ID: 1091858244

View in Genome Browser
Species Human (GRCh38)
Location 12:3756107-3756129
Sequence GACCTAGCAGTGGCCTCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091858244_1091858248 7 Left 1091858244 12:3756107-3756129 CCCTAAGAGGCCACTGCTAGGTC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1091858248 12:3756137-3756159 CACCAGGAAATGTGTGTCATTGG 0: 1
1: 0
2: 2
3: 36
4: 306
1091858244_1091858247 -9 Left 1091858244 12:3756107-3756129 CCCTAAGAGGCCACTGCTAGGTC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1091858247 12:3756121-3756143 TGCTAGGTCATGTCAACACCAGG 0: 1
1: 0
2: 1
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091858244 Original CRISPR GACCTAGCAGTGGCCTCTTA GGG (reversed) Intronic
907582765 1:55586841-55586863 GACCTAGCCGTTGCCTCTGTTGG + Intergenic
922100806 1:222475749-222475771 TGCCTTGCAGTGGCCTCTTTAGG - Intergenic
922733817 1:227968923-227968945 TGCCTTGCAGTGGCCTCTTTAGG + Intergenic
1064383043 10:14863404-14863426 GAGCTGTCAGTGGCCTCTTCAGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069243753 10:66175130-66175152 GACATAGCAGTTGCCACATAGGG - Intronic
1070575152 10:77672039-77672061 GACCCAGCACTGGCCTCCTGCGG - Intergenic
1076855978 10:133115829-133115851 GACCTGGCAGTGGTGTCTCAGGG - Intronic
1080055546 11:27902765-27902787 GCTCTAGCAGAGGCCTCTTGAGG + Intergenic
1081977172 11:47242988-47243010 GAGCTAGCAGTGTCCTCTGGAGG - Intronic
1085499583 11:77007487-77007509 GACAAAGCAGTGGCCTAGTAGGG - Intronic
1091858244 12:3756107-3756129 GACCTAGCAGTGGCCTCTTAGGG - Intronic
1100705978 12:97200579-97200601 GGACTAGCAGTGGCCCCTCATGG - Intergenic
1101546110 12:105714558-105714580 GGCATAGCAGTGGCCTCCAAAGG - Intergenic
1103971600 12:124675991-124676013 AACTGAGCAGTGGCCTCTGAAGG + Intergenic
1104716406 12:131019148-131019170 GACTCAGCAGTGGCCTCTGGTGG + Intronic
1119414360 14:74459752-74459774 GAATTAGCAGTGGCCTCTGGTGG - Intergenic
1119853437 14:77882346-77882368 GACCAAGCAGTTCCCACTTAGGG - Intronic
1120075734 14:80156152-80156174 GCCCCAGCAGGGGCCTCTTTAGG + Intergenic
1127639442 15:60901966-60901988 GACATTGCAGTGGCCTCAAAGGG - Intronic
1134162183 16:11900484-11900506 GAGCTAGCAGTCGGCACTTAGGG - Intronic
1140263194 16:73398265-73398287 GACCTAGATGTGTCCTCTTAGGG + Intergenic
1144025548 17:11273385-11273407 GAGCAAGCAGTGGCCTCCTCTGG - Intronic
1144852790 17:18252383-18252405 GACCCAGCAGAGGCCTCCTGAGG - Intronic
1145728719 17:27156551-27156573 CACCTAGAACTGGCCTCTCACGG + Intergenic
1149267952 17:54948175-54948197 GACATTGCAGTGGCCTCTAAGGG + Intronic
1160447525 18:78939210-78939232 GACCTAGCATTTGCCTCCAATGG - Intergenic
928971125 2:37030508-37030530 GACCTAGAAATTCCCTCTTAAGG - Intronic
929762550 2:44817995-44818017 ATCCTAGCAGTGGCCTCATGAGG - Intergenic
942776251 2:179586054-179586076 GACCTAACAGTGGTCCTTTATGG - Intronic
944890345 2:204110647-204110669 TACCAAGCAGTGGGCTCTAAGGG + Intergenic
946808650 2:223498469-223498491 CACCTTTCAGTGGACTCTTATGG + Intergenic
948330029 2:237157271-237157293 GACCTGGCAGTGGCTCCTGAGGG - Intergenic
1168924115 20:1565810-1565832 GTCCCAGCAGTGGCCTCCAAGGG + Intronic
1169360681 20:4946263-4946285 GCCCTGGGAGTGGCCTCTAAGGG - Intronic
1174105169 20:48156772-48156794 AACCTAGGAGTGGCCTTTTGAGG - Intergenic
1176227133 20:64007167-64007189 GATGCAGCAGTGGCCTCATAGGG - Intronic
