ID: 1091858533

View in Genome Browser
Species Human (GRCh38)
Location 12:3758245-3758267
Sequence ATGGGAAAGCAGAATTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091858533 Original CRISPR ATGGGAAAGCAGAATTATGA GGG (reversed) Intronic
903614101 1:24639657-24639679 ATGGGAAACCAGAAGGTTGAAGG + Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906670512 1:47650863-47650885 ATGGGAAGGGAGATTTATGGTGG + Intergenic
907211039 1:52822178-52822200 ATGAGAAAGAAAAATTATGAAGG + Exonic
908990436 1:70081364-70081386 ATGCCAAAGCAGAAATAAGAAGG + Intronic
909228350 1:73054838-73054860 ATGAGAAAACAGAATTAAGCAGG - Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
912214286 1:107589759-107589781 ATGGGAATGCTGAATTAAAAGGG + Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914762428 1:150609968-150609990 ATGGAAGAGCAGAATTGTGGAGG - Intronic
915694638 1:157726990-157727012 ATGTGAAAGCAGAACAATCAGGG + Intergenic
916700042 1:167282698-167282720 AAGGGAAAGCAGTATTATGAGGG - Intronic
918381363 1:183958955-183958977 ATGAGAAAGCTGAATCTTGATGG - Intronic
918832934 1:189422076-189422098 ATAGGCAAGCAGAATGAAGAAGG - Intergenic
920529275 1:206690194-206690216 ATGGGCTTACAGAATTATGAGGG + Intronic
921445754 1:215245203-215245225 ATGACAAAGCTGAATTATAAAGG + Intergenic
921980732 1:221255740-221255762 ACGTGAAAGCAGAACTTTGAGGG - Intergenic
923300209 1:232633250-232633272 AGGAGAAAGAAGAATTTTGAGGG - Intergenic
924759727 1:246972348-246972370 AAGGAAAATCAGAATTATGGTGG - Intronic
1062991130 10:1819921-1819943 ATAGAAATGAAGAATTATGAAGG + Intergenic
1063912405 10:10844816-10844838 ATTTGAAATCAGAATTATCAGGG + Intergenic
1068112946 10:52702990-52703012 AAAGTAAAGCAGAATTTTGAGGG + Intergenic
1068800589 10:61135919-61135941 ATGAGACTTCAGAATTATGAGGG - Intergenic
1070462529 10:76684171-76684193 ATGGGAAAGCATAATTGTAGAGG - Intergenic
1070490774 10:76974416-76974438 ATGGTAAAGTAGAATGTTGAGGG + Intronic
1071487898 10:86114859-86114881 ATGGAAATGCAGGTTTATGATGG - Intronic
1072835943 10:98712039-98712061 AGGGGAAAGCAGGGTTGTGAGGG + Intronic
1074066090 10:110015087-110015109 ATGGGAAGGTAGAATTTTTAAGG + Intronic
1074365054 10:112851039-112851061 ATGTGAAAGCAGAGTTCGGAAGG - Intergenic
1075658617 10:124177789-124177811 AGGGGAAAGCAGAATGGAGAGGG - Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1080015662 11:27504195-27504217 ATGGGAAATCAGAATGGTGAAGG - Intronic
1080755985 11:35199418-35199440 AAGGAAAAGCAGAACTGTGATGG - Intronic
1080949349 11:37012296-37012318 GTGGGAAAGAATATTTATGATGG - Intergenic
1081092984 11:38896031-38896053 ATTGGAAAGCAGGACTTTGATGG + Intergenic
1081842095 11:46209917-46209939 AGGGGAAAGCAGCATTTGGAAGG + Intergenic
1084457226 11:69274891-69274913 ATGGGAAAGCAGCATTAGGGAGG + Intergenic
1084903644 11:72329178-72329200 TTGGGAAAACAGAATTAGAATGG + Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086993748 11:93333370-93333392 ATGGCAGAGCACACTTATGATGG - Intronic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1088222598 11:107585687-107585709 ATGTGAAATCAGAATTATTTAGG + Intergenic
1089333125 11:117703825-117703847 AGAGGAAAGAAGAATAATGACGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090932584 11:131311659-131311681 TTGGGAAAACAGTATTTTGATGG - Intergenic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1094029937 12:26000111-26000133 ACGGTAAAGAAGAATAATGAAGG + Intronic
