100876421-100876443 GTTTCCCCCTGCAGGGAGCAGGG + Intronic
1102531757 12:113551789-113551811 ATCTCTCCCTGCCAGGAGCCAGG - Intergenic
1103066308 12:117900977-117900999 ATCTTTCCCAGCAGAGAACCTGG + Intronic
1104079322 12:125416398-125416420 ATTTCTCCCAGGAGGGGGCTCGG + Intronic
1105758825 13:23494561-23494583 ATGTGTCCCAGCAGGGAACTTGG - Intergenic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106565645 13:30882188-30882210 ATTTCTTCTGCCAGGGAGCCTGG + Intergenic
1113692016 13:112317804-112317826 CATTCTCTCAGCATGGAGCCAGG + Intergenic
1114331091 14:21637840-21637862 CTTTCTTTCAACAGGGAGCCTGG - Intergenic
1114407657 14:22471730-22471752 ACTTCCGCCAGCAGGGAGCTGGG - Intergenic
1114697937 14:24644831-24644853 ATTTCTTTCAGCAGAGAGACAGG + Intergenic
1114878957 14:26759853-26759875 ATTCCCACCAACAGGGAGCCAGG - Intergenic
1115309957 14:31968978-31969000 ATGTCACCCAGTAGGGAGACAGG + Intergenic
1115622085 14:35150623-35150645 AATTCTACCAGCTGGGATCCAGG + Intronic
1119484807 14:74980460-74980482 TGTACTCCCAGCATGGAGCCTGG - Intergenic
1119561368 14:75592466-75592488 AGTTCTGACAGAAGGGAGCCAGG - Intronic
1121857837 14:97286583-97286605 TTATCTCCCAGCAGAGTGCCTGG + Intergenic
1122941744 14:104984638-104984660 ATTTCTCCCACCCTGGGGCCTGG - Intergenic
1122945754 14:105008129-105008151 ATGTGGCCCAGCAGGGATCCAGG + Intronic
1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG + Intergenic
1124496685 15:30191706-30191728 ATTTCTCCCCGCGGAGAGCCCGG - Intergenic
1124746891 15:32346942-32346964 ATTTCTCCCCGCGGAGAGCCCGG + Intergenic
1128230657 15:66032713-66032735 ATTTCTCCCACCAGATATCCTGG - Intronic
1128412770 15:67415841-67415863 ATTTCTGCCAGAAGTGAGACAGG - Intronic
1129191036 15:73937725-73937747 CTTGCTCCCAGGAGGGAGACAGG - Intronic
1129262212 15:74374745-74374767 AGTTTCCCCAGCAGGGGGCCCGG + Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1130546316 15:84859419-84859441 ATTACTGCAATCAGGGAGCCAGG - Intronic
1131265880 15:90915060-90915082 ACTCCTCCCAGCAGGGAGTCAGG - Intronic
1132002654 15:98195607-98195629 ATTTCTCTCGGCTGGGAGCTTGG + Intergenic
1132401859 15:101514465-101514487 ATTTCCACCAGCAGTGAGCGAGG + Intronic
1132570642 16:642460-642482 CTTTCTCCCCGCTGGGGGCCCGG - Intronic
1134262821 16:12666401-12666423 CCTTCTTCCAGCAGGGAGCCAGG - Intronic
1134769864 16:16798837-16798859 AGTTCTCCAAGCATGGTGCCTGG - Intergenic
1135702443 16:24643992-24644014 AATTCTCCCAGCAGGAACACTGG + Intergenic
1135990805 16:27217637-27217659 TGTTCTCCCTGCAGGGAGCTTGG - Intronic
1137572840 16:49578078-49578100 ATTTCTCTGGGCAGGGAGCTGGG + Intronic
1137671064 16:50279493-50279515 ATTTCTCCAACAGGGGAGCCTGG + Intronic
1138574702 16:57900300-57900322 ATTTCTGGAAGCAGAGAGCCGGG - Intronic
1139948198 16:70656150-70656172 TTTTATCCCAGCTGGGAGCCAGG + Intronic
1139997715 16:70996402-70996424 AAGTGTTCCAGCAGGGAGCCAGG + Intronic
1142979631 17:3664097-3664119 GTCTCTCCCAGCTGGGAGGCTGG + Intronic
1143551246 17:7631708-7631730 ATTTCTCCCTCCAGGGACTCAGG + Exonic
