ID: 1091862648

View in Genome Browser
Species Human (GRCh38)
Location 12:3800381-3800403
Sequence TATGAGGCAGATTTCAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091862646_1091862648 -6 Left 1091862646 12:3800364-3800386 CCAATGACTGAGAGCTATATGAG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1091862648 12:3800381-3800403 TATGAGGCAGATTTCAGATGTGG 0: 1
1: 0
2: 1
3: 17
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091862648 Original CRISPR TATGAGGCAGATTTCAGATG TGG Intronic
901349376 1:8579682-8579704 TGGCATGCAGATTTCAGATGGGG - Intronic
902044040 1:13512452-13512474 GGTGAGGAAGATTTCTGATGTGG - Intronic
902216277 1:14936295-14936317 TCTGAGGCACATTAGAGATGCGG + Intronic
902979902 1:20115220-20115242 AATGGGGTAGATTACAGATGAGG + Intronic
907373763 1:54019340-54019362 TATGAAGCAGGTTTCCGCTGTGG + Intergenic
912418596 1:109528667-109528689 TTAGAGGCAGGTTTCAGATGAGG - Intergenic
913011839 1:114691210-114691232 TAAGAGTCAAATTTCAGCTGTGG - Intronic
913183527 1:116345533-116345555 TAAGAGGCAGAGCTGAGATGAGG + Intergenic
913507301 1:119528797-119528819 TGCGAGGCAGATTCCTGATGGGG - Intergenic
914251122 1:145922346-145922368 TATGAAGCAAATTTTACATGTGG + Intergenic
917510140 1:175662887-175662909 AATGATGAAGATTTCAGATTTGG + Intronic
917868475 1:179220995-179221017 TATGAGCCAATTTACAGATGAGG + Intronic
919219725 1:194611714-194611736 TATGAGGCAGTTCTCAGAGAGGG - Intergenic
919225139 1:194688193-194688215 TATGAGCCATTTTTCAGATGAGG - Intergenic
920248133 1:204603643-204603665 AATGAGACAGATTTGGGATGAGG - Intergenic
921538904 1:216387879-216387901 TATGAGGCAAAATTCTGGTGTGG + Intronic
922286988 1:224178998-224179020 GATGAAGTAGTTTTCAGATGAGG - Intronic
922723728 1:227912693-227912715 TTTGAGGCAGAAGTGAGATGTGG - Intergenic
923849418 1:237776945-237776967 TTTCAGACTGATTTCAGATGGGG + Intronic
924476155 1:244383551-244383573 TATAAGGCAGAGTTTATATGGGG + Intronic
924924916 1:248671099-248671121 TATGTAGCAGTATTCAGATGTGG + Intergenic
1065362272 10:24899657-24899679 TATGGTTCAGATGTCAGATGTGG - Intronic
1067262781 10:44708838-44708860 GAAGAGTCAGATCTCAGATGTGG - Intergenic
1068090943 10:52431491-52431513 TATGAGGCATATTTCTTAGGAGG - Intergenic
1068739131 10:60449015-60449037 CAAGAGGCAAATTTCAGAGGAGG + Intronic
1069185693 10:65419822-65419844 GATGAGGCAAATTTCTGAAGTGG - Intergenic
1070694782 10:78553989-78554011 TATGAGGCAGATTTCCCCTTTGG + Intergenic
1070973197 10:80584738-80584760 TATGAGGCAAATTTATTATGAGG + Intronic
1071144256 10:82549122-82549144 TATTAGTCAGTTTACAGATGAGG - Intronic
1074032407 10:109701916-109701938 GATGATGCAGCTGTCAGATGAGG + Intergenic
1076138656 10:128062806-128062828 TAAGAAGCAGGGTTCAGATGAGG - Intronic
1076359491 10:129877106-129877128 TATGAGGAGGATCTCAGATCTGG + Intronic
1080472765 11:32562057-32562079 TAAGAGGAAGCTGTCAGATGGGG - Intergenic
