ID: 1091859350

View in Genome Browser
Species Human (GRCh38)
Location 12:3765448-3765470
Sequence GAGGAAAGCAAGGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 404}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091859345_1091859350 -1 Left 1091859345 12:3765426-3765448 CCCAATGACAACAGGACAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 202
Right 1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG 0: 1
1: 0
2: 3
3: 44
4: 404
1091859347_1091859350 -2 Left 1091859347 12:3765427-3765449 CCAATGACAACAGGACAGAGGGA 0: 1
1: 0
2: 1
3: 29
4: 1083
Right 1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG 0: 1
1: 0
2: 3
3: 44
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091859350 Original CRISPR GAGGAAAGCAAGGATGCTGC AGG Intergenic
900418059 1:2544044-2544066 GGGGACAGCCAGGAGGCTGCGGG - Intergenic
900612334 1:3549429-3549451 GAGGAAAGAGAGGCTTCTGCTGG - Intronic
901012581 1:6209938-6209960 GAGGAAAGCGCTGCTGCTGCAGG + Exonic
901421127 1:9151860-9151882 GAGGAAAGAAAGGATGCAGGAGG + Intergenic
903705819 1:25284995-25285017 CAGGAAAGAAAGGATGCAGGAGG - Intronic
903721419 1:25408424-25408446 CAGGAAAGAAAGGATGCAGGAGG + Intronic
903906942 1:26694453-26694475 GAGGAAGAAAAGGCTGCTGCTGG + Intergenic
903978263 1:27166338-27166360 GAGGAAAGCCAGAAGGTTGCGGG - Intronic
905513503 1:38543128-38543150 GAGCAAAGCAATATTGCTGCAGG - Intergenic
905734714 1:40317153-40317175 GAGGAGAACAAGGAGGCTGCGGG + Exonic
906071209 1:43017980-43018002 GAGGAAACCAATGAAGCTGATGG + Intergenic
906105230 1:43287545-43287567 GAGGAAAGAAAGGATTATCCTGG + Intergenic
907490497 1:54806120-54806142 AGGGAAAGCCAGGATGCCGCCGG + Exonic
907993238 1:59603548-59603570 GAGGAATGCATGAATGCTGGGGG - Intronic
911634357 1:100217620-100217642 GAGAAAAGTAAGGTTGCTGTGGG - Intronic
912321646 1:108719491-108719513 AAGCAAAGCAAGGTTTCTGCAGG + Intronic
913614316 1:120541987-120542009 GTGAAAGGAAAGGATGCTGCAGG - Intergenic
914318412 1:146535776-146535798 GAGGAAAGCAATGCTGTTGTAGG + Intergenic
914374023 1:147056494-147056516 GCGAAAGGAAAGGATGCTGCAGG - Intergenic
914495948 1:148197581-148197603 GAGGAAAGCAATGCTGTTGTAGG - Intergenic
914575953 1:148968913-148968935 GCGAAAGGAAAGGATGCTGCAGG + Exonic
915325830 1:155080760-155080782 GAGGACAGAAAGGAGGCTCCCGG - Intronic
917021327 1:170591263-170591285 GAGGAAACTAGGGCTGCTGCTGG + Intergenic
919139730 1:193555962-193555984 GAGGAAGCCAAGAATCCTGCTGG + Intergenic
920880679 1:209877594-209877616 TAGGAAAGCAAGGGTACTGAGGG - Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
922925320 1:229342746-229342768 GCGGAAGGCAGGGAGGCTGCGGG + Intronic
923021345 1:230166694-230166716 GAAGAAAGCAAGGAAGTTGGGGG - Intronic
923036420 1:230287942-230287964 AAGGAAAGGAAGGAAGGTGCGGG + Intergenic
924570399 1:245232844-245232866 GAGGAAAGGAAGGAAACCGCCGG - Intronic
1062923518 10:1297612-1297634 GAGGAGGGCAAGGGAGCTGCTGG - Intronic
1063910647 10:10826257-10826279 GAGGAAATCAAGGATCATGGAGG + Intergenic
1064723474 10:18253463-18253485 GAGGAAATCAAAATTGCTGCTGG + Intronic
1065340864 10:24703799-24703821 GCAGTAATCAAGGATGCTGCCGG - Intronic
1065746115 10:28844151-28844173 GAGGAAAGGAAGGAGCCTGGAGG + Intergenic
1065916756 10:30359552-30359574 GGGGAAAGGAAGGATGGTGGGGG - Intronic
1066307176 10:34156746-34156768 GAGAAGAGCATGGAAGCTGCAGG - Intronic
1066442303 10:35450121-35450143 GAAGAAAGCAAGGATGTAGCAGG + Intronic
1067070025 10:43124417-43124439 CAGGCAAGCAAGGACGGTGCAGG + Intronic
1067345415 10:45434658-45434680 AATGAATGCAAGGATGCAGCAGG + Intronic
1067741076 10:48896629-48896651 GAGGAAGGCAAAGAGGCCGCTGG - Intronic
1068572977 10:58651394-58651416 GATGGAAGCACAGATGCTGCTGG - Intronic
1068580228 10:58730921-58730943 GAGGAATTCAAGCAGGCTGCAGG - Intronic
1069279503 10:66637579-66637601 GAGCAAAGCCAGAATGCTGTGGG - Intronic
