ID: 1091857857

View in Genome Browser
Species Human (GRCh38)
Location 12:3753407-3753429
Sequence CGGGCTGCTGCCGGGTTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091857857_1091857865 2 Left 1091857857 12:3753407-3753429 CCCGAAAACCCGGCAGCAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1091857865 12:3753432-3753454 GTCACTCCGGCTGTTACCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 63
1091857857_1091857871 20 Left 1091857857 12:3753407-3753429 CCCGAAAACCCGGCAGCAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1091857871 12:3753450-3753472 TCTGGGAGCAGAAACTAAAGGGG 0: 1
1: 0
2: 1
3: 30
4: 297
1091857857_1091857870 19 Left 1091857857 12:3753407-3753429 CCCGAAAACCCGGCAGCAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1091857870 12:3753449-3753471 CTCTGGGAGCAGAAACTAAAGGG 0: 1
1: 0
2: 1
3: 25
4: 211
1091857857_1091857869 18 Left 1091857857 12:3753407-3753429 CCCGAAAACCCGGCAGCAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1091857869 12:3753448-3753470 CCTCTGGGAGCAGAAACTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 193
1091857857_1091857866 3 Left 1091857857 12:3753407-3753429 CCCGAAAACCCGGCAGCAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1091857866 12:3753433-3753455 TCACTCCGGCTGTTACCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091857857 Original CRISPR CGGGCTGCTGCCGGGTTTTC GGG (reversed) Intronic
900121757 1:1051325-1051347 CGTGCTGCTGCCGTGTCCTCTGG + Exonic
903599549 1:24525793-24525815 CGTGCTAATGCCGGGTTATCAGG + Intronic
906076047 1:43052911-43052933 AGGGCTGGTTCCGTGTTTTCTGG + Intergenic
908652046 1:66344814-66344836 CGGGCAGATGCAGAGTTTTCTGG - Intronic
920177048 1:204108539-204108561 GTGGCTGCTGCTGGGATTTCTGG + Intronic
1070751190 10:78965010-78965032 GGGGCTGCTGCATGCTTTTCTGG - Intergenic
1076652696 10:132000806-132000828 CGGGGTGCAGCTTGGTTTTCTGG - Intergenic
1077917691 11:6621996-6622018 CGGGCTGCAGCTGTGTTTGCTGG + Exonic
1081700152 11:45147374-45147396 GGGGCTGCTGCGGGGTGCTCGGG + Exonic
1084296735 11:68216896-68216918 TGGGCGGCTGGCGGGTTTCCTGG + Intergenic
1084497101 11:69511510-69511532 CGGGCTCCAGCTTGGTTTTCCGG + Intergenic
1084860504 11:72014886-72014908 CGTTCTGCTGCCGGCTTATCTGG + Exonic
1090652739 11:128821891-128821913 GGGGCTGATGCTGGGTTTCCAGG + Intergenic
1091010720 11:131998124-131998146 CAGGCTGCTGCCTGGTTTTACGG + Intronic
1091857857 12:3753407-3753429 CGGGCTGCTGCCGGGTTTTCGGG - Intronic
1103055984 12:117820727-117820749 CTGACTGCTGCCAGGTTTTATGG - Intronic
1103329251 12:120142533-120142555 TGGGCTCCTGCTGGGTTTCCTGG - Exonic
1104745691 12:131208803-131208825 TGTGCTGCTGCTGGGATTTCAGG + Intergenic
1104788655 12:131468305-131468327 TGTGCTGCTGCTGGGATTTCAGG - Intergenic
1109931412 13:69222705-69222727 CCGGCTACTGCCGGGAGTTCGGG - Intergenic
1119286300 14:73458020-73458042 CCGGCCGCTGCCGGGCTTCCCGG + Intronic