1082032062 11:47612019-47612041 TATGAGGAAGCTGTCATATGGGG + Intergenic
1085591599 11:77767269-77767291 TAGGAGGCAGGTTTAAGATGTGG - Intronic
1086982497 11:93214280-93214302 TATGAGGGAAAAATCAGATGAGG - Intergenic
1087192297 11:95267843-95267865 TGGGTGGCATATTTCAGATGGGG + Intergenic
1089830778 11:121325925-121325947 TAGGAGGGACATTTCAGATTTGG + Intergenic
1090157298 11:124453761-124453783 TTTAATGCATATTTCAGATGAGG - Intergenic
1090609499 11:128457576-128457598 TAGGAGCCAGAGTTCAGATGAGG - Intergenic
1090918814 11:131190544-131190566 TCTGAGGCAGAATGCAGAGGAGG - Intergenic
1091095108 11:132813559-132813581 TAAGAGTGAGATTTAAGATGGGG - Intronic
1091592685 12:1854333-1854355 GATGAGGAAGAGTTGAGATGGGG - Intronic
1091862648 12:3800381-3800403 TATGAGGCAGATTTCAGATGTGG + Intronic
1092026969 12:5249021-5249043 GATGAGGCAGAATCCAGAGGTGG + Intergenic
1092900922 12:13058690-13058712 TATGTGGAAGCTTTCTGATGAGG - Intronic
1093706959 12:22285191-22285213 TTTGAGGAAGATTTGAAATGAGG + Intronic
1093825546 12:23682342-23682364 TATGAGGTATATTTTAGAAGAGG + Intronic
1093894183 12:24558702-24558724 TATGAGAGGGATTTCTGATGTGG - Intergenic
1095927754 12:47595816-47595838 TATGAGTCAGGTATTAGATGAGG - Intergenic
1096685412 12:53285334-53285356 TAGGAGGCAGGATTCAGGTGTGG + Intronic
1101828422 12:108238928-108238950 TATGAGGAATTTTACAGATGAGG - Intronic
1102583034 12:113903871-113903893 TAAAAGACAGATTTAAGATGTGG + Intronic
1102826606 12:115952313-115952335 TAGGAGGCAGCTGTCAGAGGTGG - Intergenic
1103126721 12:118429708-118429730 TCTGAGGCAAATTTCAGAGCAGG + Intergenic
1103298808 12:119910926-119910948 CTTGAGGAAGATTTCAGAAGAGG + Intergenic
1107040309 13:35940909-35940931 TAGGAGGTATATTTCAGCTGAGG + Intronic
1107182556 13:37478464-37478486 AATGTGGCAGAATTGAGATGTGG + Intergenic
1112793744 13:103031890-103031912 TATGAACCATATGTCAGATGTGG - Intergenic
1113174538 13:107547184-107547206 TATGAGGCACTCTTCTGATGTGG - Intronic
1113396669 13:109954465-109954487 TATGAGGCAGCTTTCATAGCTGG - Intergenic
1113495936 13:110729156-110729178 TGTGAGGCAGATCTTACATGAGG + Intergenic
1116452682 14:45082912-45082934 GAGGAGACAGATTTCAGATGAGG + Intergenic
1117006441 14:51425514-51425536 TTTGAGACATATTACAGATGAGG - Intergenic
1119095118 14:71823004-71823026 CATGAGACAGATTTAAGGTGTGG - Intergenic
1123913263 15:24992131-24992153 TATTAGGCAAATATTAGATGTGG + Intergenic
1124455129 15:29835163-29835185 TATGAGGCCAATGTGAGATGTGG + Intronic
1125129356 15:36263685-36263707 TATAAGCCAGATATCAGCTGGGG + Intergenic
1126469192 15:48988928-48988950 TAGGATTCAGATTTCAGATTAGG + Exonic
1127116294 15:55731155-55731177 TGTTAGGCAGCTTTCAGAAGGGG - Intronic
1128786428 15:70400778-70400800 TATTGGGCACATTTCACATGCGG - Intergenic
1129560522 15:76561851-76561873 TATGAGGCAGAGGCCAGGTGCGG + Intronic
1133664902 16:7957380-7957402 TATTAGGCAGAGATAAGATGTGG + Intergenic
1138129176 16:54464765-54464787 TATCAGACAAATTTCAGTTGAGG + Intergenic
1138136531 16:54528179-54528201 TATGGAGCCTATTTCAGATGAGG - Intergenic
1138913144 16:61427571-61427593 TATGAGGCAGAAGCCAGGTGTGG + Intergenic
1140049378 16:71466190-71466212 TATTACGCAGAATTCAGTTGAGG + Intronic
1141293059 16:82738415-82738437 AATGAGAGAGATTTCAGGTGAGG - Intronic
1145015372 17:19393100-19393122 GAAGAGGCAGATTAGAGATGGGG + Intergenic
1146272566 17:31493938-31493960 TGTCAGGCAGCATTCAGATGGGG + Intronic
1149490433 17:57080917-57080939 TATGAGTCAGCTTTCAGTTCTGG - Intergenic
1149669352 17:58392086-58392108 TATGGGGCAGTTATCAGAGGAGG + Intronic
1149737984 17:59014765-59014787 TACAAGGCAGAGTTCAGATAAGG + Intronic
1150999009 17:70352052-70352074 GATGATGCAGAATTCAGTTGGGG + Intergenic
1152699112 17:81810526-81810548 TTTGGGGCACATTTGAGATGGGG + Intronic
1155445214 18:25904243-25904265 TATGAGGCAGGTTGAAGATAAGG + Intergenic
1155445263 18:25904843-25904865 TATGAGGCAGGTTGAAGATAAGG - Intergenic
1156448106 18:37251736-37251758 CAGGAGGCAGCTTGCAGATGGGG - Intronic
1157834213 18:50884292-50884314 TATGAGGTAGATTTGAGAGGTGG + Intronic
1158152879 18:54392407-54392429 TATGAGGCAGATTTCTTAGGAGG + Intergenic
1160384610 18:78487598-78487620 TAGGAGTCAGAATTCAGCTGGGG - Intergenic
1162365087 19:10243670-10243692 TAGGGGGCACATATCAGATGCGG - Intergenic
1165540438 19:36489125-36489147 TGTGCGGCAGAGTTCAGGTGGGG - Intronic
1165858143 19:38892459-38892481 CAGGAGGCTTATTTCAGATGTGG - Intronic
1168493194 19:56828402-56828424 TGTGAGTTAGATTTCAGAAGTGG - Intronic
925802391 2:7614169-7614191 TATGACGGAGATTTCTGAGGAGG - Intergenic
926421666 2:12705752-12705774 TATGAGCCAGAAATCACATGGGG - Intergenic
927066670 2:19478524-19478546 AATGAGGCAGTATTCAGAGGTGG - Intergenic
928843981 2:35646238-35646260 TCTGAGTCAGTTTTCAGATTTGG + Intergenic
929046425 2:37795070-37795092 TGTCAGGCAGATTTCAGCTATGG + Intergenic
930203458 2:48565778-48565800 TATGAGGCAATTTACATATGAGG + Intronic
930756887 2:54984121-54984143 TATGGGTGAGATTTGAGATGGGG - Intronic
930881053 2:56271175-56271197 TATGAGGCAGGCGTCAAATGTGG + Intronic
931240883 2:60451564-60451586 TTTGGGGCAGATTTTAGAGGGGG - Intronic
931676261 2:64699599-64699621 CATGAGGTAGGTTTCAGATGGGG + Intronic
933598936 2:84309953-84309975 TATGAATAAAATTTCAGATGAGG - Intergenic
935074417 2:99727024-99727046 TATGAGGCATATTTAAGAACAGG + Intronic
935884931 2:107607285-107607307 TTGGAGGCATGTTTCAGATGTGG + Intergenic
937029389 2:118725382-118725404 AAGCAAGCAGATTTCAGATGGGG - Intergenic
939250776 2:139679563-139679585 TATTAGGCAGATTTCAGACCAGG + Intergenic
941319212 2:164033320-164033342 CATGAGGAAGATTTGGGATGAGG - Intergenic
944342440 2:198618373-198618395 TATGAGTCAGATTTCACTTCGGG + Intergenic
945865853 2:215174686-215174708 AAGGAAGTAGATTTCAGATGGGG + Intergenic