954142948 3:48619757-48619779 GACAGAGCAGTGGCCTCTCAAGG + Intergenic
954440360 3:50518415-50518437 GACCTTGCACTGGCCGCTGAGGG - Intergenic
954582757 3:51711956-51711978 GACCAAGCCTTGGCCTATTAGGG + Intronic
961023051 3:123526041-123526063 GAGCAAGCACTGGCCTCTGAGGG + Intronic
961103969 3:124225450-124225472 GGCCCAGCAGTGGCCTCTACAGG + Intronic
967634733 3:191788144-191788166 GACCTTGCATTGGTCTCTTTTGG + Intergenic
972720656 4:41693799-41693821 AACCTAACAGTGCCCTCTTCTGG - Intronic
974500674 4:62697384-62697406 GACCTAGCACTGACATCTTTTGG + Intergenic
976587548 4:86815898-86815920 AACCTATCAGAGGCCTCTAAAGG - Intergenic
977121945 4:93113132-93113154 GAGCTAGCAGTGGATTCTTCAGG + Intronic
979258989 4:118631825-118631847 TGCCTTGCAGTGGCCTCTTTAGG + Intergenic
979329364 4:119408736-119408758 TGCCTTGCAGTGGCCTCTTCAGG - Intergenic
981849167 4:149208087-149208109 GATCTAGCAGTGGCTTCTTGGGG - Intergenic
985638919 5:1054116-1054138 GACCCAGTAGTGGCCACTGAGGG - Intronic
990103336 5:52221075-52221097 GACCTTGAAGAGGGCTCTTAAGG - Intergenic
992858766 5:80891110-80891132 AACCTATCAGAGGCCTCTAAAGG - Intergenic
1007104698 6:39275506-39275528 GATCTAGGAGTGTCCTCTGATGG + Intergenic
1007582748 6:42968946-42968968 GAACTAGCAGTGTCCTTCTACGG - Exonic
1009307115 6:62103735-62103757 GACCTTGCAGTGGCCCCTCCAGG + Intronic
1009854203 6:69240193-69240215 GACCTAGAATTGGGCTCTTTTGG - Intronic
1013005455 6:106068893-106068915 GACCTAACAGTGGCCACAGATGG - Intergenic
1016408818 6:143760505-143760527 GCCCCAGCAGTGGCCCCTTTCGG - Exonic
1021038434 7:15830282-15830304 GATGTAGGGGTGGCCTCTTAAGG - Intergenic
1021103921 7:16615612-16615634 GAGCTTGCAGTGGGCTCTTTTGG - Intronic
1023669046 7:42556783-42556805 GACCTATCAGTGGCATTTGATGG - Intergenic
1024426214 7:49229417-49229439 TACCTAGCTGTGGTCTCTCAAGG - Intergenic
1025177712 7:56810388-56810410 CACCTGCCAGTGGCCTCTTCTGG - Intergenic
1025178728 7:56814520-56814542 CACCTGCCAGTGGCCTCTTCAGG - Intergenic
1025690057 7:63749552-63749574 CGCCTACCAGTGGCCTCTTCAGG + Intergenic
1025694041 7:63765851-63765873 CACCTGCCAGTGGCCTCTTCAGG + Intergenic
1031921954 7:127608872-127608894 GACCTACCCATGGCCACTTATGG - Intergenic
1032051355 7:128652805-128652827 CACCTGCCAGTGGCCTCTTCAGG + Intergenic
1032833072 7:135648519-135648541 GACGTATCCGTGGCCTCTTGAGG + Exonic
1035126284 7:156610189-156610211 GACGTAGCTGTGGAGTCTTAGGG - Intergenic
1038025503 8:23585501-23585523 GACCAAGAAGTTGCTTCTTATGG - Intergenic
1038264175 8:26024426-26024448 GACCTTGCAGTGGGGTCTTAGGG - Intronic
1044396789 8:91722156-91722178 AACCTAAGAGTGGCCTTTTAAGG + Intergenic
1045973189 8:108102799-108102821 AACTTAGCAGTGTCTTCTTATGG + Intergenic
1053100774 9:35370535-35370557 GACTTAGCAGTGGCTTCACAGGG + Intronic
1053145089 9:35706676-35706698 GATCAAGGAGTGGCTTCTTAGGG - Intronic
1054085543 9:60739537-60739559 GACTTTGCAGTTGCCTCTGATGG + Intergenic
1056557495 9:87701959-87701981 GAACTAACAGTGGTCTCTGAGGG + Intronic
1057813201 9:98273588-98273610 GAATTAGCAGTGGCTCCTTAGGG + Intergenic
1058851599 9:109016877-109016899 GACCTTGCAGTCTCCTCTGAGGG - Exonic
1191100862 X:56726783-56726805 AACCTAACAGTGCCCTCTTCTGG + Intergenic
1191900903 X:66039943-66039965 CACCTAACAGTGGACACTTATGG - Exonic
1195095997 X:101501712-101501734 GACCTAGAAGTTGCCTTATATGG - Intronic
1197723381 X:129759895-129759917 GGCCTGACAGTGGCCTCTTCTGG - Intronic