1095563064 12:43588373-43588395 AAAGGAAAGGAGAATGATGAGGG + Intergenic
1096741826 12:53699105-53699127 ATGGGAAAGCACAATTAGTCGGG - Intergenic
1096766811 12:53897810-53897832 AGGAGAAAGCAGAATTACGAAGG + Intergenic
1097611929 12:61834031-61834053 AAGGAAAAGTAGAATTTTGATGG - Intronic
1098352366 12:69576977-69576999 ATGTGGAATAAGAATTATGATGG + Exonic
1098739150 12:74148873-74148895 AGAGGAAATCAGAAATATGAAGG - Intergenic
1098775542 12:74609625-74609647 ATGGTAAGGTAGAATTAGGATGG + Intergenic
1098905715 12:76160207-76160229 AGGGGAAAGCAGAATCCTGGAGG - Intergenic
1098976494 12:76907744-76907766 ATGGCAAAGGAGAATTAAGATGG + Intergenic
1100289682 12:93201933-93201955 ATGTGAAAGCAGTCTTAAGAAGG - Intergenic
1100592243 12:96040217-96040239 TTGGGAAAGAACAATTCTGAAGG + Intronic
1101220557 12:102634819-102634841 AAGGTAAAACAGAATCATGAAGG + Intergenic
1102591329 12:113958807-113958829 AGGCGACAGGAGAATTATGAGGG - Intronic
1105956730 13:25290251-25290273 ATAGGAAAGAAGAAAGATGAGGG - Intergenic
1106524904 13:30531965-30531987 TTTGGGAAGTAGAATTATGAAGG - Intronic
1107576461 13:41728585-41728607 AAGGGCAGGCAGAATTCTGAGGG + Intronic
1107719903 13:43237482-43237504 ATGGGATAGTAGAATCATTAGGG + Intronic
1109729191 13:66388161-66388183 ATTGGAAAACACAATTATTAAGG - Intronic
1110560837 13:76909364-76909386 GTGAGACAGCAGAATTATGAGGG - Intergenic
1111067209 13:83109115-83109137 ATTGGAAAGCACAATTTAGATGG - Intergenic
1111349082 13:87002361-87002383 AAGGGAATGCAGAGGTATGAAGG + Intergenic
1111494550 13:89031392-89031414 AAGCGAAAGAACAATTATGAAGG + Intergenic
1112151339 13:96767976-96767998 ATGGGAGAGCAAAAGTATAACGG - Intronic
1112429832 13:99341776-99341798 ATGAGAAATCAGAATGATCAAGG + Intronic
1112447089 13:99474028-99474050 ATGGCAAAGCAGAAGATTGATGG + Intergenic
1112683529 13:101795498-101795520 ATGGAAAAGCTGAATTTTTAAGG - Intronic
1113253043 13:108475615-108475637 AGGGGAAAGCAGAATCAAAACGG + Intergenic
1113454633 13:110439232-110439254 AAGAGAAAGCAGAATTTTGGTGG + Intronic
1114166354 14:20222671-20222693 ATGGAAAAGCAAGATAATGAAGG + Intergenic
1115305884 14:31933038-31933060 AAGGGAAAGGAGAATGATGGAGG - Intergenic
1115380922 14:32738077-32738099 ATAGGAATGCAGAATTATCAAGG + Intronic
1115449285 14:33527678-33527700 GTGGGAAAGCAGATTTCTGCGGG - Intronic
1115522560 14:34247365-34247387 CTCAGAAAACAGAATTATGAAGG - Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116401994 14:44518716-44518738 ATGGCAAAGCAGTACTAAGAAGG - Intergenic
1116913587 14:50498012-50498034 AAGGGAAAGTAGGATTCTGATGG + Intronic
1117406594 14:55410139-55410161 ATGGGAAAACAGATTTATGATGG + Intronic
1118540963 14:66824853-66824875 AAGTGATAGCAGAATTCTGATGG + Intronic
1119113770 14:71999414-71999436 AGGAGAAATCAGAAGTATGATGG + Intronic
1119127325 14:72139517-72139539 GTGGGAAAGCATAATTATTTTGG + Intronic
1120511948 14:85425928-85425950 ATAAGAATGCAGAGTTATGATGG + Intergenic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120601053 14:86510412-86510434 ATAAGAAAACAGAAGTATGAAGG - Intergenic
1120935342 14:89890515-89890537 TTTGGAAAGCAGAATTTAGAAGG + Intronic
1121958397 14:98236117-98236139 ATGGGAAATGTGAATTATGGGGG - Intergenic
