ID: 1091863521

View in Genome Browser
Species Human (GRCh38)
Location 12:3808590-3808612
Sequence GCCAACTCTTGGCCTGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091863516_1091863521 14 Left 1091863516 12:3808553-3808575 CCAGGGGAGCACACCAAGAATAA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1091863521 12:3808590-3808612 GCCAACTCTTGGCCTGTTTGGGG 0: 1
1: 0
2: 0
3: 29
4: 302
1091863515_1091863521 22 Left 1091863515 12:3808545-3808567 CCGCTGAGCCAGGGGAGCACACC 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1091863521 12:3808590-3808612 GCCAACTCTTGGCCTGTTTGGGG 0: 1
1: 0
2: 0
3: 29
4: 302
1091863517_1091863521 1 Left 1091863517 12:3808566-3808588 CCAAGAATAAAAAATGCTGCAGA 0: 1
1: 1
2: 5
3: 55
4: 406
Right 1091863521 12:3808590-3808612 GCCAACTCTTGGCCTGTTTGGGG 0: 1
1: 0
2: 0
3: 29
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091863521 Original CRISPR GCCAACTCTTGGCCTGTTTG GGG Intronic
900782274 1:4626012-4626034 GCCACCTCTTGGCCAGGTTAAGG - Intergenic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
905633290 1:39531005-39531027 GCCACCTCATGGCCTCTTTCAGG - Intergenic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
907268788 1:53278302-53278324 GCCAGGTCTTGGCCTGTGTGTGG - Intronic
907272647 1:53299913-53299935 GCCCACTCTGGGCCTGGTGGTGG - Intronic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
911414813 1:97557914-97557936 GCCACCTCTTGGCTTTATTGAGG - Intronic
911981897 1:104579226-104579248 GAAAACTCTTGGCCTGTTATTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
914017418 1:143832810-143832832 GCGCACTCTAGGCCTCTTTGTGG - Intergenic
915138112 1:153748254-153748276 AGAAACTCTTGGCCTGTTGGGGG + Intronic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
917243800 1:172977900-172977922 ACCATTTCATGGCCTGTTTGAGG + Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
917751519 1:178057828-178057850 GCCTCACCTTGGCCTGTTTGGGG - Intergenic
918918229 1:190671843-190671865 GACAGCTCTTGGCCTGTTAATGG - Intergenic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
920020253 1:202950272-202950294 GCCAACTCTTTGCCTTTTAAAGG - Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1062815983 10:500234-500256 GCCAACCCCTGGCCTGTCTCAGG + Intronic
1063168749 10:3487071-3487093 GCAGGCTCTTTGCCTGTTTGTGG + Intergenic
1063698443 10:8360589-8360611 GCCTTCTGTTGGTCTGTTTGTGG + Intergenic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1068432852 10:56955037-56955059 ATCAACTCTTGGCCTGATTATGG + Intergenic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1071881905 10:89908426-89908448 GCCCATTATTGGCCTGTTTTGGG + Intergenic
1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG + Intergenic
1072424813 10:95320924-95320946 TCCCACTCTTGGCCTCTCTGGGG + Intronic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1074226146 10:111486402-111486424 ACTAACTCTTTGCCTGTTTGAGG + Intergenic
1075670525 10:124261159-124261181 GGCTACTCTTGTCCTGCTTGTGG - Intergenic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1076883249 10:133249628-133249650 GCCCACTCTGGGCCTCGTTGTGG - Intergenic
1077517516 11:3010745-3010767 GCCGAATCTGGGCCTGTTTCGGG - Intronic
1078917211 11:15789878-15789900 GCCAAATCTAGGACTGTTTGAGG + Intergenic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081569086 11:44278520-44278542 GCCAGCTCTTGGCCTTTCAGGGG + Intronic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1083488918 11:63000621-63000643 CCCAGCTCTTTGCCTCTTTGCGG + Intronic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1087805792 11:102553791-102553813 GTCACCTCAAGGCCTGTTTGGGG + Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1089131162 11:116213257-116213279 GAGAACCCTTGGCCTCTTTGTGG - Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090502592 11:127275949-127275971 GGCACCTCTGGGCCTGCTTGCGG + Intergenic
1090765121 11:129869820-129869842 GCCAGCTCTTGGCGTGAGTGTGG - Exonic
1091053522 11:132396870-132396892 GACAAATCTTGGCATGTGTGAGG - Intergenic
1091863521 12:3808590-3808612 GCCAACTCTTGGCCTGTTTGGGG + Intronic
1091975068 12:4817701-4817723 GCTATCACTTGACCTGTTTGGGG + Intronic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1093049669 12:14490952-14490974 GACAGCTCTTGGCCTGTTAAAGG - Intronic
1095121505 12:38424833-38424855 GGCAACTCTTGGCCTGTGACAGG - Intergenic
