ID: 1091863774

View in Genome Browser
Species Human (GRCh38)
Location 12:3811505-3811527
Sequence CCCCACTTTCCAGTTGCCTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091863774_1091863776 4 Left 1091863774 12:3811505-3811527 CCTAAGGCAACTGGAAAGTGGGG 0: 1
1: 1
2: 1
3: 21
4: 212
Right 1091863776 12:3811532-3811554 CTACCTTGATTTTCTCCTTCTGG 0: 1
1: 1
2: 0
3: 41
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091863774 Original CRISPR CCCCACTTTCCAGTTGCCTT AGG (reversed) Exonic
904197996 1:28800477-28800499 CTCCCCTCTCCAGATGCCTTGGG + Intergenic
905029770 1:34874168-34874190 CCCCACTTAGCACTTCCCTTTGG - Intronic
906515074 1:46433987-46434009 CCCCACCCTCTAGTTCCCTTAGG - Intergenic
907771846 1:57473298-57473320 ACCCACCTTCCAGTTGCCCTGGG + Intronic
907914693 1:58857964-58857986 CCCCAGTCTCCAGTTGGTTTTGG - Intergenic
908169300 1:61488734-61488756 CCTCAGCTTCCAGTTCCCTTTGG - Intergenic
908392818 1:63698901-63698923 CCACATTTTCCAGATGACTTGGG - Intergenic
908785657 1:67732391-67732413 CCCCACCTTCCAGATCCCATGGG - Intronic
909926005 1:81438894-81438916 CCCCAAGTTCCAGCTGCCTAAGG + Intronic
910807702 1:91205059-91205081 ACACACTTCCAAGTTGCCTTGGG - Intergenic
911044959 1:93620552-93620574 CCCTCCTTTCCCATTGCCTTGGG + Intronic
913144952 1:115979266-115979288 CTTCACTATCCAGTTTCCTTTGG + Intronic
913174861 1:116264007-116264029 ACACACTTTCGAGTTGCCTTGGG + Intergenic
913531452 1:119737030-119737052 TCCAACTTTCCTGTTGCCTGGGG + Intronic
917840073 1:178970296-178970318 CCCCACACTCCAGAGGCCTTGGG + Intergenic
919553455 1:199022544-199022566 CCCCAATTTCCATGTGCCTAAGG - Intergenic
920022894 1:202968808-202968830 CCCCAGTTTTCAGTTGTATTTGG + Intergenic
920404286 1:205697412-205697434 CCCCCCATTCCAGTGGCCTAGGG + Intergenic
920948465 1:210551310-210551332 CCCCACCTTCCAGTTCCCCATGG - Intronic
922577527 1:226672506-226672528 ACACACTTCCAAGTTGCCTTGGG - Intronic
922594219 1:226801395-226801417 CCCCAATTTCCTCCTGCCTTAGG - Intergenic
922612979 1:226943837-226943859 CACCCCTTTCCAGTTGCCTGTGG + Intronic
923266649 1:232320851-232320873 CTCCACTTTCCAGTTGGGATGGG + Intergenic
1062819152 10:521289-521311 CCTCACATTCCAGATGCCTCAGG - Intronic
1062963586 10:1591443-1591465 CCCCACTGTCTCGATGCCTTTGG - Intronic
1067795951 10:49322416-49322438 CCCCACTTTGCAATTGCATCTGG + Exonic
1069801108 10:71082184-71082206 GGCCACTTGCCAGTTGCATTTGG - Intergenic
1070855156 10:79602893-79602915 CCCCCTTTTCCAGCTGCCCTGGG - Intergenic
1070911994 10:80127042-80127064 CCCCTATTTCCTGTTTCCTTTGG + Intergenic
1072926601 10:99621427-99621449 CCGCACTTCCCTGCTGCCTTTGG - Intergenic
1073518804 10:104105240-104105262 GCCGACTTTCCACTTACCTTTGG - Intergenic
1075631511 10:124003415-124003437 CCCCCCTTTCAAGTTCCCTCAGG - Intergenic
1079358489 11:19750540-19750562 TCCCACCTTCCTGCTGCCTTGGG + Intronic