1121463769 14:94101388-94101410 CGTGCTGCTGCAGGGCCTTCAGG + Intronic
1125328965 15:38564403-38564425 CGCGCTGCGCCCGGGGTTTCGGG - Intronic
1131888655 15:96948030-96948052 CGCGCTGCTGCCCGGCTCTCGGG + Intergenic
1132466017 16:77807-77829 CGGGCCGCAGACGTGTTTTCCGG - Intronic
1133035433 16:3031412-3031434 CCAGCTGCTGCCGGGGCTTCTGG + Intronic
1135495559 16:22948420-22948442 CGGGGTGCAGCCGAGGTTTCTGG - Intergenic
1141072881 16:80974044-80974066 CGGGTTGCTGCTGGGTATTTAGG - Exonic
1141405159 16:83786038-83786060 AGGGATGGTGCCAGGTTTTCTGG - Intronic
1141480671 16:84304671-84304693 CGGGTTGCTCTGGGGTTTTCAGG + Intronic
1142163426 16:88570955-88570977 CGGGCTGCTGCTGGGCTCTTCGG + Intronic
1143830536 17:9646928-9646950 CGGGTTGCTGCCGGGTCGTGAGG + Intronic
1145986093 17:29047392-29047414 AGGGTTGCTGCCGGGTAGTCAGG + Intronic
1151485606 17:74397419-74397441 CCGGCTGCATCCAGGTTTTCGGG + Intergenic
1151807388 17:76414614-76414636 CGAGCTGCAGCCGAGTTTCCAGG - Intronic
1151944747 17:77313403-77313425 GGGGCCGCTGCAGGGTTTACTGG - Intronic
1152460450 17:80439493-80439515 TGGGCTGCTGCCGGGGTTGGGGG - Intergenic
1152755314 17:82084735-82084757 GGGGCTGCTGCGGGGCCTTCGGG + Intronic
1157666951 18:49495291-49495313 CGGGCTGCTCACAGTTTTTCTGG + Intergenic
1162026109 19:7895043-7895065 CAGGCTCCAGCCGGCTTTTCCGG + Intronic
1162936431 19:13983804-13983826 AGGGCTGCTGCCAGGTATTAAGG - Intronic
1164835252 19:31351474-31351496 CGGGCTGCGGCGGGGCTCTCGGG + Intergenic
1165716087 19:38046664-38046686 GGGGATGCTGCTGGATTTTCCGG + Intronic
1168404234 19:56102681-56102703 CAGGCTGATGCCGACTTTTCAGG - Intronic
926157335 2:10463891-10463913 AGGGCTGCTCCCTGCTTTTCAGG + Intergenic
926226723 2:10972045-10972067 CGAGCTCCTCCCGGGTTTCCTGG - Intergenic
930323366 2:49882661-49882683 GGGGCTGCTGCCTTTTTTTCAGG - Intergenic
934795374 2:97094982-97095004 CAGGCGGCGGCCGCGTTTTCTGG + Intergenic
935032631 2:99337266-99337288 CGGGCTGCTGCCTGGTCGGCCGG + Intronic
935322017 2:101898354-101898376 CGGGGTGCTGAAGGGATTTCAGG - Intergenic
936467197 2:112764314-112764336 AAGGCTGCTGCAGGGCTTTCTGG + Intronic
946282442 2:218675891-218675913 GGGACTGCTGCTGGGTCTTCTGG + Intronic
948762733 2:240202811-240202833 CGGGCTGCTGCTGTGGTTTTGGG + Intergenic
1169471344 20:5888186-5888208 TGGGCTGCTGATGAGTTTTCTGG - Intergenic
1173334268 20:42100262-42100284 CGTGCTCCTGCCGGGTTTCAGGG + Intronic
1173551712 20:43937368-43937390 CGGGCAGCTCCTGGGTTTTGTGG + Intronic
1174182051 20:48681115-48681137 CGTGCAGCCGCCGTGTTTTCTGG - Intronic
1175287419 20:57846220-57846242 TGGGCTGCTCCCTGGTTTTTGGG + Intergenic
1180050000 21:45326743-45326765 CGTGCTGCAGCCGTGTGTTCAGG + Intergenic
1180072576 21:45443672-45443694 CGGGCTGCAGCCGGGTCCCCAGG + Intronic
1181601082 22:23952234-23952256 TGGGCTGCTGCCGGGCCTTGTGG + Intergenic
1181607427 22:23989092-23989114 TGGGCTGCTGCCGGGCCTTGTGG - Intergenic
1184803301 22:46775507-46775529 CTGGCTGCTGCCAAGTTCTCAGG + Intronic
1185211780 22:49574560-49574582 TGGGCTGTGGCCTGGTTTTCAGG - Intronic
951201062 3:19875798-19875820 CCGGCTACTGCCGGGAGTTCGGG + Intergenic
954380280 3:50215588-50215610 AGGGCTGCTGCCAGCTTTCCTGG - Exonic
968278173 3:197456703-197456725 CGGGCTGCTGCAGCGGTTCCGGG - Intergenic
969696304 4:8737070-8737092 CGGGCTGCTGCAGTTGTTTCTGG - Intergenic
971107456 4:23542295-23542317 AGGGCTGCTGTGGGGTTTGCTGG - Intergenic
976002186 4:80386520-80386542 GGGGGTGCCGCCGGGTTTGCAGG + Intronic
978325794 4:107552703-107552725 GGGGCTGCTGCCAGTTTTCCAGG + Intergenic
983534581 4:168843791-168843813 TGAGCTGCTGCCAGTTTTTCGGG - Intronic
986205983 5:5625687-5625709 CGGGCTCCTGCCAGGTACTCTGG - Intergenic
987829566 5:23077702-23077724 GGGGTTTCTGCTGGGTTTTCAGG + Intergenic
991226984 5:64285143-64285165 CAGGCTGCTGCTTTGTTTTCTGG + Intronic
995906641 5:117132114-117132136 CTGGCAGCTGCAGGGATTTCTGG + Intergenic
999866243 5:155703322-155703344 ATAGCTGCTGCTGGGTTTTCAGG + Intergenic
1000939422 5:167342463-167342485 CTGACTGCGGTCGGGTTTTCAGG + Intronic
1003521490 6:6862353-6862375 CAGGCTGCTGCCTGGTCTCCTGG - Intergenic
1005520438 6:26596623-26596645 CGGGTTGATGCCGGCTTTTTAGG - Intergenic
1006641422 6:35491620-35491642 CAGCCTGCTGGCGGGTTTGCAGG - Intronic
1008331614 6:50252223-50252245 CAGGATGCTGCCAGGTTCTCTGG + Intergenic
1008782704 6:55126742-55126764 GGGGCTGCTGCCTTATTTTCAGG + Intronic
1009544434 6:65005783-65005805 CCGGCTACTGCCGGGAGTTCGGG - Intronic
1010631859 6:78207795-78207817 CGGGCTGCTGCAAAGTTCTCTGG + Intergenic
1010893141 6:81338029-81338051 CCGGCTACTGCCGGGAGTTCGGG - Intergenic
1011540263 6:88420660-88420682 CCGGCTACTGCCGGGAGTTCAGG + Intergenic
1017825390 6:158077879-158077901 AGTGTTGCTGCCGGGTTTCCAGG - Intronic
1019074959 6:169379642-169379664 CGGGATGCTGCTGGATTTCCTGG - Intergenic
1019616152 7:1963356-1963378 CGGGCGGCTGTCGAGTCTTCTGG - Intronic
1022110272 7:27225824-27225846 CGCGCTGCTCCCGGGTTTGTCGG + Intergenic
1028588968 7:92477097-92477119 CCGGCTACTGCCGGGAGTTCAGG + Intronic
1035779670 8:2217425-2217447 CAGGCTGCTGTCTGGTTTTCTGG - Intergenic
1042581284 8:70281694-70281716 CGGACTGCTGCATGGTGTTCAGG - Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1049647879 8:143744331-143744353 GTGGCTGCTCCTGGGTTTTCTGG - Intergenic
1053283454 9:36836193-36836215 TGGGGAGCTGCTGGGTTTTCAGG - Exonic
1054766260 9:69045028-69045050 AGGGCTGCTGCAGGCTGTTCAGG - Intronic
1056776461 9:89516469-89516491 CGGGCTGCTCTCGGCTTCTCTGG + Intergenic
1056962111 9:91134429-91134451 CGGCCTGCTGTTGGGTTTTAAGG + Intergenic
1059418646 9:114177475-114177497 GGGGCTGCTGCCGGTTCTTGGGG + Intronic
1193595071 X:83435664-83435686 GGGGCTGCTGCCTTTTTTTCAGG + Intergenic
1194391201 X:93319910-93319932 GGGGCTGCTGCCTTTTTTTCAGG - Intergenic