1095603855 12:44044345-44044367 GACAGCTCTTGGCCTGTTTCTGG + Intronic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1109039885 13:57319215-57319237 GATAAATATTGGCCTGTTTGTGG - Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1115143400 14:30199398-30199420 GGCAACTCTTGGCCTGCTACTGG + Intergenic
1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117742557 14:58833815-58833837 GCCCACTCTGGCCATGTTTGAGG + Intergenic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1119049506 14:71352836-71352858 GCCAAATCTTGACATGTCTGTGG - Intronic
1119510881 14:75210156-75210178 GCCAACACTGGGAATGTTTGAGG - Intergenic
1119825435 14:77653753-77653775 GCCAACTCCTGGCTGGTTTGGGG + Intergenic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1121266169 14:92603998-92604020 ACCACCACTTGGCCAGTTTGTGG - Intronic
1122336214 14:100987927-100987949 GCCAACTCTTTCCCAGTTAGAGG + Intergenic
1125317475 15:38446583-38446605 ATAAACTCTTGGCCTTTTTGTGG + Intergenic
1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG + Intergenic
1127356917 15:58209200-58209222 GACAGCTCTTGGCCTGTTATTGG + Intronic
1130847572 15:87761664-87761686 GCCAAGTCTTGGCCCCCTTGGGG - Intergenic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1132016457 15:98321548-98321570 ACCTACTCATGGGCTGTTTGGGG - Intergenic
1132712176 16:1273862-1273884 GCCATCTCTTTTCCTGTCTGCGG - Intergenic
1138247712 16:55479606-55479628 GCCAACTCTTTGTCCGTTTTGGG - Exonic
1138754232 16:59463857-59463879 CCCATCTCTTTGCCTCTTTGTGG + Intergenic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1141807419 16:86351211-86351233 GCCAACTCCTGGGGTGTTGGCGG + Intergenic
1146659253 17:34653528-34653550 GCTTTTTCTTGGCCTGTTTGGGG - Intergenic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1146916362 17:36680758-36680780 GCCAAATCCTGGCCGGTTTTTGG + Intergenic
1146923191 17:36727437-36727459 CCCCACTCTTGCCCTGTGTGGGG + Intergenic
1148247588 17:46044703-46044725 GCCAACTCTACGCCTGGCTGTGG - Intronic
1148714632 17:49707432-49707454 GCCGACTCGGGTCCTGTTTGAGG + Intronic
1149659607 17:58327460-58327482 GTCCTCTCTTGGCCTGTCTGTGG - Intronic
1150208013 17:63423737-63423759 GACAAGTCCTGGCCTGTTTTAGG - Exonic
1151396483 17:73826524-73826546 GCCAACTCTTGTCCACTTAGGGG + Intergenic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1155098926 18:22589620-22589642 CCCAAGGCTTTGCCTGTTTGTGG + Intergenic
1156149839 18:34228007-34228029 AAGAACTCTTGGCATGTTTGAGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156934641 18:42688975-42688997 TCTAACTCTTGGGCTGTTTTTGG - Intergenic
1157265138 18:46212564-46212586 GCTAACTTTTGTCCTGTTTGTGG + Intronic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157465803 18:47943877-47943899 GCCAACTTTTGTCCTCATTGAGG - Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1159703131 18:71654820-71654842 CCCAACTCTAGCTCTGTTTGTGG + Intergenic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1162928730 19:13944741-13944763 CACTACTCCTGGCCTGTTTGGGG + Intronic
1163095387 19:15053642-15053664 GCCTACTCCAGGCCTGTTTGGGG + Intronic
1164097085 19:22021336-22021358 GACAACTCTTGGCCTATTACTGG - Intergenic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1168458962 19:56538504-56538526 GCCAACGCTGGGCCTGGGTGTGG - Intergenic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG + Intergenic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935663097 2:105486852-105486874 GGCAACTCTGGGCCTGCTTTGGG + Intergenic
936397969 2:112143362-112143384 GCCACCTCCTCGCCTGTGTGGGG + Intronic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
938982256 2:136537961-136537983 GATAACTCCTGGTCTGTTTGGGG + Intergenic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG + Intergenic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
944116396 2:196191602-196191624 GCAACCTCTTGGCCTCTTTTGGG + Intergenic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
946412172 2:219520889-219520911 GCTAACTGTTGCCCTGTGTGAGG + Intronic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
946860911 2:223999660-223999682 GCCAGCTCCTGGCCCTTTTGGGG + Intronic
1169915538 20:10678891-10678913 GCAAACTTGTGGCCTGGTTGTGG - Intergenic
1172109812 20:32538296-32538318 CCCAACCCTGGGCCTGATTGTGG - Intronic
1173798626 20:45880403-45880425 GCCAAGTTTTGGCTTGTTTAAGG + Intergenic
1174169827 20:48609310-48609332 GCAAACTCTTGGGCTGTCTGGGG + Intergenic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1178292883 21:31384709-31384731 GACAGCTCTTGACCTATTTGTGG - Intronic
1179043443 21:37825017-37825039 GCCAACTCCTTCCCTGTGTGTGG + Intronic