1080641229 11:34159708-34159730 CCCCCCTTTCCTGCTGCCCTGGG + Intronic
1080679929 11:34464998-34465020 ATCCTCTTTCCAGTTGCCTATGG + Intronic
1081884908 11:46486555-46486577 CCCCACTTCCCTGGTTCCTTAGG - Intronic
1083691211 11:64409934-64409956 CCACACTTTCCAGTGGCTTAGGG + Intergenic
1084506130 11:69569687-69569709 CCCCACTCTCCTGTGGCCTTGGG + Intergenic
1085482387 11:76833415-76833437 ACACACTTCCAAGTTGCCTTGGG + Intergenic
1086628393 11:88987247-88987269 CCCGATTTTCCAGGTGCCGTGGG - Intronic
1087687483 11:101281209-101281231 CCCGATTTTCCAGGTGCCGTCGG + Intergenic
1088365191 11:109032928-109032950 ACCCACTTTCCTATTGCCATGGG + Intergenic
1088840740 11:113625475-113625497 CCCCATCTCCCTGTTGCCTTAGG + Intergenic
1091761923 12:3093222-3093244 GCCCACCTTCCAGCTGGCTTTGG + Intronic
1091863774 12:3811505-3811527 CCCCACTTTCCAGTTGCCTTAGG - Exonic
1093523082 12:20073086-20073108 ACACACTTCCAAGTTGCCTTGGG + Intergenic
1093693678 12:22136782-22136804 CCCAATTTTCCAGGTGCCATGGG - Intronic
1093883381 12:24432003-24432025 CCACTCTTTCCATTTGGCTTAGG + Intergenic
1094098227 12:26732037-26732059 CCTCTCTTTACAGTTGCCTTAGG - Intronic
1095083284 12:38031685-38031707 CCCGATTTTCCAGGTGCCATTGG - Intergenic
1095960124 12:47829074-47829096 CCCCACTTGCCTGGGGCCTTCGG + Intronic
1096895895 12:54820323-54820345 CTCCACTTGCCAGTGGCCTGTGG + Intergenic
1104032284 12:125073532-125073554 CCCCATTTTGCACTTGCCTGAGG + Intronic
1106695076 13:32164213-32164235 CCCCACAGTCCAGTTGCCTTCGG + Intronic
1107998753 13:45887672-45887694 CCTCATTTTCCAGTTGCCTGTGG - Intergenic
1110529224 13:76577005-76577027 CCCCACTTTCCACTTCTCTTTGG + Intergenic
1111934200 13:94542614-94542636 CCCACCTTTCCATTTGCCTGGGG + Intergenic
1112989746 13:105497721-105497743 CCAGACTTTCCAGTCGCCTGTGG + Intergenic
1114713438 14:24801611-24801633 CCCCCCTTTCCTTGTGCCTTTGG - Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1117457349 14:55911779-55911801 CCACACTCTCCAATTACCTTGGG - Intergenic
1117497230 14:56317881-56317903 CCCCAGTTTGCACTTGCATTTGG - Intergenic
1120917052 14:89719593-89719615 CCCCACCTTCCAGTTGGCCTGGG + Intergenic
1121469186 14:94138801-94138823 CTCCACTTCTCAGCTGCCTTTGG + Intergenic
1122843082 14:104476186-104476208 CCCCACTTCCAACTTGCCTCTGG + Intronic
1125167446 15:36724539-36724561 TCCCACAGCCCAGTTGCCTTTGG - Intronic
1125365949 15:38916309-38916331 CCCCTCTCTCCAGGTACCTTTGG - Intergenic
1128151355 15:65365358-65365380 CCTCACATTCCAATGGCCTTGGG + Intronic
1128908023 15:71485587-71485609 CTCCAATTTCCATTTTCCTTAGG - Intronic
1129254548 15:74326770-74326792 CCCCACTTTCCAGTCTGCTGGGG - Intronic
1131305214 15:91236770-91236792 CCCCACCTTCCAGCTGCCCCAGG - Intronic
1131918432 15:97296047-97296069 CCCGATTTTCCAGGTGCCGTCGG + Intergenic
1132131254 15:99282226-99282248 CCACAACTTCCAGTTGCCTCAGG + Intronic