946094395 2:217260230-217260252 TATGAACCAGATTTCAGTTTGGG - Intergenic
947030923 2:225793952-225793974 AAGGAGGCAAATTTGAGATGGGG + Intergenic
1169720022 20:8666182-8666204 TATCAGGCAGGTTACAGCTGTGG - Intronic
1170077257 20:12433127-12433149 TATGAGGTACCTTTCAGAAGCGG + Intergenic
1172931709 20:38591157-38591179 TTTGAGGCAGAAGGCAGATGAGG + Intergenic
1172950785 20:38722423-38722445 TATAGGGCAAATTTCGGATGGGG + Intergenic
1173260371 20:41429722-41429744 TGGGAGGCAGATTTCTGGTGTGG + Intronic
1175886484 20:62294154-62294176 TATGTGGCAGAAATCAGCTGGGG + Exonic
1176013722 20:62916326-62916348 AATGAAGCAGTTTTCAGCTGGGG - Intronic
1176152214 20:63597651-63597673 GATGAGGCGTATTTTAGATGTGG - Intronic
1184230278 22:43155010-43155032 TATGAGCCCTGTTTCAGATGAGG + Intronic
1184325036 22:43776485-43776507 AATGAGGCAGAGTGCAGCTGGGG + Intronic
1184886063 22:47345112-47345134 GAGGAGGCAGATTCCAGAGGTGG + Intergenic
1185033910 22:48460867-48460889 TGTGAGGCAGATTTGGGGTGGGG + Intergenic
950063893 3:10095460-10095482 TTTGAATCAAATTTCAGATGCGG - Intronic
952464952 3:33573207-33573229 TATGAGGCAGACGGAAGATGTGG - Exonic
953316648 3:41933710-41933732 TGTGTGGCAGTTTTCAGATACGG - Intronic
958589875 3:96142597-96142619 TATGAGGCATACTCCACATGAGG + Intergenic
958809297 3:98841154-98841176 GAGCAGGCAGATCTCAGATGGGG + Intronic
958892986 3:99801003-99801025 TATGAGGCAGGTTGGTGATGTGG - Intergenic
959002147 3:100976787-100976809 TACGGGGCAGATCTCAGATCTGG + Intronic
962845057 3:139266871-139266893 GATGAGGCAGGATACAGATGGGG - Intronic
963946623 3:151152758-151152780 TATGTGGCAGATCTGAGATTTGG + Intronic
965126093 3:164631548-164631570 TCTGAGGCAGATTACTTATGAGG - Intergenic
966706314 3:182919282-182919304 TACAAGGCATATTTCAGGTGTGG + Exonic
967047006 3:185746633-185746655 TATGAGGAAGATTATATATGAGG + Intronic
967511244 3:190315139-190315161 CATAACACAGATTTCAGATGTGG + Intronic
967772982 3:193355442-193355464 TCTGAGGCAGATTTGTGAAGTGG - Intronic
972256221 4:37358493-37358515 TAGGAAGCAGATTTCAGCTTTGG + Intronic
974050164 4:56933879-56933901 TTTGAGGCAGGTTTCAGATTTGG + Exonic
974518761 4:62953303-62953325 TATGAGTAAGATTTGAAATGGGG + Intergenic
974880943 4:67756524-67756546 AATTAGGCAGACTTCAGATCTGG + Intergenic
977307343 4:95341921-95341943 AATGGGGCAGAATTCAGCTGGGG + Intronic
977488205 4:97676467-97676489 TATCACACAGGTTTCAGATGCGG - Intronic
977575336 4:98667750-98667772 AATGGGGCAGATTTCATAAGGGG - Intergenic
977578751 4:98702219-98702241 TATGAGCCATTTTTCAGATCTGG - Intergenic
978980329 4:114937349-114937371 TACCGGGCAGGTTTCAGATGTGG + Exonic
980267006 4:130529764-130529786 AATGAGACAGATTTGAGAAGAGG + Intergenic
980343826 4:131585553-131585575 TATGAGGTTGATATCAGATAGGG - Intergenic
980643939 4:135617263-135617285 CATGAGGCAGATGTCAAATGAGG - Intergenic