1124791715 15:32733272-32733294 ATGCTAAGGCAGAATTTTGAGGG + Exonic
1125279748 15:38031123-38031145 AAGGGAAAGCAGAAAGATGGAGG - Intergenic
1125450263 15:39800455-39800477 AGGGAAAATCAGAATTATCAAGG + Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1127405690 15:58643011-58643033 ATAGGAAAGCATAAATATTAAGG + Intronic
1127812822 15:62579320-62579342 TTGGGAAAGATGAATTTTGAGGG + Intronic
1128033455 15:64502020-64502042 ATGGCAAAGCAACATTATTAAGG - Intronic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128706121 15:69838466-69838488 TTGGGGCAGCAGAATTGTGAGGG - Intergenic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1128988950 15:72242351-72242373 ATGGGAAAGAAGAATTTTCTGGG - Intronic
1129146727 15:73654815-73654837 ATGGGAAAGTAAATATATGAGGG - Intergenic
1130520774 15:84659004-84659026 ATGGGAATGCAGAATGATGGAGG + Intergenic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG + Intronic
1135050985 16:19192896-19192918 GTGGGAAATCAGAATTAGGGAGG - Intronic
1135352132 16:21738117-21738139 ATGTGAAAAGAGAATCATGAAGG + Intronic
1135450622 16:22554240-22554262 ATGTGAAAAGAGAATCATGAAGG + Intergenic
1135621691 16:23961404-23961426 AGAGGAAAGCTGAATCATGATGG - Intronic
1136412953 16:30087473-30087495 ATGCAAAAGCAGAACTGTGACGG - Intronic
1138359563 16:56416192-56416214 GTGGGAAATCAGAAAAATGAGGG + Intronic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139395675 16:66636992-66637014 CTGGGAGAGCAGAATTCTGATGG + Intronic
1139401144 16:66682452-66682474 ATGGGAAACCACAAAAATGAAGG + Intronic
1140302301 16:73770073-73770095 ATGGCAAAGGAGAATTAAGGTGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143525355 17:7468748-7468770 ATGGGAAAGAAGATTTTTCAGGG - Intronic
1143941395 17:10545882-10545904 ATGTGATAGCAGAATCCTGAGGG + Intronic
1146593602 17:34150758-34150780 ATGGTAAAGCTGGATTTTGAAGG + Intronic
1149147130 17:53507669-53507691 ATGTGAAAGCAGTACTAAGAGGG + Intergenic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1152231551 17:79116543-79116565 ATTGGAAAGCAGAAGTGAGAGGG + Intronic
1152939478 17:83160665-83160687 AGGTGAAAGCAGACATATGAGGG - Intergenic
1154956497 18:21262493-21262515 TTGGGAAAGCAGAAGTGTAACGG - Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1160456093 18:79001754-79001776 ATGGGAAAGCAGATTTTACATGG - Intronic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1162163243 19:8734616-8734638 AAGAGAAAGCAGATTGATGATGG + Intergenic
1163899243 19:20087137-20087159 ATGAGAAATGAGCATTATGAAGG - Intronic
1164010145 19:21194919-21194941 GTGAGAAAGCAGAGTTATCAGGG + Exonic
1164035592 19:21451332-21451354 GTGGGAAAGCAGAGTTACCAGGG - Intronic
1164878398 19:31709809-31709831 ATGGGACAGCAGAATTCTGGAGG - Intergenic
1165951631 19:39476806-39476828 ATGGGAAAACAGATTTAGGTAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1168351318 19:55677768-55677790 ATGGGAAAGAAGGCTGATGAAGG - Intronic
925539270 2:4949333-4949355 ATGGGAAGAGAGGATTATGAAGG - Intergenic
925617812 2:5760365-5760387 ATGGGAAAGCCAAAGTAGGAAGG - Intergenic
929495669 2:42440254-42440276 AAGGGAATGCACATTTATGAAGG + Intergenic
930126086 2:47797993-47798015 CAGGGAAAGCAGCATTATGAAGG - Intronic
930175277 2:48295059-48295081 AAGGGAAAGAAGAAAAATGAAGG - Intergenic