1180005154 21:45017399-45017421 CCCAACTCTTGGCTTGGTTGGGG + Intergenic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949310647 3:2694093-2694115 CCCAAGTCTTTGCCTGTTTCTGG + Intronic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
950909033 3:16568542-16568564 GCAAACTCCTGGCCAGGTTGTGG - Intergenic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951760384 3:26141039-26141061 TCCAATTCTTGGTCTGTCTGAGG + Intergenic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
964742238 3:159978452-159978474 TCTAACTCTTGGCCTGTTCTGGG - Intergenic
965226766 3:166000756-166000778 GACAGCTCTTGGCCTGTTAGTGG - Intergenic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968501404 4:951856-951878 GCCAGCTGTTGGGCTGTTGGGGG + Intronic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
969038185 4:4273039-4273061 CCCATCTCTGGGCCTGTTTCTGG - Intronic
969949549 4:10820384-10820406 GCCCACTATTGGCAAGTTTGTGG - Intergenic
972629213 4:40828935-40828957 GCCAACTCCTGGCCTGGGTTGGG + Intronic
973021751 4:45211399-45211421 GCCTATTCTTGACCTGTTTTAGG + Intergenic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977466002 4:97383382-97383404 GACAACTCTTGGTCTGTTACTGG + Intronic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980387946 4:132111173-132111195 GACAACACTTGGCCTGTTACTGG - Intergenic
980497526 4:133605354-133605376 GACAGCTCTTGGCCTGTTATTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
984801172 4:183718442-183718464 GCCTACTGTGGGCCAGTTTGTGG + Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG + Intergenic
986318388 5:6607102-6607124 GCCACTTCTTGGTCGGTTTGAGG - Intronic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989414892 5:41162452-41162474 GCCAACTCTTAACCTGATGGGGG - Intronic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
990490492 5:56298508-56298530 TCCAGTTCTTGGCCTGTCTGTGG + Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995439123 5:112170686-112170708 GTAAACTATTGGCCTGTCTGAGG + Intronic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1006387348 6:33738763-33738785 GCCAAGTCCTGGCCTCCTTGTGG - Intronic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1008427100 6:51371527-51371549 TCCATATCTTTGCCTGTTTGTGG - Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1012522420 6:100136879-100136901 GTCAACTCTAGGCCTGTGTGCGG - Intergenic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1015699366 6:136018513-136018535 GCCAACACTTGGCATGTGTCTGG + Intronic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1017533353 6:155320065-155320087 GCAAGCACTTGGCATGTTTGAGG - Intergenic
1018535030 6:164810484-164810506 GACCACTCTTGGCCTGTTACTGG - Intergenic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1030911350 7:115252915-115252937 GGCAACTCTTAGCCTGTTGTAGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1035325350 7:158062458-158062480 GCCCACTCTGGCCCTGCTTGAGG + Intronic
1036692989 8:10956453-10956475 GGAAACTCTTGGCCTTCTTGGGG - Intronic
1041043491 8:53869827-53869849 GCCAATTTTGGGCCTGCTTGTGG - Intronic
1041636745 8:60153429-60153451 GCCCACTCTTGCCATGCTTGAGG - Intergenic
1042828413 8:73001332-73001354 TCCAACTCATGGCCTGTGGGTGG - Intergenic
1044150800 8:88773083-88773105 GACAGCTCTTTGCCTGTTAGTGG + Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1047991746 8:130293600-130293622 GCCAGCTCTGGGGCTGATTGTGG - Intronic
1048539140 8:135326600-135326622 GCCACCTGTTGGCCTGATGGAGG + Intergenic
1049787608 8:144458541-144458563 GCACACTGTTGGCCTGGTTGGGG + Intronic
1050276997 9:4010389-4010411 GCTAACTCTGGGCCAGTCTGAGG - Intronic
1051411583 9:16794997-16795019 TCCAAGTCTTGGGCTGTTCGTGG - Intronic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1057446216 9:95116986-95117008 GCCAAGTCTTAGCCTGTTCCTGG + Intronic
1059432994 9:114260922-114260944 GCCAACTCTTCCCCTGCCTGTGG + Intronic
1060889958 9:127181813-127181835 GCCAACTCCTTGCCTGGATGTGG - Intronic
1061048403 9:128179960-128179982 ACCAAGTCTTGGGCTGTATGTGG - Intronic
1062482561 9:136759326-136759348 AGCCACTCTTGGCCTGTGTGGGG - Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1188796892 X:34478203-34478225 GCCCATTATTGGTCTGTTTGGGG + Intergenic
1191011834 X:55768241-55768263 GCCGACTCTTGGCATTTATGAGG + Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194253249 X:91603618-91603640 GGCAACTCTGGGCCTGCCTGAGG + Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG + Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic