ID: 1091857834

View in Genome Browser
Species Human (GRCh38)
Location 12:3753323-3753345
Sequence TGGGAGCCTGAATCGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091857834_1091857846 14 Left 1091857834 12:3753323-3753345 CCTTGCCCCGATTCAGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1091857846 12:3753360-3753382 TCCGGCCCTCGCTGGCTCACTGG 0: 1
1: 0
2: 0
3: 9
4: 127
1091857834_1091857849 19 Left 1091857834 12:3753323-3753345 CCTTGCCCCGATTCAGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1091857849 12:3753365-3753387 CCCTCGCTGGCTCACTGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 139
1091857834_1091857851 22 Left 1091857834 12:3753323-3753345 CCTTGCCCCGATTCAGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1091857851 12:3753368-3753390 TCGCTGGCTCACTGGAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 126
1091857834_1091857853 30 Left 1091857834 12:3753323-3753345 CCTTGCCCCGATTCAGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1091857853 12:3753376-3753398 TCACTGGAGAGGTGGTGTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 194
1091857834_1091857852 29 Left 1091857834 12:3753323-3753345 CCTTGCCCCGATTCAGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1091857852 12:3753375-3753397 CTCACTGGAGAGGTGGTGTCTGG 0: 1
1: 0
2: 2
3: 18
4: 231
1091857834_1091857843 -4 Left 1091857834 12:3753323-3753345 CCTTGCCCCGATTCAGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1091857843 12:3753342-3753364 CCCAAGGTGGGGCATCAGTCCGG 0: 1
1: 0
2: 1
3: 7
4: 134
1091857834_1091857845 6 Left 1091857834 12:3753323-3753345 CCTTGCCCCGATTCAGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1091857845 12:3753352-3753374 GGCATCAGTCCGGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091857834 Original CRISPR TGGGAGCCTGAATCGGGGCA AGG (reversed) Intronic
900272183 1:1796659-1796681 TGGAAGCCTGCAGAGGGGCAGGG + Intronic
901302704 1:8211206-8211228 TGGGAGTCAGAATCGGAGCCTGG - Intergenic
901770657 1:11528932-11528954 TGGGACCCTGACTCGGGGGTGGG + Intronic
903134808 1:21302590-21302612 CTGGAGCCTGAAAAGGGGCATGG - Intronic
904473870 1:30752096-30752118 TGGGAGGCTGGATGAGGGCAGGG + Intronic
904825069 1:33268979-33269001 AGGGGGCCTGGATCAGGGCAGGG + Intronic
905462002 1:38128086-38128108 TGAGGGCCTGAAGCGTGGCAGGG + Intergenic
907192052 1:52657557-52657579 TGAGAGAATGAATAGGGGCAGGG + Intronic
912051028 1:105527631-105527653 TGGGAGCCTGAAACTTGGAATGG - Intergenic
916004835 1:160650052-160650074 TGGGAGCTTGAAACTGGCCATGG + Intergenic
918339175 1:183553071-183553093 TGGGAGACTGCAGCTGGGCAGGG - Exonic
919423208 1:197397793-197397815 TGGGAGCTGGAATTAGGGCATGG + Intronic