930530534 2:52582878-52582900 ATGAGGAATAAGAATTATGAAGG - Intergenic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931162134 2:59703911-59703933 ATGGGACATGAGATTTATGAGGG - Intergenic
931482563 2:62656611-62656633 TTGGGAAGGAAGAATTCTGAAGG + Intergenic
932143888 2:69302263-69302285 ATGGCAAAGCAGAATACAGAAGG + Intergenic
932911351 2:75809502-75809524 ATGGGAAAAAAGATCTATGAAGG - Intergenic
933101620 2:78266361-78266383 ATGGCATAGCAGAATTATTTGGG + Intergenic
933113774 2:78439767-78439789 ATAGGAAAACAGAATTATTAAGG + Intergenic
933129355 2:78653863-78653885 ATTAGAAACCAAAATTATGATGG + Intergenic
933633347 2:84680907-84680929 ATGGGGAAGCTGAAGTGTGAGGG + Intronic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934844613 2:97654868-97654890 AAGGGAAAGCAGAATTTGCACGG - Intergenic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936369917 2:111895283-111895305 ATGGGATAGAAGATTTCTGAGGG + Intergenic
936811071 2:116402924-116402946 ATGAGAAAGGAAATTTATGAAGG + Intergenic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
937382826 2:121396245-121396267 ATGGGAAAGGAGAATTAGTGGGG + Intronic
937822753 2:126329387-126329409 AAGGGCAGGAAGAATTATGATGG + Intergenic
938635018 2:133214545-133214567 AAGTGAAAGCAGAATTATAAGGG - Intronic
938640543 2:133273626-133273648 ATGGGAAAGGAAAATTAAGGAGG + Intronic
939207760 2:139129561-139129583 AAGAGAAAGCAGAATTATTCTGG - Intergenic
940436086 2:153656944-153656966 ATGGGAAAGAAAAATTAAGAAGG + Intergenic
940526804 2:154826041-154826063 ATGGGAGAGAAGTATTATCAAGG - Intronic
941389778 2:164897467-164897489 AGGGGAAAGCAGGATTGTTAGGG - Intronic
942117217 2:172739765-172739787 TTGGTAAAGGAGTATTATGAAGG + Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942864520 2:180657078-180657100 CTGGGATAGGAGAAATATGAAGG + Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
944356941 2:198801502-198801524 TGGGAAAAGCAGAATTATAAAGG - Intergenic
945522752 2:210848502-210848524 ATAGGAAATTAGAATTGTGAAGG - Intergenic
946768321 2:223060869-223060891 ATGGGAGAGGAGAATTAAAAAGG - Intronic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
947220515 2:227787492-227787514 ATAGGAAAGAAGAGTAATGATGG - Intergenic
947745477 2:232505078-232505100 AAGGGAAGGCAGAACCATGATGG + Intergenic
948278808 2:236730721-236730743 ATGGGAAGGAAGAATTGTCAAGG - Intergenic
1171492848 20:25533252-25533274 GTGGGAGAGGAGAATAATGAAGG + Intronic
1172856207 20:38004822-38004844 ATGGCAAATCTGGATTATGAGGG + Intronic
1173190579 20:40872663-40872685 ATGGGAAAACAGACTTCTGGAGG - Intergenic
1173432459 20:43001283-43001305 ATGAGTAAGCAGTAATATGAAGG + Intronic
1174875913 20:54226252-54226274 ATTAGAGAGCAGAATAATGATGG + Intronic
1177138665 21:17334104-17334126 ATGGGAAAGCGGGGGTATGAGGG - Intergenic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1179327793 21:40366341-40366363 ATGGGAAATCAAAAATATTAAGG - Intronic
1181851329 22:25752020-25752042 ATGGGAAAGCATGTTTATCATGG - Intronic
1182043121 22:27253801-27253823 ATGGAAAAGCAGAAATGTGGTGG + Intergenic
1182065506 22:27428716-27428738 AGGTGACAGCAGAATAATGATGG - Intergenic
1182409013 22:30166024-30166046 ATGAAAAAGAAGAATAATGAGGG - Intronic
1184932881 22:47694084-47694106 AAGGGCAAACAGAATTATCATGG + Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949674770 3:6440718-6440740 ATATGAAAGCAGATTTATTAGGG - Intergenic
950858180 3:16125016-16125038 AGGGGGAGGCAGAAATATGATGG + Intergenic
951403648 3:22266548-22266570 ATGAGAAAGCACAATTAGAAAGG + Intronic
955885398 3:63592488-63592510 ATGGGAATGCTGAATTAAAAGGG + Intronic
957021266 3:75130429-75130451 ATGAGAAAGCACAAAAATGAAGG + Intergenic
958168249 3:89905366-89905388 ATGGGAAAGCAGTATCCTCAAGG + Intergenic
958915131 3:100041289-100041311 TTAGAAAAGCAAAATTATGATGG + Intronic
959272772 3:104234798-104234820 ATGGGATAGCTGTATTATGTAGG + Intergenic
959349215 3:105239441-105239463 AAGGGTAAGCAAAATTTTGAAGG - Intergenic
960072590 3:113447878-113447900 ATTGGAAAAGAGAATTTTGAGGG - Intronic
960189404 3:114685070-114685092 ATGGGAAAACAGAATGATGTAGG - Intronic
961970622 3:130961543-130961565 ATAAGAAAGCAGAAAAATGATGG + Intronic
962183221 3:133230573-133230595 ATGGGAGAGGAGACATATGAAGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962792030 3:138820286-138820308 ATGTGAAAGGTGAATTATGTAGG - Intronic
963535117 3:146518143-146518165 ATGGCCAAGCCTAATTATGAAGG - Intronic
965217869 3:165887428-165887450 TTGGGAAAACAGCATTATAATGG - Intergenic
966272375 3:178122640-178122662 TGGGAAAAGCTGAATTATGAAGG + Intergenic
967275176 3:187767397-187767419 ATATGAAAGCTGAATGATGAAGG + Intergenic
967385776 3:188909432-188909454 ATGGGAAAGCTGAGTTACCAAGG - Intergenic
967457774 3:189709390-189709412 ATAGGACAACAGAATGATGAAGG - Intronic
968179987 3:196587208-196587230 ATAGGAAAGAAGAAATATTAAGG + Exonic
968245087 3:197136973-197136995 GTAGGTAAGCATAATTATGATGG - Intronic
970765300 4:19541144-19541166 ATGGTAAAGCAGAATTCAGAAGG - Intergenic
970839791 4:20454049-20454071 AAGGGGAAGCACAGTTATGAAGG - Intronic
972155643 4:36157771-36157793 ATCCTAAAGCAGAATTATGTTGG - Intronic
973530398 4:51831948-51831970 ATGGGAAAGCAGACTGTTGTTGG + Intergenic
974183080 4:58408704-58408726 TTTAGAAAGCAGAATTATCAAGG - Intergenic
974372323 4:61033463-61033485 ATGTGAAAGGAGATTTATTATGG + Intergenic
975285808 4:72618136-72618158 CAGGGAAAGCAAAATTAAGAGGG + Intergenic
975519269 4:75281111-75281133 ATGAGAAAGCAGTATTGTAATGG - Intergenic
976357486 4:84136205-84136227 AGGGGAAAGCAGATTTTTGGTGG - Intergenic
976822765 4:89225557-89225579 ATGGGAGAACAGAATTTGGAGGG + Intergenic
978659324 4:111104783-111104805 ATGGGAAATAAGAATTATAAAGG + Intergenic
979572353 4:122242787-122242809 ATGGCAAAGCAGGGTTGTGAGGG - Intronic
982308814 4:153962572-153962594 ATGTGAAACCAGAATTGTGAAGG + Intergenic
982418620 4:155166753-155166775 ATTAGAAATCAGAATTGTGATGG - Intergenic
982627885 4:157790794-157790816 AAGGGAAAGGAGAAATAAGAAGG - Intergenic
982793887 4:159623051-159623073 ATGGAAAAGCTGAAGTATTAGGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984406251 4:179334907-179334929 ATGGGGAAGCTGAATAATGCTGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
986884798 5:12220109-12220131 ATGGGAATGCAGACTTTTGGGGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
991575451 5:68098785-68098807 CTGGGACAGCAGAGTTTTGATGG - Intergenic
992702002 5:79350295-79350317 ATGTGAAAGCAGAATCAAAATGG - Intergenic
993362223 5:86991677-86991699 ACTGGAAAGGAGAATGATGAGGG - Intergenic
994824635 5:104698084-104698106 AATGGAAAGGTGAATTATGAGGG - Intergenic
995274547 5:110263117-110263139 ATAGGAAAGAAGAATCATGGGGG + Intergenic
995378434 5:111504672-111504694 ATGAGAGAGCAGATTTATGGTGG - Intronic
998002418 5:138635543-138635565 AAGAGAAGGAAGAATTATGAGGG - Intronic
1000190745 5:158908443-158908465 ATGGGAAAGGAAAAAGATGAGGG - Intronic
1001656764 5:173356631-173356653 ATGGGAAAACACAAGTATGTTGG + Intergenic
1003009305 6:2411265-2411287 CTGGGACAGCACAATTCTGATGG - Intergenic
1004995059 6:21183152-21183174 ATTGGAAAGACGAATTATGCTGG - Intronic
1005676189 6:28157811-28157833 AAGGGAAAGTAGAATTGTGGAGG + Exonic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008307516 6:49921837-49921859 ATGAGAAAAGAGAATCATGAGGG + Intergenic
1008465249 6:51822868-51822890 ATGGGAAAGCAGAATTGATAGGG - Intronic
1008594168 6:53024710-53024732 ATGGGAAAACTGAATCATGGTGG + Intronic
1008793952 6:55277068-55277090 TTGGGAAAGGAGAATGATAAAGG - Intronic
1009809199 6:68639223-68639245 ATGGGAGAACAGAATCATGTGGG + Exonic
1010510956 6:76718958-76718980 GTGAGAGAGCAGAGTTATGAAGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1014311739 6:119812293-119812315 ATGGAAAAGCAGATTTATCATGG - Intergenic
1014833858 6:126135293-126135315 ATGAGAAAGGAACATTATGATGG + Intergenic
1015725381 6:136294160-136294182 ATGGGGCAACAGAATCATGATGG + Intergenic
1015778426 6:136838753-136838775 ATGGGACAGAAGAAACATGATGG + Intronic
1015890802 6:137967948-137967970 CTGGGACAGCAGATTAATGATGG - Intergenic
1016745016 6:147570133-147570155 ATGGGAAATCAGAGTTCTAACGG + Intronic
1017644323 6:156525102-156525124 ATGAGAAAGCAGAATCAGGGAGG - Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018831984 6:167450248-167450270 ATGGGTAAGCAGAATGTTAATGG - Intergenic
1018965716 6:168487205-168487227 AGGGGAAAGTAGAATTTTAAGGG - Intronic
1020007247 7:4789376-4789398 ATGGGGATGCTGAATTATCAGGG - Intronic
1020542538 7:9477194-9477216 ATGGGAAGGCAGACTTAGAAAGG - Intergenic
1022237565 7:28476915-28476937 GTGGAAAAGCAGAATTTTAATGG - Intronic
1022749421 7:33208166-33208188 ATGGCAAAAAAGAATTATGTAGG - Intronic
1022774642 7:33513290-33513312 ATGGGAAGCCAGAATAAAGAGGG - Intronic
1023545427 7:41313295-41313317 ATGGGAAGGGAGAAGTATGGTGG - Intergenic
1023561746 7:41481262-41481284 GTGGGAGAGCAGAAATATTATGG - Intergenic
1024426261 7:49229857-49229879 ATGGGAACCCAGAATCATCAGGG + Intergenic
1025796739 7:64745083-64745105 ATTGGAAAGCAGAGGTATCAGGG - Intergenic
1026634590 7:72070222-72070244 TTGGGAATGCAGAATCATTATGG + Intronic
1027504452 7:78998085-78998107 AAGGGACATCAGAGTTATGATGG + Intronic
1027560413 7:79721711-79721733 ATGGGAAAGAAGAGAGATGAGGG - Intergenic
1030804993 7:113906007-113906029 ATAGAAAAGTAAAATTATGATGG + Intronic
1030867502 7:114717483-114717505 ATGGGAAAAAAAAATTCTGAGGG + Intergenic
1032071281 7:128808811-128808833 ATGGGAAAGGAGAAGCATGCTGG + Intronic
1033202836 7:139388722-139388744 ATGGGAAAACTGATCTATGAGGG - Intronic
1035700470 8:1635268-1635290 CTGGGAAAACAAAATTATGGAGG + Intronic
1036738715 8:11342236-11342258 ATGGGAAAGGTGAATTATTAGGG + Intergenic
1037051820 8:14383371-14383393 ATGGGAAAGAAGTCTAATGATGG + Intronic
1037933245 8:22896725-22896747 ATGATAAGGCAGAATTTTGAAGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038623402 8:29166928-29166950 ATGGAAAAGCTAGATTATGAAGG + Intronic