1148197829 17:45727464-45727486 ATGTGGCACAGCAGGGAGCCTGG - Intergenic
1148637593 17:49160541-49160563 ATTTCTCCCTCCAGTGAGTCTGG + Exonic
1150283081 17:63940643-63940665 CTGTCCCCCATCAGGGAGCCAGG + Exonic
1151340123 17:73465790-73465812 AGTTCTCCTATCATGGAGCCAGG - Intronic
1151536316 17:74740897-74740919 CTTGCTTCCAGCAGAGAGCCAGG + Intronic
1152004466 17:77671117-77671139 ATGTCTCCCAGCACGGTGCTGGG + Intergenic
1152343259 17:79736996-79737018 GTTGCTCCCAGCAAGGACCCAGG + Intronic
1152537880 17:80960916-80960938 ATTTCACCCAGCACAGAGCGAGG + Intronic
1152946762 17:83202131-83202153 ATATGTCCCATCAGGGAGCTGGG + Intergenic
1153573880 18:6501495-6501517 ATTTCTCTTTGCAGGGAGACGGG - Intergenic
1155352883 18:24924212-24924234 ATTACGCTCAGCGGGGAGCCTGG - Intergenic
1156376456 18:36519306-36519328 ATTTCTCACAGGAGGGAGCTGGG + Intronic
1158011105 18:52728987-52729009 ATTTGACCCTGTAGGGAGCCCGG - Intronic
1160251431 18:77206921-77206943 ACTTCTCCCAGCAGGGCCCTTGG - Intergenic
1160314202 18:77825286-77825308 ATTTCTCTGAACTGGGAGCCAGG - Intergenic
1161041475 19:2112960-2112982 AGCTCCCCCTGCAGGGAGCCAGG + Exonic
1161884879 19:6986822-6986844 ATTTCTACCAGCAGTGCACCAGG - Intergenic
1163288047 19:16361528-16361550 TTTTCTTCCAGCAGGGAGGCGGG - Intronic
1164497748 19:28783930-28783952 ATTTCTCCTAGCAGAGACACAGG - Intergenic
1164701967 19:30291691-30291713 ATTTCTGCCAGCAGCGTGCCAGG + Intronic
1167076669 19:47254342-47254364 TTTCCTCCCAGCACGCAGCCTGG + Intergenic
1167320739 19:48796039-48796061 CTTTCTCCCACCAGGGCACCCGG + Intronic
1168224028 19:54981692-54981714 ATATCTTCCTGCAGGGAGCTTGG + Intronic
925459223 2:4045225-4045247 ACTACTCCCAGCAGAGACCCTGG - Intergenic
925476277 2:4219919-4219941 ATTTTTACCAGCAAGCAGCCAGG - Intergenic
930707485 2:54519226-54519248 ATAACTCCTAGCAGGGTGCCTGG - Intronic
933778508 2:85786183-85786205 ATTCCTTCCAACAGAGAGCCTGG - Intronic
933912281 2:86952170-86952192 ACTGCTCCCAGCTGGGAGGCAGG + Intronic
934010714 2:87817727-87817749 ACTGCTCCCAGCTGGGAGGCAGG - Intronic
935774285 2:106458430-106458452 ACTGCTCCCAGCTGGGAGGCAGG - Intronic
935905783 2:107837483-107837505 ACTGCTCCCAGCTGGGAGGCAGG + Intronic
935992266 2:108730006-108730028 ACTGCTCCCAGCTGGGAGGCAGG + Intronic
936127585 2:109802660-109802682 ACTGCTCCCAGCTGGGAGGCAGG + Intronic
936217112 2:110568825-110568847 ACTGCTCCCAGCTGGGAGGCAGG - Intronic
936426252 2:112423409-112423431 ACTGCTCCCAGCTGGGAGGCAGG - Intronic
938707889 2:133949433-133949455 ACTTCTCCAAGGAGGGAGCATGG + Intergenic
941749406 2:169119295-169119317 ATTTCACACAGCAGGGGTCCTGG + Intergenic
944648105 2:201800203-201800225 ATCTCTGCCTGCATGGAGCCTGG + Intronic
946131127 2:217607760-217607782 ATTTCACTCAGCACAGAGCCTGG + Intronic
947190552 2:227500432-227500454 TTGTCTGCCTGCAGGGAGCCTGG + Intronic
947801686 2:232932659-232932681 ATTTCTCCCAGTCTGGAGGCTGG + Intronic
1168841136 20:910891-910913 ATTTTTCCAAGAAGGGGGCCTGG - Intronic
1171410325 20:24942867-24942889 ATTTTACCCTCCAGGGAGCCGGG - Intergenic