1069865517 10:71500494-71500516 GAGGAAAGCCAGGGTGCTAGAGG + Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070797423 10:79224724-79224746 GGGGAAGGCCAGGCTGCTGCAGG + Intronic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071778853 10:88819810-88819832 GAGAAAAGCAAGGAATCTGCTGG - Intronic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072272297 10:93788421-93788443 GAGATAATCAAGGATGGTGCAGG - Intronic
1072805072 10:98418959-98418981 GAGGAAAGCTGGGAGCCTGCAGG + Intronic
1073304530 10:102492586-102492608 GAGGGAAGCAGGCATGTTGCTGG - Intronic
1073420210 10:103418498-103418520 GAGGAAAGCACGGATGTTGTGGG - Exonic
1073490268 10:103848627-103848649 GAGAAAAGCAAAGGTGCTGGAGG - Intronic
1073642138 10:105263606-105263628 GAGTAAAGCGAGGAGGCTGTGGG - Exonic
1074024186 10:109616596-109616618 GAGGAGAGGAAGGAAACTGCAGG + Intergenic
1074563882 10:114559072-114559094 CTGGAAAGCAATGATGCTCCAGG - Intronic
1074637168 10:115333100-115333122 GAGGAAAGCCAATATTCTGCTGG - Intronic
1076532743 10:131155574-131155596 GAGGAAAGCTGGGACACTGCTGG - Intronic
1076681684 10:132175464-132175486 TGGGAAAGCAGGGATGCTGGTGG + Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077010487 11:377107-377129 GAGGACAGCGAGGAGGCCGCGGG + Exonic
1077411977 11:2407913-2407935 CTGGAAAGCAAGGGTGCTGTGGG + Intronic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1079225813 11:18603781-18603803 GAAGTAAGCAAGGATGATCCTGG + Intergenic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1079702419 11:23565274-23565296 GAAGAAAGCAGGGATACTACTGG + Intergenic
1080407319 11:31990965-31990987 GAGGAAGGCAGAGATACTGCAGG + Intronic
1081242099 11:40719550-40719572 GAGGAAAGCAAAGCTGCTTTTGG + Intronic
1081384079 11:42450064-42450086 GAGGAAATTAAGGTTGCTGATGG + Intergenic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1083275048 11:61592166-61592188 GAGGAAAGCAAGGGGGCTTGTGG + Intergenic
1083407084 11:62465001-62465023 GAGGAAAGCCAGGAGGATGTGGG - Intronic
1084296743 11:68216943-68216965 GTGGAAAGCAAGAATGGTGCCGG - Intergenic
1084318443 11:68359470-68359492 GAGGATAGAAAGGCTGCAGCTGG + Intronic
1084671269 11:70607917-70607939 CAGGAACGCAAGGATGGAGCTGG - Intronic
1085126514 11:74006012-74006034 GTGGACATCAAGGAAGCTGCAGG - Intronic
1087635006 11:100692095-100692117 AAGGATAGCCAAGATGCTGCAGG - Intronic
1088043953 11:105424642-105424664 CATGAAAGCAAGAATCCTGCAGG - Intergenic
1088176895 11:107063239-107063261 GAGGAAAGCAAGGATGGACATGG - Intergenic
1089312966 11:117572227-117572249 GAGGAAGGCAAGAATGTTACAGG - Intronic
1089525106 11:119092137-119092159 GAGGAATGCATGTATGCTGTGGG + Exonic
1090056568 11:123429799-123429821 GAGGAAAGCAAGGTTGCTGGAGG - Intergenic
1090185847 11:124738727-124738749 GAGGAAAGGATGGCTCCTGCTGG - Intergenic
1090231674 11:125111514-125111536 GAGGAAAGCGGGGCGGCTGCGGG - Intronic
1091301190 11:134509364-134509386 AAGGAAAGCAATGATGCTCATGG - Intergenic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092018983 12:5184705-5184727 GAGGAAATCAAGGAAGATACAGG - Intergenic
1093069143 12:14690374-14690396 GATGAAAGCAAGGGTCTTGCTGG + Intronic
1093168950 12:15837489-15837511 GAAGAAACCAAGGATGATCCGGG - Intronic
1093253213 12:16833803-16833825 GAGCAAAGCAAAAATGCTGATGG - Intergenic
1095223537 12:39650352-39650374 CAGGTAAGCAAAGATGCTGAAGG + Exonic
1095977833 12:47951938-47951960 GAGGAAAGCAAGGAGTGAGCAGG + Intergenic
1097629510 12:62042891-62042913 GAGGAAAGGCAGGGTGCTGACGG - Intronic
1098587830 12:72175553-72175575 GGGAAAGGCAAGGATGCAGCCGG - Intronic
1098974915 12:76892483-76892505 GAGGAAAGCCAGGAAGATCCTGG + Intergenic
1099438817 12:82675721-82675743 GAGGAAAGCAATGATTCAACAGG + Intergenic
1099606374 12:84806849-84806871 GAGGAAATCCAGGAAGCTGGTGG + Intergenic
1100025353 12:90121787-90121809 GAGGAATGCACAGATGCTGGTGG + Intergenic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1101734664 12:107454009-107454031 GGGGAAATCAAGAATGCAGCTGG + Intronic
1101882930 12:108638351-108638373 GAGGAAAGCAAGAGTCTTGCTGG + Intergenic
1102695933 12:114799580-114799602 GAGGAAACCACGCATGGTGCAGG + Intergenic
1103464222 12:121129006-121129028 GAGGAAAGAAAGGAAGATGGCGG - Intergenic
1103566660 12:121819577-121819599 GAGGAAAGCATGGCTTCTGCAGG + Exonic
1103995531 12:124827633-124827655 CAGGATAGCAAGGAGGCTGTGGG - Intronic
1104412941 12:128574439-128574461 GAGGAAACCAAGGCTGGAGCAGG + Intronic
1105276530 13:18933552-18933574 GAGGACAGGAAGGATCCAGCAGG - Intergenic
1105806611 13:23955183-23955205 GAGGAAAGGGAGGATGGTGAGGG + Intergenic
1106372897 13:29153718-29153740 GAGGAAAAGAAGGATGCAGGAGG - Intronic
1107946433 13:45420977-45420999 GAGGAACCCAAGGTTACTGCAGG - Intergenic
1111276164 13:85950209-85950231 GAGTAAAATAAGGAGGCTGCAGG - Intergenic
1111904201 13:94236836-94236858 GGGGAAAGCAAGGATGTTAGAGG - Intronic
1112422861 13:99268805-99268827 CAGGGAAACAAGGATGTTGCTGG + Intronic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1113365320 13:109670290-109670312 GAGAAAGGCAAGATTGCTGCTGG - Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1114542780 14:23474801-23474823 GAAGAGGCCAAGGATGCTGCTGG + Intronic
1116767723 14:49092490-49092512 GTGGACAGAAAGGATGCTGTTGG - Intergenic
1117462112 14:55955580-55955602 GTGGAAAGCCAGGGTGCTGGTGG + Intergenic
1118278884 14:64410801-64410823 AAACTAAGCAAGGATGCTGCAGG - Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119194450 14:72706668-72706690 TAGGAAAGCAAGGAGCCTGATGG - Intronic
1119658758 14:76436030-76436052 GAGGGAAGCAAAGAAGATGCTGG - Intronic
1119940384 14:78634274-78634296 GTGGAAAGCAACGATGGGGCAGG + Intronic
1120843266 14:89105280-89105302 GAGGAAAGCAAGGGAGCTGTGGG - Intergenic
1121140377 14:91536565-91536587 GAGCAAAGAATGGATGTTGCAGG - Intergenic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121692205 14:95885993-95886015 AAGGAAAGCAAGGTAGCCGCTGG + Intergenic
1122394515 14:101413988-101414010 GAGGAATGCAGGGATGCCACTGG - Intergenic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122594240 14:102878454-102878476 GAGGAAAGCAGAGATGTTGGGGG + Intronic
1122775150 14:104113732-104113754 GAGGACAGCAAGGATGCCAGCGG - Exonic
1123065732 14:105618316-105618338 AAGGAAACCCAGGATGGTGCCGG - Intergenic
1123199845 14:106652056-106652078 GAGGAAAGCACAGATCCTGAAGG + Intergenic
1123406576 15:20023013-20023035 GAGGCATGCAAGATTGCTGCAGG - Intergenic
1123515906 15:21029661-21029683 GAGGCATGCAAGATTGCTGCAGG - Intergenic
1123774633 15:23566263-23566285 AAGGAAAGGGAGGATGCAGCCGG - Exonic
1124840917 15:33241347-33241369 GAGGAAAGCCTGAATGCTGTTGG + Intergenic
1124992621 15:34691102-34691124 CAAGAAAGCAGGGAGGCTGCTGG - Intergenic
1126672802 15:51131910-51131932 GAGGAAAGCAGTGATGCTTGAGG + Intergenic
1127697876 15:61469622-61469644 GAGGAAAGCATGGATTCTAGGGG - Intergenic
1127915736 15:63453400-63453422 CAGGAAAGCAGGAAGGCTGCAGG - Intergenic
1127958498 15:63873263-63873285 GAAGGAAGCAAGGAAGCTGTGGG - Intergenic
1128080760 15:64855525-64855547 GAGGAAAGCTGGGGGGCTGCAGG - Intronic
1128419599 15:67479014-67479036 AAATAAAGCAAGGATACTGCTGG - Intronic
1128649563 15:69400714-69400736 GAGGAAAGAAAGGATGAAGATGG + Intronic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1129517616 15:76166214-76166236 GGGGAGGGGAAGGATGCTGCGGG + Intronic
1130119559 15:81035813-81035835 GAGGAAAGAATGGAGGATGCTGG - Intronic
1130577674 15:85106749-85106771 GATGAAAGGCAGGCTGCTGCAGG + Intronic
1131073795 15:89482297-89482319 AAGGAAGGCAAGAATGCAGCCGG + Intronic
1131147676 15:90024702-90024724 GAAGAAAGCAAGGATGGAGGTGG - Intronic
1132051535 15:98611634-98611656 CAGGAAATCAAGGATGCAGTTGG - Intergenic
1132355692 15:101169752-101169774 GTGGAAACCAAGCATGCTTCAGG + Intergenic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1135164245 16:20124696-20124718 GAGGAAAGAGAAGATGCGGCAGG - Intergenic
1135608350 16:23842239-23842261 GAGGAGACCAAAGTTGCTGCTGG - Intronic
1137701502 16:50501214-50501236 GAGGAAGGAAAGGATTCTGCAGG + Intergenic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1138130171 16:54472642-54472664 GAGAAAAGCAAGGAAGGTCCTGG + Intergenic
1139083951 16:63561527-63561549 GAGGAATTCAAGCAGGCTGCAGG - Intergenic
1140031589 16:71343629-71343651 GATGAAAGAAACAATGCTGCAGG - Intergenic
1140469701 16:75207130-75207152 GAGGAAAGCCATGGTGCCGCTGG + Exonic
1141075476 16:81002957-81002979 GGGGAAAGCAAGGAATCTGTTGG - Intronic
1141477750 16:84284950-84284972 GAGGATAGGAAGGATGAGGCAGG - Intergenic
1142065335 16:88059199-88059221 GAGGAGAGTAGGGATGCTCCTGG + Intronic
1143243734 17:5465934-5465956 GAGGAAGGCTAAGAGGCTGCAGG - Intronic
1143433015 17:6900676-6900698 GAGGAAGGCTGGGATGCAGCTGG - Intronic
1143639377 17:8187038-8187060 GAGGAAAGGATGGATGCAGCTGG - Intergenic
1143684014 17:8499269-8499291 GGAGAAAGCAAGTAAGCTGCAGG - Exonic
1144009619 17:11134247-11134269 GATGAAAGCCAGGGTGCTGCTGG + Intergenic
1144538581 17:16115391-16115413 GAGGAATTCAAGCCTGCTGCAGG - Intronic
1145070922 17:19807048-19807070 CAGGAAAGCAAGGGTTCAGCTGG + Intronic
1145288164 17:21522002-21522024 CAGGAAAGCCAGGAGGCAGCAGG + Intergenic
1146270244 17:31480343-31480365 GAGGCAAGCAGGGAGGCAGCAGG + Intronic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1147605870 17:41773416-41773438 GAGGAGAGGAAGGAGGCAGCTGG - Intronic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148445976 17:47737469-47737491 GAGGATAGCAAGGATAGTGTGGG - Intronic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1149355361 17:55834118-55834140 GAGGAAAGTAGGGGTGCTGTGGG - Intronic
1149471961 17:56924314-56924336 GCGGAAAGCCAGGCTGCTGGAGG + Intergenic
1149988142 17:61364003-61364025 GAGGACAGCAAAGGTGCTCCTGG - Intronic
1150189725 17:63225280-63225302 GAGGAAAACAAGGAGACTGTGGG - Intronic
1150582504 17:66487634-66487656 AGGGAAGGCAGGGATGCTGCTGG - Intronic
1151691581 17:75689456-75689478 TAGGAAAGGAAGGCTGCTCCTGG - Intronic
1151978113 17:77493628-77493650 GAGGAAGGCATGGATGAGGCTGG - Intronic
1152556448 17:81055439-81055461 GAGAGAAACAAGGCTGCTGCTGG - Intronic
1152807488 17:82363127-82363149 GAGGAAAGCCTGGCTGTTGCAGG + Exonic
1153834154 18:8949337-8949359 GAGGAAGGCAAGGATGTGGAGGG + Intergenic
1155700988 18:28743367-28743389 CAGGAAAGCAAGGAAACTGCAGG + Intergenic
1156395896 18:36699649-36699671 GGGGAAAGCAGGGCTGCTGAAGG - Intronic
1156483017 18:37447952-37447974 GATGGAAGCAAGGGAGCTGCAGG - Intronic
1157338094 18:46756195-46756217 GAAGCAAGCAAGGATGCTCTTGG + Intronic
1157711744 18:49854560-49854582 GAAGAAAGCTAGGGTGCTGGGGG + Intronic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1160246712 18:77165450-77165472 CAGGAAAGCACAGATGCTGGAGG + Intergenic
1160404209 18:78634105-78634127 GAGGAAAGCAAGGCAGAAGCGGG - Intergenic
1160414759 18:78700808-78700830 GAGGAAAGCAAAGGTGGTCCTGG - Intergenic
1160922062 19:1525632-1525654 GTGGAAAGCCACGATGTTGCGGG - Exonic
1161801490 19:6418857-6418879 CAGGAAAGCCAAGATGATGCTGG - Exonic
1162621467 19:11847678-11847700 GAGGAGAGCAGGGACTCTGCTGG + Intergenic
1162625250 19:11879948-11879970 GAGGAGAGCAGGGACTCTGCTGG + Intronic
1162630488 19:11923714-11923736 GAGGAGAGCAGGGACTCTGCTGG + Intergenic
1162646902 19:12056595-12056617 GAGGAAAGCAGAGACTCTGCTGG - Intergenic
1162647306 19:12059211-12059233 GAGGAAAGCAGGGACTCTGTTGG + Intergenic
1162659931 19:12161029-12161051 GAGGAAAGCAGGGACTCTGCTGG + Intergenic
1162829823 19:13277502-13277524 CAGGAAAGCAAGGGTACTGGGGG - Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1164287228 19:23828304-23828326 AAAGAAAGAAAGAATGCTGCAGG - Intergenic
1164521370 19:28982606-28982628 GTGGAAAGGAAGGATGATGGAGG + Intergenic
1164787028 19:30941620-30941642 GTGGAAAGCAAGGAGGCAGGAGG + Intergenic
1164844757 19:31422424-31422446 GATCAAAGGAAGGAGGCTGCTGG - Intergenic
1165114971 19:33523177-33523199 GAGGACAGCAGGGATGGTACTGG - Intergenic