983926102 4:173404073-173404095 CATGAGGTAGTTTCCAGATGGGG + Intronic
984006123 4:174311928-174311950 TAGGCTGCAGATTTCAGATTTGG + Intronic
984420770 4:179518101-179518123 AAGGAGCCAAATTTCAGATGAGG + Intergenic
985891000 5:2715204-2715226 TAGGACACAGATGTCAGATGTGG - Intergenic
985899462 5:2777313-2777335 AATAAGGCAAATTTCAAATGAGG - Intergenic
986201299 5:5581302-5581324 AACGAGCCAGATTTCAGAGGTGG - Intergenic
988613966 5:32755327-32755349 GATTAAACAGATTTCAGATGTGG + Intronic
989012860 5:36893143-36893165 GAAGAGGCAGTCTTCAGATGAGG - Intronic
990224371 5:53632518-53632540 TCTGAGGCAGAGTTCTGAAGAGG - Intronic
991382620 5:66046891-66046913 TCTGAGACAGTTTTTAGATGTGG + Intronic
991990805 5:72337217-72337239 TATGGGGCAGAGATCACATGAGG - Intronic
992540320 5:77758006-77758028 AATGAGGCAAGTTTCAGATCAGG + Intronic
994104681 5:95934058-95934080 TATAAGTCAGTTTTCAGATTAGG - Intronic
994360171 5:98841014-98841036 TATGAGGCAGTTTTCCCAAGGGG + Intergenic
994689963 5:103005735-103005757 TAAGAGAAATATTTCAGATGTGG - Intronic
996060534 5:119028448-119028470 CATAAGGCAGATTACAGTTGTGG + Intergenic
997724626 5:136110169-136110191 TTGGAAGCAGATCTCAGATGAGG - Intergenic
999307440 5:150529039-150529061 CATGAGGCAGATTTTAACTGAGG + Intronic
1000867729 5:166536198-166536220 TCTGTGGCAGATTTCAGATGAGG + Intergenic
1002047281 5:176549216-176549238 AATGAGGCAGAGTACAGCTGGGG - Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1002717250 5:181235209-181235231 TCTGATGCAGATTTTAGCTGAGG + Exonic
1005622351 6:27631643-27631665 TATTTGGCAGATTTCAGAGAAGG + Intergenic
1008884313 6:56415445-56415467 TATGAAGCAGAAATGAGATGTGG + Intergenic
1011972168 6:93239431-93239453 TAATAGGCAAATGTCAGATGAGG - Intergenic
1012928059 6:105287725-105287747 TGTGAATCAGATTTCATATGGGG + Intronic
1014305256 6:119733331-119733353 GATGAGGCAGTTGTAAGATGTGG - Intergenic
1015100991 6:129480099-129480121 TATGAGGCAGAAATTTGATGTGG + Intronic
1018282807 6:162206211-162206233 TATGGGTCAGATTTCAAAGGTGG - Intronic
1018826902 6:167415392-167415414 AATGAGGGAGATTTGGGATGAGG + Intergenic
1021240675 7:18196940-18196962 TGTGAGGGTGATTTTAGATGAGG + Intronic
1021345079 7:19517473-19517495 TATGAGCCCGTTGTCAGATGAGG - Intergenic
1021887062 7:25149687-25149709 TGTGTGGCAGAAGTCAGATGAGG + Intronic
1022531936 7:31072340-31072362 TATGAGGGACATTTTAGAGGTGG + Intronic
1022654366 7:32305542-32305564 GAAGAGGAAGATTTCAGATTTGG - Intergenic
1023122803 7:36926214-36926236 TATGAAGCAGAGTAGAGATGAGG - Intronic
1023621715 7:42079877-42079899 TATGAGGCATATATTAAATGTGG - Intronic
1023906565 7:44526583-44526605 AATGAGGGAGATGCCAGATGAGG + Intronic
1024632279 7:51259721-51259743 TCCCAGGCAGACTTCAGATGTGG + Intronic
1026861094 7:73789919-73789941 TATGAGGCCGATTCCCCATGGGG - Intergenic
1027866604 7:83655994-83656016 TATGAGCCAGATTTTACATAAGG + Intergenic
1028146398 7:87324354-87324376 TATGAGGCAGTTTTCCCAAGGGG + Intergenic
1030409698 7:109160521-109160543 TATGAGGCTGAATTAAGATGTGG - Intergenic
1031011451 7:116528130-116528152 AAAGAGGCAGATTTCAGAGAGGG + Intronic
1031331904 7:120475675-120475697 CATGAGGCAGCTTGCAAATGAGG - Intronic
1032141532 7:129335583-129335605 CATGAGGCTGATGTCAGATGGGG + Intronic
1032620061 7:133520473-133520495 GATGAAGCAGATTTGAGAAGGGG + Intronic
1033233305 7:139618813-139618835 GATGGGGCAGATGTTAGATGGGG + Intronic
1033740902 7:144275027-144275049 TATGAGCCAGAAGGCAGATGTGG - Intergenic
1033753004 7:144374586-144374608 TATGAGCCAGAAGGCAGATGTGG + Intronic
1033874756 7:145801854-145801876 CAGGAAACAGATTTCAGATGGGG - Intergenic
1035230497 7:157463109-157463131 AATGAGGCAGATTCTCGATGTGG + Intergenic
1036703812 8:11031651-11031673 TTTCATGCAGATTTCAGATGAGG + Intronic
1038492868 8:27982648-27982670 GAGGAGGCAGATTCCAGAGGTGG + Intronic
1042566430 8:70116797-70116819 GATGAGGCAGATTCAAGAGGGGG + Intronic
1043262108 8:78214815-78214837 TATGTGGCAAATTTCATATGAGG - Intergenic
1043871964 8:85442855-85442877 TATGAGACAGGTTACAGATGAGG + Intronic
1044367672 8:91368391-91368413 TGCAAGGGAGATTTCAGATGAGG + Intronic
1044371203 8:91412959-91412981 TATGAGGAAGAGATGAGATGAGG + Intergenic
1045798924 8:106079165-106079187 TAAGGAGCTGATTTCAGATGGGG + Intergenic
1046599932 8:116304473-116304495 TATCAGGCAGATTTAAGGTGAGG - Intergenic
1046655354 8:116887858-116887880 TATGAGGAAAGTTTCAGAAGTGG + Intergenic
1046674069 8:117089452-117089474 CAGGAGTCAGATTTCAGATTTGG - Intronic
1047778493 8:128092651-128092673 TAAGAAGCAGGGTTCAGATGAGG + Intergenic
1048000365 8:130374961-130374983 TAAGAGGCAGATTCCTGAAGGGG - Intronic
1051900345 9:22032030-22032052 CCTAAGGGAGATTTCAGATGAGG + Intronic
1053600640 9:39605223-39605245 CATGGGTCAGATTGCAGATGTGG - Intergenic
1053858287 9:42359031-42359053 CATGGGTCAGATTGCAGATGTGG - Intergenic
1054252889 9:62737206-62737228 CATGGGTCAGATTGCAGATGTGG + Intergenic
1054567006 9:66771705-66771727 CATGGGTCAGATTGCAGATGTGG + Intergenic
1054904740 9:70404763-70404785 TATGAAGCTTAATTCAGATGAGG - Intronic
1058936781 9:109777028-109777050 TCTGATGCAGATTTCTGATTAGG + Intronic
1059571827 9:115446029-115446051 TAGGAGGCAGATCTGAGATCTGG - Intergenic
1059637165 9:116182435-116182457 GATGAGGCAGTTTTAGGATGGGG + Intronic
1061440665 9:130601138-130601160 GATGAGGCTGATTTTAGTTGAGG - Intronic
1191938015 X:66445845-66445867 TATGAGGCAGATTGAAGTGGGGG + Intergenic
1192549149 X:72040072-72040094 TGTGAGGCAGAGTTCAGCTTGGG + Intergenic
1195883792 X:109619564-109619586 TATCAGGCAGAGTACAGAGGTGG - Intergenic
1196332767 X:114491792-114491814 TAGGAGGCAGATATCAGACTTGG + Intergenic
1199148021 X:144394591-144394613 TAGAAAGCATATTTCAGATGTGG + Intergenic
1200081255 X:153577719-153577741 TCCGAACCAGATTTCAGATGGGG + Intronic