1171425136 20:25044159-25044181 GTTTCTCCCTGCCTGGAGCCTGG - Intronic
1172014572 20:31865252-31865274 ATCCCTCCCAACAGGGACCCAGG + Intronic
1172096915 20:32465017-32465039 ATTTCTCTCTGCAGAGACCCTGG + Intronic
1173733553 20:45344543-45344565 ACTTCTCCCAACAGGGAGATGGG + Intronic
1175862120 20:62156160-62156182 ATCACTCCCAGCACGGGGCCGGG - Intronic
1175887093 20:62298250-62298272 ATTCATCCCAGCAGGCAGCAAGG + Intergenic
1176037641 20:63048128-63048150 GTTTCTCCCAGCAGCCAGCCCGG + Intergenic
1176169733 20:63691376-63691398 ATGGCTCCCAGCAGGAAGCAGGG - Intronic
1176207751 20:63899117-63899139 TTTTCTCCCAGCAGGACGCAGGG - Intronic
1177057704 21:16329106-16329128 ATGTCTCCCAGCTGGGACTCAGG - Intergenic
1178023462 21:28436688-28436710 ATTTCTCCCAGCTGTGACCTGGG - Intergenic
1179526265 21:41977867-41977889 CTTCCTGGCAGCAGGGAGCCTGG - Intergenic
1179534675 21:42043910-42043932 ATTTCACCCAGGAGGAAGCTGGG + Intergenic
1179730993 21:43367405-43367427 ATTCCTCCCTGCAGGGAGCACGG + Intergenic
1181132740 22:20743035-20743057 ATTGTACCCAGCAGTGAGCCCGG + Intronic
1181365170 22:22370989-22371011 ATATCTGCCTGCAGGGACCCAGG + Intergenic
1182751956 22:32648902-32648924 TTTTCTCCCTGCAGGGAGTTTGG + Intronic
1183299200 22:37050635-37050657 ACTTCTCCCAGCACAGGGCCAGG + Intergenic
1183812064 22:40265889-40265911 ATCTTCCCCAACAGGGAGCCTGG - Exonic
1184454932 22:44604403-44604425 CTGCCACCCAGCAGGGAGCCCGG + Intergenic
1184549846 22:45198594-45198616 ACCTCCCCCAGCAGGGAGCAGGG - Intronic
1184792110 22:46706520-46706542 GTGTCTCCCAGCCTGGAGCCAGG + Intronic
949130135 3:490044-490066 ATTTCTCACAGTCGGGAGGCTGG + Intergenic
949566766 3:5252384-5252406 AATTTTCCCAGGAGGCAGCCGGG - Intergenic
950423131 3:12910388-12910410 AAAGCTCCCAGCAGGGGGCCAGG - Intronic
950493922 3:13322448-13322470 ATGTCTTCCAGCAGGGCCCCAGG + Intronic
952455218 3:33466233-33466255 ATTTGTCTCAGCAGGGTGCACGG + Intergenic
953063092 3:39443950-39443972 ATTTCATTCAGCAGGGAGCTGGG - Intergenic
954285602 3:49616866-49616888 ATGTCTCCCAGCAGTGGTCCTGG + Intronic
955242842 3:57194624-57194646 GTTCCTCCCAGCAGAGAGCTGGG - Intergenic
955324994 3:58003170-58003192 ATTTCACCTAGCAGGGAGGAGGG + Intergenic
958114942 3:89203454-89203476 TTTTCTCCCAGCTGGGATTCAGG - Intronic
958210530 3:90468364-90468386 GGTTCTCCCAGCACGGAGCTGGG - Intergenic
962919156 3:139935505-139935527 TCTTCTCCCAGGAGGGAGGCAGG + Intronic
966081179 3:176003517-176003539 ATTTCCCCCAACAGTGAGCAAGG + Intergenic
966464804 3:180218488-180218510 ATTTCTCCCAGTCTGGAGGCTGG - Intergenic
968125705 3:196158705-196158727 AGGTCACCCAGCATGGAGCCTGG + Intergenic
977748483 4:100579996-100580018 ATTTCTCACAGCCTGGAGCCTGG - Intronic
982159486 4:152553536-152553558 ATTTCTCCTAGCAAGGAGAAAGG + Intergenic
982703427 4:158682184-158682206 ATTTCTCCCAGGAGTGAACATGG + Exonic
985727022 5:1522030-1522052 ATGTTTCCCCCCAGGGAGCCAGG + Intronic
986717539 5:10534760-10534782 ATCTTTCTCATCAGGGAGCCAGG + Intergenic
988559862 5:32271104-32271126 ATCTCTTCCAGCAGGGGCCCTGG + Intronic
990171362 5:53053522-53053544 ATTTTTCCCTGGAAGGAGCCTGG + Intronic
990548334 5:56845940-56845962 GTTTCTCCCCGCAGGGAGATAGG + Intronic
990550907 5:56877404-56877426 ATTTCTGCCTCCATGGAGCCTGG - Intronic
991159630 5:63482972-63482994 AGATCTCCCAGCAGGGATGCAGG - Intergenic
991500058 5:67268041-67268063 CTCCCTCCCAGAAGGGAGCCAGG - Intergenic
997453058 5:133998961-133998983 ATTTCTACCAGGCGGGGGCCTGG - Intronic
999539510 5:152556317-152556339 ATTCCTGGCATCAGGGAGCCAGG + Intergenic
1002083399 5:176751306-176751328 ATTGCTCCCAGCAGGGTGATTGG - Intergenic
1002427717 5:179185897-179185919 AATGCTCCCAGCAGGTAGCCAGG + Intronic
1002536488 5:179878907-179878929 CTTTCACACAGCCGGGAGCCGGG - Intronic
1003927243 6:10887670-10887692 ATTTCTACCACCAGGAACCCAGG - Intronic
1005043654 6:21621579-21621601 ATTTCACCCAGCAAGAAGTCAGG + Intergenic
1005089681 6:22043416-22043438 CCTTCCCCAAGCAGGGAGCCTGG - Intergenic
1005675627 6:28151915-28151937 ACTTCTCACAGCAGGGTTCCAGG + Exonic
1006919977 6:37621148-37621170 CTTTCTCCCAGCATGGTGACTGG + Intergenic
1007234507 6:40380582-40380604 ATATTTCCCAGCAAGGACCCTGG + Intergenic
1007506350 6:42338129-42338151 CTTCCTCACAGCAGTGAGCCAGG - Intronic
1007960722 6:45956640-45956662 ATTGCTCCCAGCAGGGGCTCAGG + Intronic
1010056507 6:71571423-71571445 ATTCCTCCCAACAGGGTGCAAGG + Intergenic
1011621474 6:89247500-89247522 ATTTCTCCTAGCACGTACCCAGG - Intergenic
1011719217 6:90138204-90138226 ATTTAAACCAGCAGGGAGGCTGG + Intronic
1012829619 6:104188012-104188034 GTTTCTCTCAGCAGAGAGACAGG + Intergenic
1014088904 6:117380469-117380491 ATCTCTCTCAGCATGGAGCAAGG - Intronic
1016935129 6:149443874-149443896 ATTTCCCCCAGAAAGAAGCCTGG - Intergenic
1021413523 7:20355223-20355245 AGTTGTCCCACCTGGGAGCCTGG - Intronic
1021582225 7:22168396-22168418 ATTTCTCACAGCCTGGAGGCTGG - Intronic
1025025638 7:55514282-55514304 ATTATTCCCAGCAGCCAGCCAGG + Intronic
1025985043 7:66442628-66442650 AACTCTCCCAGCAGTGAGCTGGG - Intergenic
1026029876 7:66781869-66781891 AACTCTCCCAGCAGTGAGCTGGG + Intronic
1026564800 7:71481075-71481097 ATTTTTCCCAGGAGGCAGCTTGG + Intronic
1027195975 7:76030516-76030538 ATTCTTCCCAGCAGGATGCCTGG - Exonic
1027201939 7:76069466-76069488 ATTTCAACCAGCAGGGAGGGTGG + Intergenic
1027208254 7:76121229-76121251 AACTCTCCCAGCAGTGAGCTGGG - Intergenic
1029459678 7:100687611-100687633 GTTTCTCTGAGGAGGGAGCCAGG + Exonic
1029560472 7:101299800-101299822 ATTTCTCCGCGCAGGCTGCCTGG - Intergenic
1029561002 7:101302962-101302984 ATTTCTCCGCGCAGGCTGCCTGG - Intergenic
1029561880 7:101308482-101308504 ATTTCTCCGCGCAGGCTGCCTGG - Intergenic
1030678142 7:112406277-112406299 ATTTCACCCAGCATGGGGCAGGG - Intergenic
1031389534 7:121196578-121196600 AATTCTCACAGCTGGGAGACAGG - Intronic
1031651380 7:124294664-124294686 ATTACTCCCAGCAGTGCGCAAGG - Intergenic
1032406996 7:131663652-131663674 ATGCCTCCCAGCAGGGGGTCTGG + Intergenic
1034574592 7:151986086-151986108 ATATCACCCAGCACAGAGCCTGG - Intronic
1034825050 7:154254630-154254652 ATTTCACCAAGGAGGGAGACAGG + Intronic
1034910626 7:154995334-154995356 ATATCTCCCCCCAGGGAGCTTGG + Intronic
1035056767 7:156041022-156041044 TTTTTTCCCAGCAAGGAGCATGG - Intergenic
1035056965 7:156042138-156042160 TTTTTTCCCAGCAAGGAGCATGG + Intergenic
1039031862 8:33317849-33317871 ATTTCCCCCATCAGGGCCCCAGG + Intergenic
1039471058 8:37814121-37814143 CCTCCTCCCAGCAGGGAGCTTGG + Intronic
1041495513 8:58481575-58481597 ACTGCTCCCAGCACTGAGCCTGG + Intergenic
1042390265 8:68226400-68226422 ATCTCTCCCAGCTGAGAACCTGG + Intronic
1042875681 8:73438302-73438324 ATGTGTCCCAGCAGGGAGACAGG + Intronic
1045476427 8:102556674-102556696 ATGTCACTCAGCAGGGAGCCAGG - Intronic
1048418856 8:134257150-134257172 ATATCTCTCAGCAGGTAGCAAGG - Intergenic
1049251792 8:141593219-141593241 ATTTCTCCTGCCAGGGAGCGTGG + Intergenic
1049985579 9:947907-947929 ATTTCTCCCAACAGTGGGCCTGG + Intronic
1050175228 9:2863433-2863455 ATTTCTAACAACAGGGAGGCAGG + Intergenic
1050318921 9:4431339-4431361 ATTTTTTCCAGTAGGTAGCCTGG - Intergenic
1051769944 9:20566626-20566648 ATTTGTATCAGCAGGGTGCCAGG - Intronic
1054973420 9:71115595-71115617 ATGACTTCCTGCAGGGAGCCAGG - Intronic
1055411871 9:76038922-76038944 ATTTCTCCCTGCAGGAAGGTTGG - Intronic
1055877541 9:80961635-80961657 ATTCCTCCCAGCGGGCAGGCCGG - Intergenic
1055909187 9:81327529-81327551 ATTTCTCCCTGCAGGGAAAAAGG - Intergenic
1056817946 9:89815306-89815328 CGTTCTGCCAGCAGGGAGACAGG - Intergenic
1056821190 9:89843192-89843214 ATTTCCCCAATCAGGGAGGCAGG - Intergenic
1057270855 9:93650620-93650642 ATCTCTGCCACCAGGAAGCCAGG - Intronic
1057551191 9:96051889-96051911 ATTTCTCACAGTTTGGAGCCTGG - Intergenic
1058373914 9:104301773-104301795 ATGACTCCCAGCAGATAGCCAGG - Intergenic
1060260514 9:122070239-122070261 AATTCAGCCAGCAGGGAGTCAGG + Intronic
1062006889 9:134243071-134243093 AAATCTTCCTGCAGGGAGCCAGG + Intergenic
1062061787 9:134500978-134501000 ATTTCTCCTGGCAGGGCACCAGG - Intergenic
1062134803 9:134919735-134919757 GTTTCTTTCAGCAAGGAGCCTGG - Intergenic
1062637668 9:137500143-137500165 ATGTCTTCCAGCCCGGAGCCTGG + Intronic
1186472152 X:9830145-9830167 ATTTCTCACAGCCTGGAGCTGGG - Intronic
1190080657 X:47354600-47354622 CCTTCTCCCAACAGGAAGCCTGG - Intergenic
1190260128 X:48792208-48792230 ATTTCTCACCACAGGGAGGCAGG - Exonic
1190572434 X:51797652-51797674 ATTTTGCCCAGGAGGGAGACTGG - Intergenic
1190775757 X:53551218-53551240 ATTTCTCCTGCCAGGCAGCCTGG + Intronic
1192161258 X:68789663-68789685 ATTTCTTCCATCAGGGTGACTGG + Intergenic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1192698280 X:73442176-73442198 CTTTCTCCAAGCAGACAGCCAGG + Intergenic
1195098790 X:101532932-101532954 TATTCTCCCAACAGGGAGGCAGG - Intronic
1196734592 X:118973388-118973410 ACTGCTCCAAGCAGGGAGGCAGG - Intergenic
1197403997 X:126027893-126027915 AGTTTTCCCAGCAGGGTGGCTGG + Intergenic
1201449828 Y:14099807-14099829 TTTTCTCCCAACTGGGAACCAGG - Intergenic
1201770453 Y:17613034-17613056 ATGCCTGCCAGCAGGGTGCCAGG + Intergenic
1201831101 Y:18292953-18292975 ATGCCTGCCAGCAGGGTGCCAGG - Intergenic