919866474 1:201786808-201786830 AGAGAGCCTGAATGGTGGCATGG + Intronic
920021398 1:202958848-202958870 TGGGAGCAGGAACTGGGGCACGG - Intergenic
920825284 1:209419242-209419264 TGTGTGCTTGAATCTGGGCATGG - Intergenic
921194521 1:212741929-212741951 TGGGAGCCTGTAGCAAGGCAGGG - Intronic
922016705 1:221655571-221655593 AGGGAGCCTGAGTTGGGGCCTGG - Intergenic
922336802 1:224624585-224624607 TGGGGGCCTGAACCAAGGCAGGG - Intronic
924581731 1:245329657-245329679 TGGGAGCCTGGAAAGGGGCAGGG - Intronic
1063469341 10:6272041-6272063 TGGCAGCCACCATCGGGGCAGGG - Intergenic
1065669320 10:28097220-28097242 TGGGAGGCTGAAGTGGGGCCAGG - Intronic
1067201556 10:44176519-44176541 TGGGAGGCTGTAAGGGGGCAGGG - Intergenic
1070380726 10:75878363-75878385 GGGGAGCCAGAAGGGGGGCATGG + Intronic
1070923017 10:80200788-80200810 TGGGAGGCTGAGGCGGGGCGGGG + Intronic
1072984357 10:100126953-100126975 TGGGAGCCTGATTGGGTGGATGG - Intergenic
1073418348 10:103403599-103403621 GGAGAGCCTGAATGGGGGCCAGG + Intronic
1074322017 10:112412114-112412136 TGGGAGCCCTAATCATGGCATGG + Intronic
1075590288 10:123686390-123686412 TGGGAGCCTGAATGGGGAAATGG - Intronic
1076175425 10:128364346-128364368 TGGGTGACTGCATCTGGGCATGG + Intergenic
1076686102 10:132199120-132199142 TGAGTCCCTGCATCGGGGCAGGG + Intronic
1076733134 10:132448051-132448073 TCGAAGCCTGAAGCGGGGAATGG + Exonic
1077485129 11:2835031-2835053 TAGGAGCCAGAAGCGGGGGAGGG + Intronic
1078139296 11:8680438-8680460 TGGGGGCCTGAATGAAGGCAGGG + Intergenic
1081606785 11:44532106-44532128 TGGGAGGCTGAATCGGGGCCTGG - Intergenic
1081765380 11:45606659-45606681 GGGGAGCCTGACTCGGGGATGGG - Intergenic
1082991503 11:59211084-59211106 TGGGAGCCTGGCAGGGGGCAGGG + Exonic
1083928807 11:65827057-65827079 TGGGATCCTGAATGGGGGTAGGG - Intronic
1084462282 11:69302639-69302661 TGGGAGCCTGGCACGGGGCCTGG + Intronic
1085451906 11:76639209-76639231 AGGGAGCCAGAATGGGGTCAGGG - Intergenic
1086502020 11:87463541-87463563 TGGGAAACTGAATCTGGGCATGG + Intergenic
1088194086 11:107256912-107256934 TGGGAGGCCGAGGCGGGGCAAGG + Intergenic
1088549655 11:110999614-110999636 TGGGATCCTGAATTGGATCATGG - Intergenic
1089384003 11:118056279-118056301 TGGGAGCCTGACCCAGGGCAAGG + Intergenic
1089855123 11:121536948-121536970 TGGGAGCCAGAATGAGGGCCAGG + Intronic
1090533205 11:127612715-127612737 TAGGAGCAAGAATGGGGGCAGGG + Intergenic
1090919898 11:131198335-131198357 TGGGAGCCTGAGGTGGAGCAAGG - Intergenic
1091348183 11:134870021-134870043 TGGGATCTTGAAACGGGGGAGGG - Intergenic
1091712781 12:2753393-2753415 AGGGAGCCTGTGTCGGGGCGTGG + Intergenic
1091857834 12:3753323-3753345 TGGGAGCCTGAATCGGGGCAAGG - Intronic
1092046822 12:5437196-5437218 TGGGAGCCTGACTCTGAGCCAGG - Intronic
1094720825 12:33062181-33062203 TGGGATCCTGAATCAGGAAAAGG + Intergenic
1095270698 12:40215259-40215281 TGGCAGCCTGAATGGGGCCATGG - Intronic
1101191806 12:102341974-102341996 TGGGAGCCTGAAACCAGCCATGG - Intergenic
1101697789 12:107142686-107142708 TGGGGGTTGGAATCGGGGCATGG - Intergenic
1103781062 12:123399106-123399128 TGGCAGCCAGCAGCGGGGCAGGG + Intronic
1104761273 12:131298809-131298831 CGGGACCCTGAGTCGGGGCCTGG - Intergenic
1104818502 12:131661983-131662005 CGGGACCCTGAGTCGGGGCCTGG + Intergenic
1107770782 13:43786425-43786447 AGGGAGCTTGAGACGGGGCACGG + Intronic
1112173888 13:97001961-97001983 TGGGAGTCTGAATATGTGCATGG - Intergenic
1113887478 13:113668396-113668418 GGGGAGGCTGAAGAGGGGCAGGG + Intronic
1117953749 14:61107222-61107244 TTGGCCCCTGAATCGGGGAAGGG + Intergenic
1118758114 14:68860295-68860317 TGGGAGGCTGAACCGGGGGGCGG + Intergenic
1119321156 14:73731305-73731327 TGGGAGCCAGAACCTTGGCAGGG - Intronic
1121321654 14:92995071-92995093 TGGGAGCCGGGAGAGGGGCAGGG + Intronic
1122779081 14:104136141-104136163 TGGAAGCCAGAATCGGGTCGCGG - Intergenic
1123010547 14:105347596-105347618 TTAGAGCCTGAAGCCGGGCAGGG + Intronic
1124120955 15:26888368-26888390 TGGAAGCCTAATTCTGGGCATGG - Intronic
1127330454 15:57934030-57934052 TGGGAACCAGAATCGGGACTTGG + Intergenic
1127379950 15:58422289-58422311 TGGGAGGCTGAAGCAGGGAATGG - Intronic
1128744439 15:70103628-70103650 TGGGAGTCGGGATAGGGGCAGGG - Intergenic
1128800293 15:70492814-70492836 TGGGAGGCTGAATCAGGACCCGG - Intergenic
1129107027 15:73317688-73317710 CGGGGGCCTGAATTGGGGTAGGG + Intergenic
1129675796 15:77632059-77632081 TGGGAGCCTGGAGCTGGGGAGGG - Intronic
1130486111 15:84399244-84399266 TGGGCGACTGCCTCGGGGCACGG - Intergenic
1132113340 15:99118056-99118078 TGGGAGTCTGCAGCGGGGCAGGG - Intronic
1133078208 16:3295787-3295809 AGGGAGCCTGGACCAGGGCAGGG + Intronic
1133903192 16:9996348-9996370 AGGGAGCCTGCATCGTGGGAGGG - Intronic
1137497414 16:48981478-48981500 TGCAAGCCTGGATCTGGGCAAGG - Intergenic
1137522546 16:49207141-49207163 TGCGAGCCTGAAATGGAGCATGG + Intergenic
1141271064 16:82541653-82541675 TGGGAGCCTGAGTGGGTGCCAGG - Intergenic
1142125325 16:88407320-88407342 TGGGAGCCGGCATCATGGCAGGG + Intergenic
1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG + Intergenic
1143082899 17:4394641-4394663 TGGAAGCCTGGATGGGGGCTAGG - Intergenic
1143521899 17:7449070-7449092 TGGGAGTCTGAAAGTGGGCAGGG - Intronic
1143764862 17:9130757-9130779 TGAGGGCCTGAATCAGGGTAGGG - Intronic
1144141813 17:12356728-12356750 TGGGACCCTGAATCACTGCATGG - Intergenic
1148344789 17:46895909-46895931 TGGGAGCCTGGTGCTGGGCAGGG + Intergenic
1149253284 17:54794773-54794795 TGGGAGCTTGCATGGGGGCAGGG - Intergenic
1150186436 17:63186594-63186616 TGGGAGGCTGAAGCGGGGGGTGG - Intronic
1152806505 17:82359355-82359377 TGGGAGGCTGAAGCGGGGCCAGG + Intronic
1155800944 18:30102526-30102548 GGGGAGCCGGAATAGGGGGATGG - Intergenic
1157102915 18:44745991-44746013 AGAGAGCTTGAATTGGGGCAGGG + Intronic
1159475587 18:68916844-68916866 GGGTAGGCTGAATCAGGGCAAGG + Intronic
1160993131 19:1869075-1869097 TGGGACCCTGGATGGGGGCCGGG + Intergenic
1161346314 19:3770434-3770456 TGGGAGACGGGATGGGGGCAGGG + Exonic
1161454477 19:4363148-4363170 CCGGGGCCTGCATCGGGGCAGGG + Intronic
1161933109 19:7354363-7354385 TGGGAGGCTGATTTGGGGCTGGG + Intronic
1163661394 19:18579976-18579998 TGGGACCCTGACTCGGATCATGG + Intronic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1167146215 19:47681885-47681907 TGGGAGCGTCAATAGGGGCAGGG + Intronic
1167422709 19:49413515-49413537 TGGGAGCCTGAAAGAGGGGAGGG - Intronic
1168233513 19:55047732-55047754 CGGGAGCCTGCATCGGTGCGTGG + Intronic
1168649104 19:58081821-58081843 TGTGAGGCTGAAGCTGGGCACGG - Intronic
934565759 2:95339882-95339904 TGGGTGCCTGAATGGCTGCATGG - Intronic
934949573 2:98567196-98567218 TGGGAACCTGGATCAGGGCCAGG + Intronic
935291481 2:101614225-101614247 TGGGAGGCTGAGTCAGGGCGAGG + Intergenic
937290146 2:120777002-120777024 TGGGCACCTGACACGGGGCAGGG + Intronic
938262995 2:129908601-129908623 TGGGCGCCTGAAGAGGGTCAGGG + Intergenic
946174444 2:217913840-217913862 TGGGTGCAGGAATGGGGGCAGGG - Intronic
947977825 2:234382781-234382803 TGGGAGCCTGAGGCCAGGCACGG + Intergenic
948782421 2:240329890-240329912 TGGGAGCGTGAACCTAGGCAGGG + Intergenic
949016972 2:241719036-241719058 TGGGGGCCTGGGGCGGGGCAGGG + Intronic
1169368723 20:5011997-5012019 TGGGAGGCTGAGACGGGGCGGGG - Intergenic
1172623503 20:36334585-36334607 AGGTGGCCTGAATCGGGACAGGG + Intronic
1173847479 20:46197359-46197381 TAGGAGACAGAATCGGGGGAGGG - Intronic
1175941414 20:62539101-62539123 TGGCTGCCTGGAGCGGGGCAGGG - Intergenic
1176012510 20:62906791-62906813 TGGGAGGCGGGTTCGGGGCAAGG - Intronic
1178535058 21:33403846-33403868 TGGGAGCCCGCAGCGGGGCTGGG + Intronic
1179325032 21:40334072-40334094 TGTGAGCCTGACTGGGGGCTGGG + Intronic
1180049519 21:45324915-45324937 TGTGGGCCTGAAGCGGGGAAAGG + Intergenic
1181139595 22:20794694-20794716 TGGGAGAGTGAAACAGGGCAGGG - Intronic
1182000012 22:26912718-26912740 TTGGAGCCCAGATCGGGGCACGG - Intergenic
1182041555 22:27242242-27242264 TGGCAGCCTGAGACCGGGCATGG + Intergenic
1182142011 22:27967661-27967683 TGGGAGCCTGAGTGGGGTGACGG - Intergenic
1182693767 22:32182296-32182318 TGTCAGCTTGCATCGGGGCAGGG + Intergenic
1182992876 22:34784668-34784690 TGGGAGCCTGAGTCAGTGTAGGG - Intergenic
1183543020 22:38440830-38440852 TGGAAGACTGAAACGGGGCCAGG + Intronic
1185052650 22:48561952-48561974 AGGGAGCCTGAGGCCGGGCAGGG - Intronic
1185177044 22:49333860-49333882 TGGGAGCCCGGATGGGGGCATGG + Intergenic
1185209850 22:49564730-49564752 TGGGCTCCTGAATCGGGGCCAGG - Intronic
949808260 3:7978478-7978500 AGGGAGCCAGAAGCGGGGGACGG + Intergenic
950793781 3:15494294-15494316 TGGGAGCATGCAGCAGGGCACGG + Intronic
951621516 3:24606753-24606775 TGGGACCTTGGATGGGGGCAGGG + Intergenic
951673653 3:25212907-25212929 TGGGAGCCTGAACTAGGCCACGG + Intronic
954443221 3:50533051-50533073 AGGGAGCCTCAATAGGGGCCTGG + Intergenic
954641548 3:52102319-52102341 TGGAAGTCTGAATCAAGGCAGGG + Intronic
954751812 3:52818151-52818173 AGGGAGCCTGTATGGGGGCTGGG + Exonic
956106194 3:65821295-65821317 TCGGGGCCTGAAACAGGGCAGGG - Intronic
959913366 3:111790030-111790052 GAGGAGCCTGACTGGGGGCAGGG + Intronic
960247202 3:115412890-115412912 TGGGAGGCTGAAGCAGGGGAGGG - Intergenic
961521010 3:127467390-127467412 TGGGTCCCTGAATTTGGGCACGG + Intergenic
961709187 3:128813905-128813927 TGTGAGCCTGTAATGGGGCATGG - Exonic
962941282 3:140126779-140126801 TGAGAGCCTGAATTGTGCCAGGG + Intronic
965065166 3:163839230-163839252 GGGGAGCCGGAAGCGGGGGATGG + Intergenic
968663837 4:1810185-1810207 TGGGATCCTGAATGGGTGCTGGG + Intergenic
976886546 4:89991707-89991729 TGGGAGCATGAACTTGGGCAAGG - Intergenic
980386602 4:132093195-132093217 TGGGACCCTGAATCTTGGAATGG - Intergenic
981746039 4:148053294-148053316 TGGGTTTCAGAATCGGGGCAGGG - Intronic
982057818 4:151570363-151570385 TGGGAGCATGAAAGAGGGCAGGG - Intronic
983957367 4:173714045-173714067 TGGGAGCCTGAAGTGTGGCTAGG + Intergenic
985513491 5:325157-325179 TGGGAAGATGAAGCGGGGCAGGG - Intronic
988159592 5:27502600-27502622 TGGAAGTCTGAAACCGGGCAGGG + Intergenic
988567605 5:32331844-32331866 TGGGAGCCAGAAAGGGGGCGGGG + Intergenic
993227222 5:85182526-85182548 TGGGCGCCGGCATCTGGGCAAGG - Intergenic
993232250 5:85250246-85250268 TGGGACCCTGAAACGTGGAATGG - Intergenic
998849414 5:146339201-146339223 TGGGAGACAGACTCGGCGCATGG - Exonic
1002051943 5:176576234-176576256 TGGGAGCCTGGATCGAGTGACGG + Intronic
1004799909 6:19134814-19134836 GGGGAGCCAGAACCGGGGGATGG - Intergenic
1005557918 6:27007141-27007163 TGGGAGCCTGAATAGGTGTGTGG + Intergenic
1006094009 6:31644590-31644612 TGTGTGCCAGAATCTGGGCAGGG + Exonic
1006150037 6:31982191-31982213 TGGGTGCTTGGATTGGGGCAGGG + Intronic
1006156338 6:32014929-32014951 TGGGTGCTTGGATTGGGGCAGGG + Intronic
1006634418 6:35452139-35452161 AGGGAGCCTGGAGCGGGGCGGGG - Intergenic
1006753027 6:36391254-36391276 TTGGAGCCAGGATTGGGGCAGGG + Exonic
1011335879 6:86259273-86259295 TAGGAGCTGGAATCTGGGCAGGG + Intergenic
1017254052 6:152313382-152313404 TAGGGGCCTGAATAGGGGCTGGG - Intronic
1019569479 7:1704174-1704196 AGGGAGCCTGCAGCCGGGCATGG + Intronic
1020611610 7:10404333-10404355 TGGGAGGCTGAAGCGGGGGTGGG - Intergenic
1023013606 7:35944181-35944203 TGGGAGGCTGAGGTGGGGCAGGG + Intergenic
1023881661 7:44324706-44324728 AGGGAGCCTGGATCAGGTCATGG - Intronic
1024077523 7:45829653-45829675 TGGGAGGCTGAGGTGGGGCAGGG - Intergenic
1024082373 7:45865904-45865926 TGGGAGCATTAATTGGGGGAAGG + Intergenic
1025126890 7:56351759-56351781 TGGGAGGCTGAGGTGGGGCAGGG + Intergenic
1028054437 7:86225363-86225385 TGGGAGGCTGTATCTGGACAAGG + Intergenic
1028235715 7:88359349-88359371 TGGGTCCCTGAATCTGGCCATGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029549747 7:101231464-101231486 TGGGAGGCTGAGGCGGGGGAGGG - Intergenic
1031100992 7:117479739-117479761 TGGGAGTCAGAATCGGGAAAGGG + Intronic
1033596955 7:142865530-142865552 TGGGAGCGTGACTGCGGGCAGGG - Exonic
1034083506 7:148302434-148302456 TGGGAGGCTGAAAAAGGGCAGGG - Intronic
1034758968 7:153653050-153653072 TGGGAGTGTGAATGGTGGCAGGG + Intergenic
1038362704 8:26898433-26898455 TGGGAGCCTGAACCAGGGATGGG + Intergenic
1038395980 8:27245728-27245750 TGGAAGCCTGAATAGGTGGAGGG + Intronic
1038446666 8:27609240-27609262 TGGGAGCCTGTGCCAGGGCAAGG - Intronic
1039832145 8:41223822-41223844 AGTGAGCCTGAGGCGGGGCACGG + Intergenic
1040037322 8:42883152-42883174 GGGGAGACTGAAAGGGGGCAAGG + Intronic
1040544305 8:48385105-48385127 TGGCAGCCCGGGTCGGGGCAGGG - Intergenic
1044552372 8:93526399-93526421 TGGGAGCTTGAAGCGGGGGAAGG - Intergenic
1048899888 8:139027271-139027293 GGGGAGCCGGAAGCGGGGGATGG - Intergenic
1052987668 9:34500012-34500034 TTGGGGCCTGAACCTGGGCAGGG + Intronic
1052999744 9:34571392-34571414 TGGGAGCAGGAACCAGGGCATGG + Intronic
1054871790 9:70053873-70053895 TGAGGGCCTGAATTAGGGCAGGG + Intronic
1057129292 9:92642013-92642035 GGGGTGCCTGAGTTGGGGCAGGG + Intronic
1057846609 9:98530959-98530981 TGGGAGCCTGGCCCGGGGCTGGG + Intronic
1058991255 9:110256635-110256657 TGCGAGCCGGGATCGGGGCGGGG + Exonic
1060357652 9:122925265-122925287 TGGGAGGCTGAATGGGAGGATGG + Intronic
1060562039 9:124553781-124553803 TTGGAGGGTGAATTGGGGCAGGG - Intronic
1062443209 9:136582741-136582763 TGGAAGCCTGAAACGGGTCCTGG + Intergenic
1062580497 9:137227310-137227332 TGGGGGCCAGCAACGGGGCAAGG - Exonic
1186618625 X:11214986-11215008 CTGGGGCCTGAATCAGGGCAAGG + Intronic
1191677729 X:63809386-63809408 TTGGAGCCTGAAAGGGGGAAAGG - Intergenic
1195217193 X:102713254-102713276 TGGGGACCCGAATCGGGGTAGGG + Intronic
1196179025 X:112670391-112670413 GGGGAGCCTGAATGAGGGGAAGG + Intronic
1200173188 X:154094161-154094183 TGGGAGCCGGAATTGGGGGGTGG - Intronic
1201524971 Y:14922786-14922808 TGGGAGCCAGAATCTGGGGGAGG - Intergenic