1038902487 8:31859333-31859355 ATGGAAAAACAAGATTATGATGG - Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039170283 8:34737672-34737694 ATGGGTAAGCAAAATTTTAATGG - Intergenic
1040670226 8:49680760-49680782 ATGGGGAAGTAGAATTAACAGGG + Intergenic
1042009907 8:64231550-64231572 ATGGGATAGCAGAAAGATCATGG - Intergenic
1042148165 8:65754389-65754411 ATGGGAAAGGAGGTATATGATGG - Intronic
1042805604 8:72767808-72767830 GTGGGAATGCAAAATTATGCAGG - Intronic
1043045046 8:75312663-75312685 ATTGGAAGGCAGAATTTTGCAGG - Intergenic
1043143057 8:76615393-76615415 ATTGAAAAGGAGAATTCTGAAGG - Intergenic
1044218062 8:89636102-89636124 AGGGGAAGGCAGAATTAGGTAGG - Intergenic
1045008860 8:97939986-97940008 ATAGCAAAGGAGAATTATGGTGG - Intronic
1047031199 8:120883122-120883144 AAGGGAAAGCAGACTAAAGATGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1050125865 9:2355742-2355764 GCGGGAAAACAGAATAATGAAGG + Intergenic
1050264790 9:3878874-3878896 ATTGGGAAACAGAAGTATGAAGG + Intronic
1050350644 9:4738667-4738689 GTGGCAAGGCAGAATTATGAGGG + Intronic
1050375706 9:4970673-4970695 ATGGGAGAGAAGAATTCTCATGG + Intergenic
1050797718 9:9565482-9565504 ATCTGAATGCAGAATGATGATGG + Intronic
1054676906 9:67864817-67864839 ATTGAAAAGGAGAATTTTGAAGG - Intronic
1055126806 9:72728265-72728287 ATGGGAAAGCAAATATATGGGGG + Intronic
1055257990 9:74395483-74395505 ATGGGAAAGTATACTCATGATGG - Intergenic
1057781994 9:98057322-98057344 ATGTCAGAGAAGAATTATGACGG - Intronic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058168781 9:101652901-101652923 ATGTGAAAACAGGATTATAATGG - Intronic
1058358592 9:104113454-104113476 ATGAAAAAGCTAAATTATGAAGG + Exonic
1058495324 9:105553291-105553313 ATGTGATAACAGAATTTTGAAGG + Intergenic
1059029614 9:110677069-110677091 CTGAGAAAGCAGATTTATGTGGG - Intronic
1059229825 9:112709377-112709399 ATGGGAAAACAGAATGAATAAGG + Intronic
1059715940 9:116913395-116913417 ATGAGAAAACAGAATTAATAAGG - Intronic
1060622159 9:125077158-125077180 GTAGGAAAGCAGAATTGTGACGG - Intronic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1186270490 X:7881511-7881533 ATGGGAAAACAGAGTGATCAAGG - Intergenic
1189602095 X:42637901-42637923 TTGGGAAAAAAAAATTATGATGG + Intergenic
1189963080 X:46343855-46343877 AGGAGAAAGCAGAATTCTTAGGG + Intergenic
1189973716 X:46442333-46442355 ATGGGCAAGCAGATTTCTGAAGG + Intergenic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190789102 X:53683252-53683274 ATGGGACGACAGAATTAGGAGGG + Intronic
1191165100 X:57381463-57381485 TTGGGAAAGAAGAATAATAAGGG + Intronic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1195033254 X:100947146-100947168 ATGGGAAAGCTAAATTAGGTTGG - Intergenic
1195742050 X:108074768-108074790 ATGGGAAAGCTGAAGCATGACGG + Intronic
1196145394 X:112311260-112311282 ATTGGAAAAGAGAATTATCAAGG - Intergenic
1196482478 X:116165661-116165683 ACGGGAAAGCAGAATTTTTACGG - Intergenic
1196628370 X:117905436-117905458 AAAGGAAAGCAGCATTTTGAAGG + Intronic
1198112773 X:133516255-133516277 ATGGGAAAGCAGAACACAGAGGG - Intergenic
1198429040 X:136547459-136547481 TTGCAAAAGCAGAATTCTGAGGG - Intronic
1200975988 Y:9212658-9212680 ATGGAAAAGCAGCAGTATGGTGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic