ID: 1091860304

View in Genome Browser
Species Human (GRCh38)
Location 12:3775554-3775576
Sequence GTGCAAGAGCAGTGAGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091860304_1091860315 29 Left 1091860304 12:3775554-3775576 CCCTAGCCTCACTGCTCTTGCAC No data
Right 1091860315 12:3775606-3775628 TGAATGTCGCATCACATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091860304 Original CRISPR GTGCAAGAGCAGTGAGGCTA GGG (reversed) Intergenic
No off target data available for this crispr