1165379093 19:35465204-35465226 GAGAAAGGTAAGGATCCTGCAGG - Intergenic
1165876905 19:39014307-39014329 CAGCAAAGCCAAGATGCTGCAGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166963906 19:46516225-46516247 GAGGAAAGCAAGGATCAGGGAGG + Intronic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167656077 19:50765169-50765191 GAGGAAAGAAAGGGTGCTCCAGG + Intergenic
1168138352 19:54366977-54366999 GAGGAATTCAAGTAGGCTGCTGG + Intronic
1168668225 19:58220526-58220548 CAGGAATGCAAGAATGCTTCAGG + Intergenic
925189997 2:1874977-1874999 GAGGAACGCAAGGACTCTGGAGG - Intronic
925621201 2:5794434-5794456 GTGGAAGGCAAGGAGGCTTCGGG + Intergenic
925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG + Intergenic
926244479 2:11113064-11113086 AAGTACGGCAAGGATGCTGCAGG + Intergenic
926515551 2:13840688-13840710 GAGGAAGCCATGGGTGCTGCAGG + Intergenic
926657822 2:15428386-15428408 GAGTAAAGGAATGATTCTGCAGG + Intronic
927440743 2:23115224-23115246 GAAGAAAGCAAGGCTCCGGCTGG - Intergenic
927654613 2:24934907-24934929 GAGGAAAGCTTGGTTGCTGGAGG + Intergenic
929445778 2:42000007-42000029 GGGGAGAGCAAGCATGCTACAGG + Intergenic
929864664 2:45708028-45708050 GAGGAATGCTGGGATGCTGCAGG + Intronic
931254772 2:60560820-60560842 GAGGAAAACAAGGATGGTGGTGG + Intergenic
932177778 2:69618675-69618697 GAGGGAAGCCAAGATGCTACAGG - Intronic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933541147 2:83644176-83644198 GAGGAAAAGAAGGATTCTCCTGG - Intergenic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934650710 2:96089826-96089848 GAGCCAAGCAAGGCTGCTGTCGG + Intergenic
934751977 2:96799490-96799512 GAGGAAACAAAGGATGAGGCAGG - Intronic
934849585 2:97689320-97689342 GTTGAAAGTTAGGATGCTGCTGG - Intergenic
935378408 2:102423604-102423626 CAGGAAACCAGGGCTGCTGCTGG + Intronic
935545022 2:104391707-104391729 AAGGAAAGAAAGGTTGCTCCAGG + Intergenic
935784233 2:106534257-106534279 GAGAAAAGCAAGGAAGAGGCGGG + Intergenic
935807895 2:106767062-106767084 GAGGAAAGAGTGGAAGCTGCTGG - Intergenic
937207609 2:120246513-120246535 GAGGAAGGAAAGGATGTTGGTGG - Intronic
937318397 2:120946612-120946634 GAAGAAAGGGAGGTTGCTGCTGG + Intronic
938109227 2:128553006-128553028 GAGGAAAACCAGGGTGCTGACGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938774110 2:134525933-134525955 TAAGAAGGCAGGGATGCTGCGGG + Intronic
939514531 2:143150028-143150050 GGCGAAATCAAGGATGCTGGGGG + Intronic
940212609 2:151271073-151271095 GAGGAAAGGAGGGATGCTCTGGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942484644 2:176426341-176426363 GGGAAAAGCAAGGATACTGGGGG - Intergenic
944320556 2:198336679-198336701 GAGCAAAGCAAGGAGTATGCTGG + Intronic
944663784 2:201942235-201942257 AATGAAAGCAAGGATGGTGATGG + Intergenic
945016863 2:205527686-205527708 GAAGAATGAAAGGAGGCTGCAGG - Intronic
945084861 2:206120800-206120822 GAGGAATACAAGCAGGCTGCAGG + Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946647223 2:221850704-221850726 GAGGAAAGAAAGGGTGTTGGTGG + Intergenic
948353065 2:237356649-237356671 GAGGAAATTCAGGATGCTGGTGG - Intronic
948725339 2:239930671-239930693 GTGGAAGGCAAGGATGCACCGGG + Intronic
1168819852 20:765499-765521 GAGGAAGGCAAAGATGATGCAGG + Exonic
1169404875 20:5314912-5314934 CAGGAGGGCCAGGATGCTGCGGG + Intergenic
1169939971 20:10926336-10926358 GATGAAAGGAAGGATGGTGGTGG - Intergenic
1170085335 20:12525207-12525229 GAGGAAAGCTTTTATGCTGCTGG + Intergenic
1170152551 20:13240573-13240595 GAAAAAAGCAAGGATTTTGCAGG + Intronic
1170445283 20:16420526-16420548 GTGGAAAGGTAGGAAGCTGCTGG + Intronic
1170605040 20:17869602-17869624 GAGGAAAGGAGGGATGGTGCAGG - Intergenic
1171176287 20:23052509-23052531 GAGTAAAGCAAGTCTGCTGGTGG - Intergenic
1171370013 20:24656448-24656470 GAGGAAAGCAGGCGTGCTGAGGG + Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172454007 20:35051954-35051976 GAGGAAAGGAAGGATTGTGATGG - Intronic
1172806642 20:37616612-37616634 GAGGCCAGCATGGCTGCTGCTGG + Intergenic
1172862051 20:38062196-38062218 GAGGAAAGCTAGAATAATGCAGG - Intronic
1173715417 20:45199496-45199518 GTGGAGGGCAAGGGTGCTGCAGG + Intergenic
1174167480 20:48595409-48595431 GAAAAAAGGAAGGAAGCTGCAGG + Intergenic
1174174437 20:48636069-48636091 GTGGAAGCCAGGGATGCTGCTGG - Intronic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175259303 20:57664576-57664598 GAGGAGCGCAGGGAGGCTGCTGG + Intronic
1175265658 20:57701977-57701999 GAGGAAGGCCAGGGTGCTCCTGG + Intronic
1175328160 20:58143933-58143955 GAAGAAAGGAAGCCTGCTGCTGG - Intergenic
1175644083 20:60656726-60656748 GAGGAAGGTAAGGATGCCGTGGG - Intergenic
1175922706 20:62457528-62457550 GAGGATAGCAGGGAAGCTGAGGG - Intergenic
1175956271 20:62611019-62611041 GAAGGAAGCAGGGATGCTCCAGG + Intergenic
1179250802 21:39669791-39669813 GAGAAAAGCAAGGCTGCTCGCGG - Exonic
1180701260 22:17782602-17782624 TAGGAAAGGAAGGATGCCACGGG - Intergenic
1180877272 22:19180442-19180464 CTGGACAGCAAGGCTGCTGCTGG - Intronic
1181296749 22:21846352-21846374 GAAGAAAGTAAGGGTGCTGTAGG - Intronic
1181806791 22:25379717-25379739 GAGGATAGAAAGGCTGCAGCTGG - Intronic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1182790807 22:32951289-32951311 GAGGAAGGCAGCCATGCTGCTGG - Intronic
1183092903 22:35535625-35535647 AAGGAAAGCTAGGAGCCTGCTGG + Intergenic
1183421439 22:37713826-37713848 GAGGAAAGGGAGCAGGCTGCGGG + Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184116476 22:42425626-42425648 GAGGTCAGCAAAGATGCTGGTGG + Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1184680864 22:46071552-46071574 GGGGAAAGCAAGGCGCCTGCGGG - Intronic
1185064975 22:48627654-48627676 GAGCCAAGAAAGGAGGCTGCTGG - Intronic
951702433 3:25509840-25509862 GAGCAAAGAAAGGCAGCTGCTGG - Intronic
952257089 3:31705014-31705036 GAGGAAATTAAGGCTGGTGCAGG + Intronic
952425904 3:33174267-33174289 GAGGAAAGCAGGGGTGGTGAGGG - Intronic
952953807 3:38544234-38544256 GAGGAAAGGAGGGAAGCTGGAGG - Intergenic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954134782 3:48576922-48576944 AAGGAAGACAAGGATGCTTCAGG + Intronic
954927820 3:54252751-54252773 GAGCACAGGAAGCATGCTGCAGG - Intronic
955148888 3:56347400-56347422 GAGGAAAGCTGGGAGGCTGGAGG + Intronic
955773089 3:62405681-62405703 AAGGAAAGCATGGATGTTCCAGG - Intronic
956527505 3:70181155-70181177 GAGGAAAGGAGCAATGCTGCTGG - Intergenic
958192732 3:90204219-90204241 GAGGAAACTGAGGAAGCTGCAGG - Intergenic
958416150 3:93876149-93876171 GAGGAAACTGAGGAAGCTGCAGG - Intronic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961546483 3:127637564-127637586 GAGGAGAGCAAGGCTGGTGGTGG + Intronic
961624746 3:128254198-128254220 GAGGAAGGCAAGTTTGCTTCTGG + Intronic
962492521 3:135908295-135908317 GAGGCAAGCAGGCATTCTGCAGG - Intergenic
962497641 3:135958048-135958070 TAGAAAAGCAAGAATGTTGCGGG - Intergenic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
963209560 3:142673988-142674010 AAGGAAAGAAAGGATGTTTCAGG - Intronic
964212668 3:154245722-154245744 AAGGAAAGGAAGGATGTAGCAGG - Intronic
966242409 3:177769115-177769137 GAGGAATCCAAGGGTGCAGCTGG - Intergenic
966842895 3:184103853-184103875 GAGGAAAGGAAGGAAGGAGCTGG + Intronic
966854814 3:184186590-184186612 GGGGACAGCAAGGATGACGCGGG + Exonic
966886012 3:184378539-184378561 CAGGAAAGCAAGCATCCTGTTGG - Intronic
967356171 3:188574137-188574159 GAGGAAACCCAGGGTGCTGAAGG - Intronic
967838847 3:193987421-193987443 ATGGAAAGCAAGCGTGCTGCAGG + Intergenic
967920217 3:194608957-194608979 GATGACAGCCAGGAGGCTGCTGG + Intronic
968470680 4:781121-781143 GAGGAAGGCAAGGCTGGTGGGGG + Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969515712 4:7647095-7647117 GAGGGAAGTAGGGATGCTCCAGG + Intronic
971741609 4:30528485-30528507 GAGGAGAGCAGGCACGCTGCTGG - Intergenic
973812046 4:54581064-54581086 GAGGTGAGGAAGGATTCTGCTGG + Intergenic
973982358 4:56316682-56316704 GAGGAAAGGTAGGTAGCTGCAGG + Exonic
974888375 4:67849226-67849248 GTGGAAAGCTAGGATGGTGTGGG + Intronic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975712942 4:77178679-77178701 AGGGAAAGAAAGGAAGCTGCAGG + Intronic
976124090 4:81815005-81815027 GAGGAAAGGAGGGATGTGGCGGG + Intronic
976207913 4:82639802-82639824 GAGGAAGGAGAGGAAGCTGCTGG - Intronic
977045565 4:92064807-92064829 GAGGAGAGCAAGGCTGGAGCCGG - Intergenic
977425328 4:96861463-96861485 GAGACAAGCTTGGATGCTGCAGG + Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
979668792 4:123340987-123341009 TAGGAAAACCAGGATGCTGCTGG + Intergenic
979734696 4:124068891-124068913 AAGAAAAGCTAGGATACTGCAGG + Intergenic
980189425 4:129504449-129504471 GAGGTAAGCAAAGAGGCTGCAGG + Intergenic
980906896 4:138957161-138957183 GAAGAAAGCAAGTATTCTGGTGG + Intergenic
980970987 4:139567095-139567117 GATGACAGCAGGGATGCTGGTGG - Intronic
981147635 4:141343614-141343636 GAGGGAAGCCAGGATGCAGGTGG + Intergenic
981305366 4:143241466-143241488 GAGGAAAGGAAGAATGCAGGAGG - Intergenic
981483435 4:145260400-145260422 GAGGAATTCAAGTAGGCTGCAGG - Intergenic
985315343 4:188653383-188653405 GGGGAAAGCATGGGTGCTGAAGG - Intergenic
985592530 5:772987-773009 GAAGACAGCCAGGCTGCTGCTGG + Intergenic
985685181 5:1278091-1278113 GAGGAGAGTAGGGATGCTGGTGG - Intronic
987377434 5:17249258-17249280 GATGAAAGCAAGAAGGCTGCAGG - Intronic
989272749 5:39552060-39552082 GAGGAAAGGAAGGAGGATGTAGG - Intergenic
992503106 5:77360724-77360746 CAGGAAAGCAAGGATGCTAAAGG - Intronic
992962542 5:81970825-81970847 GATGAAAACAAGAATGCGGCTGG - Intergenic
995478957 5:112576378-112576400 AAGGCAAGCCAGGAGGCTGCTGG + Intergenic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
997791724 5:136768028-136768050 GAAGAAATCAAGGCTGCTGCTGG + Intergenic
997878320 5:137568656-137568678 GAGGAAAGCAAGGGTGGGGAGGG - Intronic
998676133 5:144410016-144410038 GAGGAGGGGAAGGATGCTCCAGG + Intronic
999649880 5:153755099-153755121 GAGTACAGCAAGTATGTTGCTGG + Intronic
1000649229 5:163795620-163795642 GAAGAAAGTCAGGATGCTGCAGG - Intergenic
1001254303 5:170171869-170171891 GGGGAGGGCAAGGGTGCTGCGGG - Intergenic
1001338543 5:170822477-170822499 GAGGAAAGAAAGGCTTCTTCGGG - Intergenic
1001760687 5:174205638-174205660 AAGGAAAGCAAGGGTATTGCTGG + Intronic
1001886228 5:175293139-175293161 GAGGACAGTAAGGCAGCTGCAGG - Intergenic
1002181255 5:177432203-177432225 GTGGAAAGCAAAGAAGCTGGAGG - Intronic
1002209053 5:177585121-177585143 GAAGAAAGCAAGGATGAAGGAGG + Intergenic
1002210570 5:177596533-177596555 AAGGAGAGGAAGGATTCTGCTGG + Intergenic
1002365466 5:178706312-178706334 GATGAAAGCAAGGATACTAGAGG - Intergenic
1002616947 5:180461825-180461847 GTGGAAATGAAGGATGCTCCAGG + Intergenic
1003203624 6:3987303-3987325 GAGGAAAGCCAGGATGCAGGAGG - Intergenic
1003427843 6:6009105-6009127 GAGGAAGGCAAGGACGTTGAGGG - Intergenic
1007573185 6:42907959-42907981 GAGCAAGTCAAGGATGCTGGTGG - Intergenic
1012196230 6:96344366-96344388 AAGGAGAGCAAGGAAGCTGGTGG + Intergenic
1013744889 6:113333915-113333937 GAACAAAGCCAAGATGCTGCAGG + Intergenic
1014160305 6:118160032-118160054 GAGTAAAGGCAGGATGCTGAGGG + Intronic
1014547644 6:122751864-122751886 GAGGAAAGCAAGGAGGGAGATGG - Intergenic
1016107783 6:140184670-140184692 GGGGAAAGCAGGGACACTGCAGG - Intergenic
1018240927 6:161773920-161773942 GAGGAAGGGAGTGATGCTGCTGG + Intronic
1018445591 6:163855311-163855333 GAGGAATGAAAGGATGCTAATGG - Intergenic
1019361399 7:605987-606009 GAGGGAAACAAGGGTGATGCTGG - Intronic
1019837022 7:3398176-3398198 GAAAAAAGCAAGGATACTACGGG - Intronic
1020895459 7:13933540-13933562 GAGGAAAGGAAGCAGGGTGCAGG + Intronic
1021096805 7:16544310-16544332 TAGGAAAGCTAGGATGTTGGAGG - Intronic
1022972437 7:35530263-35530285 CAGGCAAGCAGGGGTGCTGCGGG + Intergenic
1023247733 7:38223586-38223608 GAAGAAGGCAAGGCTGCTGCAGG - Intronic
1023659008 7:42454407-42454429 GAAGAAAGCAAGGATACGTCAGG + Intergenic
1026156192 7:67827832-67827854 GAGCAAAGCATGGAAGATGCAGG + Intergenic
1026570871 7:71529212-71529234 CAGGAAAGCAAGGTTGCAACAGG + Intronic
1029464109 7:100714788-100714810 GAAGGAAGCAAGAATGCTGGAGG - Intergenic
1029466346 7:100727625-100727647 GAGGAAGGCAGGGATGATGGAGG + Intergenic
1030392707 7:108946746-108946768 GGGGAAAGCAAGGAAGCTATAGG - Intergenic
1032520295 7:132538710-132538732 CAGGAGAGCCAGGATGCTGTAGG + Intronic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1033656366 7:143377521-143377543 GATGGAAGCAAGGATGGGGCAGG + Intergenic
1034201327 7:149284861-149284883 GAGGAAACCGAGGACCCTGCTGG - Exonic
1034558941 7:151867383-151867405 GAGGCAAGGAAGGATCCTCCCGG - Intronic
1036058024 8:5281540-5281562 GAGGAAACGATGGATACTGCAGG + Intergenic
1037535453 8:19818771-19818793 GAGTAAAGGAAACATGCTGCAGG - Intronic
1037884132 8:22587524-22587546 GGGGAACGCAAGGATGTTCCTGG - Intronic
1038406505 8:27326183-27326205 GAGGAAAGCAAGGGTGTTCTGGG + Intronic
1038765474 8:30423757-30423779 GAAGAAAGGCAGGATGGTGCGGG + Intronic
1039172540 8:34764299-34764321 GAGGGAAGGAAGGATTCTGGAGG + Intergenic
1039192339 8:34990909-34990931 GAGAAAAGTAAGAAAGCTGCAGG + Intergenic
1040475872 8:47777090-47777112 GTAGAAAGCAAGGCTGCTCCTGG - Intronic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1040977167 8:53206243-53206265 GAAGACAGCAAGGATCATGCTGG - Intergenic
1042291731 8:67176061-67176083 GAAGAAATCTAGGATGCTGTTGG + Intronic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1047112525 8:121806526-121806548 GAAGAAAGCATGGATGCCGGTGG + Intergenic
1048460365 8:134616261-134616283 GTGGAAAGCAAGGAGGGTACAGG + Intronic
1048603042 8:135939474-135939496 GACAAAAGCAAGGATGCTAGAGG - Intergenic
1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG + Intronic
1050115880 9:2262999-2263021 GAAGAAAGCAAGGTTGATGGAGG - Intergenic
1051158662 9:14180847-14180869 TAGGCAAGCAAAGAGGCTGCTGG - Intronic
1051612527 9:18975187-18975209 TGGGGAAGCAAGGAGGCTGCAGG + Intronic
1052325813 9:27215812-27215834 AAGGAAAGCATAGATGCTACGGG + Intronic
1052836045 9:33250819-33250841 GAGGAATGAGAGGATGATGCAGG + Intronic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1057891890 9:98875846-98875868 GAGGAAAGAGAGGATGCTCCAGG + Intergenic
1057994832 9:99811729-99811751 GAGGAAAGCAGGGAGGCAGCAGG + Intergenic
1058941043 9:109812803-109812825 GAGCAAGGCAGTGATGCTGCTGG - Intronic
1059400479 9:114066770-114066792 GTGGAAGGCAAAGATGCTCCTGG + Intronic
1059656801 9:116365060-116365082 GAGGAAAGCGAGGATACAGCTGG - Intronic
1059730630 9:117053599-117053621 GAGAAGAGCCAGGATGTTGCTGG - Intronic
1060679242 9:125546724-125546746 CAGGAAAGGAAGGGTGCTCCTGG + Intronic
1061871788 9:133524788-133524810 GAGGAAGGCCAGGCTGCTGAGGG + Exonic
1062109058 9:134772225-134772247 AAGCAAAGCAAGGTTGGTGCGGG - Intronic
1062669230 9:137696868-137696890 GAGGAAAGGAAGGAAGACGCAGG - Intronic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1186429242 X:9490286-9490308 GATGGAATCAAGGAAGCTGCAGG - Intronic
1187781139 X:22826493-22826515 GAGGAAAGCAAGTAGGGTGGTGG + Intergenic
1188283135 X:28295176-28295198 GTGGAAAGCAAGTGTGCTTCAGG - Intergenic
1189255703 X:39637296-39637318 CAGCCAAGCAAGGAAGCTGCGGG + Intergenic
1191728949 X:64313378-64313400 GAGAAAAGTGAGGAAGCTGCAGG - Intronic
1193285812 X:79713739-79713761 GAGGAATTCAAGTCTGCTGCAGG + Intergenic
1194000599 X:88424369-88424391 GACCAGAGCAAGGAAGCTGCTGG + Intergenic
1194986550 X:100495867-100495889 GGGCAAAGCAAGGAGGCTGAGGG + Intergenic
1197611467 X:128643810-128643832 GAGGAAATCAAGGGTACTGGTGG - Intergenic
1197969386 X:132099265-132099287 GATGAAAGAAATCATGCTGCTGG - Intronic
1198008372 X:132523102-132523124 GATGAATGCAAGGCTGCGGCAGG + Intergenic
1198043243 X:132875096-132875118 GAGGTAAGCAATGAAGCTACAGG + Intronic
1200243309 X:154508819-154508841 GAGAAAAGAAAGGATGCTGAGGG + Intronic
1200929856 Y:8687158-8687180 AAGGAATGCAAGGATGGAGCTGG + Intergenic