1133830425 16:9318335-9318357 CCTCATTCTCCATTTGCCTTGGG + Intergenic
1141319409 16:82993243-82993265 CCCTCCTTTCCAGATGTCTTGGG + Intronic
1143471267 17:7177478-7177500 CCCCGATTTCCAGTTGCCTCTGG - Intronic
1145405207 17:22584234-22584256 CCCCAGTTTCCAATTTCCTTGGG + Intergenic
1145724453 17:27104904-27104926 CCCGATTTTCCAGGTGCCGTCGG + Intergenic
1148166160 17:45485350-45485372 CCACAATTTCCAGTGGCCTGAGG + Intronic
1148813976 17:50313418-50313440 TCCCACCTTCCAGTTGGGTTTGG - Intergenic
1149276132 17:55039899-55039921 TCCTAATTTCCAGTGGCCTTTGG - Intronic
1150397384 17:64832074-64832096 CCACAATTTCCAGTGGCCTGAGG + Intergenic
1151521895 17:74636209-74636231 ACGCACTTCCAAGTTGCCTTTGG - Intergenic
1155119584 18:22804637-22804659 ACACACTTCCAAGTTGCCTTGGG - Intronic
1155229905 18:23762634-23762656 ACACACTTCCAAGTTGCCTTGGG + Intronic
1156658713 18:39319665-39319687 CCCCACTGTCCAAGTGCTTTGGG + Intergenic
1157209743 18:45731820-45731842 CCCCACTAGCCAGTTCCTTTAGG + Intronic
1161102648 19:2428919-2428941 CCCCACCCTACATTTGCCTTGGG - Exonic
1164454018 19:28392116-28392138 ACACACTTCCCAGGTGCCTTGGG + Intergenic
1166693621 19:44839496-44839518 TCCCACTTTCCTATTGCCCTAGG - Intergenic
1167247810 19:48384213-48384235 TCCCACATTCCAGCTACCTTTGG + Exonic
925860502 2:8170833-8170855 TCCCACTTTCCAGCTGCCAATGG - Intergenic
928103195 2:28451520-28451542 CTCCACTTTCCTGCTGGCTTGGG + Intergenic
928769364 2:34687936-34687958 CCCCACTCTCCAATTTCCATTGG + Intergenic
929539995 2:42811692-42811714 TCCCACATTCCAGTTGGCATAGG - Intergenic
931226467 2:60336125-60336147 CCTCACTCTCCACGTGCCTTGGG + Intergenic
932289329 2:70562256-70562278 CCCCACCTACCAGTTGAATTTGG + Intergenic
937870080 2:126780370-126780392 CTCCAGTTTCCACCTGCCTTTGG + Intergenic
939627111 2:144491208-144491230 CTCCATTTTCCCTTTGCCTTGGG + Intronic
939774755 2:146370822-146370844 CCCCACTTCCCAGTTTTCTCAGG - Intergenic
940959103 2:159762246-159762268 TCCCACTTCCAAGCTGCCTTGGG - Intronic
943612412 2:190048648-190048670 ACACACTTCCAAGTTGCCTTGGG - Intronic
945034439 2:205692248-205692270 CATCCCTTCCCAGTTGCCTTAGG + Intronic
946797743 2:223373608-223373630 CCACACTTTCCATTTATCTTTGG - Intergenic
1169745151 20:8935801-8935823 CTCCACTTGCCAGTGGCCTGTGG + Intronic
1171254151 20:23674187-23674209 ACACACTTTCAAGTTGCCTTGGG + Intergenic
1171260653 20:23729438-23729460 ACACACTTTCAGGTTGCCTTGGG + Intergenic
1171269772 20:23805285-23805307 ACACACTTTCAGGTTGCCTTGGG + Intergenic
1172155481 20:32820761-32820783 CCCTACTTCACAGTTGCCCTCGG + Intronic
1173159917 20:40644758-40644780 CCTCCCTTTCCATTTGCTTTTGG - Intergenic
1173702950 20:45089204-45089226 CCCCAGTATCCATTTACCTTGGG - Intergenic
1174609682 20:51788855-51788877 ACCCACCTTTAAGTTGCCTTTGG + Exonic
1177138670 21:17334113-17334135 CCCCGCTTTCCCATTGCCTTGGG + Intergenic
1178741492 21:35206298-35206320 CCTGGCTTTCCATTTGCCTTGGG + Intronic
1179481010 21:41678711-41678733 CTCCGTTTTCCAGGTGCCTTAGG + Intergenic
1181112770 22:20611621-20611643 CCTCAGTTTCCTGTTGCCTCTGG - Intergenic
1181277177 22:21694508-21694530 CCCCTCTTCCCACGTGCCTTGGG + Intronic
1181673963 22:24439994-24440016 CCCCATTTGCCATTTGACTTGGG - Intronic
1182664435 22:31946658-31946680 CCCCCATTTCAAGTTGCCTCAGG - Intronic
1182784902 22:32899241-32899263 CCCCACTTTTCTGATGCCTATGG + Intronic
950543019 3:13623348-13623370 ACCCACTTTGCAGCTGCCTGGGG - Intronic
951492254 3:23284468-23284490 ACACACTTCCAAGTTGCCTTGGG - Intronic
953071560 3:39525791-39525813 CCTCACCCTCCAGCTGCCTTGGG - Intronic
953350380 3:42210893-42210915 ACCCACATTCCAGTTGCCACTGG + Intronic
956442037 3:69289981-69290003 ACACACTTCCAAGTTGCCTTAGG - Intronic
956782339 3:72613959-72613981 CCCCACCTTCCATTTTTCTTTGG + Intergenic
957034264 3:75279204-75279226 CCCGATTTTCCAGGTGCCATCGG + Intergenic
957439274 3:80222465-80222487 CCACACTTTCCAGTTACATCAGG + Intergenic
960022277 3:112968448-112968470 CTCCACTTTCCAGTAACCTCAGG - Intronic
960427541 3:117527299-117527321 CCATCCTTTCCAGTTACCTTGGG - Intergenic
962671595 3:137714380-137714402 CCCCAATTCCCAGTAGACTTAGG + Intergenic
962993451 3:140601571-140601593 CCCCATTTCCCAGTTCCCTGTGG + Intergenic
963607691 3:147424837-147424859 CCGCACTTTCCACTTGGTTTGGG + Intronic
964634814 3:158847418-158847440 CCCTACTCTGCAGATGCCTTAGG - Intergenic
964639349 3:158892181-158892203 CTCCACTGTGAAGTTGCCTTAGG + Intergenic
968839914 4:2995725-2995747 ACACACTTCCAAGTTGCCTTGGG + Intronic
970461084 4:16275626-16275648 CTCCACTTTCCACTAACCTTAGG + Intergenic
971748501 4:30615300-30615322 TCCCTCTTTCCAGTTCCCTGTGG - Intergenic
971998383 4:33996120-33996142 CCCCACTTTCCAATCTCCTTGGG - Intergenic
972356482 4:38283766-38283788 CCCCACTCTCCAGCTCCCTGCGG + Intergenic
972952661 4:44347442-44347464 CCCCACTGACCAGTAGCCATTGG - Intronic
976247730 4:83020503-83020525 ACCTAGTTTCCAGTTTCCTTAGG - Intergenic
977162310 4:93650224-93650246 CCCCACTTTCCAGTGAATTTTGG - Intronic
978700928 4:111645147-111645169 CTCCACTTTGCACTAGCCTTGGG - Intergenic
979664930 4:123300984-123301006 TCCCCCTTTCCAGATGACTTAGG - Intronic
979756442 4:124345946-124345968 TCCTACTTTCTAGCTGCCTTAGG + Intergenic
979831751 4:125314242-125314264 CCCCACCTTCCAGGTGACTAGGG - Intergenic
980815034 4:137934911-137934933 CACCATTTTCCAGTGGCCCTTGG - Intergenic
981588520 4:146330549-146330571 ACCTACTTTTCAGTTGCATTAGG + Intronic
982932251 4:161423775-161423797 AACCACTTTCAAGTTGGCTTTGG - Intronic
987120455 5:14762114-14762136 ACACACTTCCCAGTGGCCTTGGG - Intronic
988613265 5:32748549-32748571 TCCCACTTTCCCTTTGCCTCGGG - Intronic
988802775 5:34712040-34712062 CCCCAATTTCAAATTTCCTTAGG + Intronic
991032157 5:62094077-62094099 CCACACTCTCCTGTTGCCATGGG + Intergenic
991032891 5:62101029-62101051 CCCCACTTACCACTAGCATTGGG - Intergenic
992426513 5:76663137-76663159 CCCCCATTTCCAGTTGCCCCTGG - Intronic
992642527 5:78780410-78780432 CCCCACACCCCAGTGGCCTTGGG + Exonic
993449101 5:88052581-88052603 CCTGAGTTTCCAGGTGCCTTCGG - Intergenic
993867568 5:93213395-93213417 CCCGATTTTCCAGGTGCCGTCGG - Intergenic
994139799 5:96329516-96329538 CCCCACTGCCCAGTTTCCCTGGG + Intergenic
995564708 5:113421886-113421908 CACCACTTCCCAGTTCCCTGGGG + Intronic
996492163 5:124110708-124110730 ACCCACTTTCCAGTTGCCTTAGG + Intergenic
996527613 5:124496018-124496040 GCACCCTTTCCATTTGCCTTAGG - Intergenic
997698000 5:135876871-135876893 CTCCAGTTCCCAGTTGGCTTGGG + Intronic
1000379314 5:160614719-160614741 CACCACTTTACAGTGACCTTGGG + Intronic
1000468730 5:161611811-161611833 CCCGATTTTCCAGGTGCCGTCGG + Intronic
1002032254 5:176438984-176439006 CCTCACTTTCCTGTTCCCTCAGG - Intergenic
1002773730 6:311001-311023 ACACACTTTCAGGTTGCCTTGGG + Intronic
1003013605 6:2449951-2449973 CCCCATTTTAGACTTGCCTTGGG - Intergenic
1003241987 6:4353077-4353099 CTCCACTTGCAAGTTGACTTCGG - Intergenic
1004281128 6:14280758-14280780 CCTCACTAACCAGTTGTCTTGGG + Intergenic
1004330370 6:14715474-14715496 CTCCACTTCCCTGTTCCCTTGGG - Intergenic
1004745834 6:18508273-18508295 CCCCAGATTGCAGTTTCCTTGGG + Intergenic
1006662870 6:35663396-35663418 CCTCAGTTCCCTGTTGCCTTTGG - Intronic
1008956838 6:57224741-57224763 CCCCACTTTTCCATTTCCTTGGG + Intergenic
1009430811 6:63563753-63563775 ACTCACTTTCCACTTTCCTTGGG - Intronic
1009564832 6:65300530-65300552 CCCCACCTTCCAACTGACTTTGG + Intronic
1011643983 6:89440539-89440561 ATCCACTTCTCAGTTGCCTTCGG + Intronic
1012396670 6:98805954-98805976 CCTCATTGTCCAATTGCCTTTGG + Intergenic
1013862200 6:114649412-114649434 CCCCACCTTCCTGTTGCTTTGGG - Intergenic
1013868446 6:114726480-114726502 CCCGATTTTCCAGGTGCCGTTGG + Intergenic
1015204534 6:130619835-130619857 TCCCTCATTCCAGTTGCCTTGGG + Intergenic
1016301098 6:142632744-142632766 CCCCACTTTGTAACTGCCTTAGG - Intergenic
1021484998 7:21157827-21157849 AGCCACTTTCAAGTTGCCTGAGG + Intergenic
1022896151 7:34751930-34751952 CCCCCACTTCCAGTTGCCTCAGG - Intronic
1024486132 7:49922473-49922495 CCAGATTTTCCAGTTGCCCTTGG - Intronic
1028792969 7:94874473-94874495 ACACACTTCCAAGTTGCCTTGGG + Intergenic
1030680340 7:112427278-112427300 CCCCACAATCCTGTTGCATTGGG + Intronic
1031751124 7:125575539-125575561 CACAAATTTCCAGTTGCCTTTGG - Intergenic
1035264374 7:157683005-157683027 TTCCACTTTCAAGTTGCATTTGG - Intronic
1035485352 7:159219447-159219469 ACACACTTCCAAGTTGCCTTGGG + Intergenic
1036291084 8:7491224-7491246 CCCCACTTCCCACTTCCCTGGGG - Intergenic
1036330406 8:7820312-7820334 CCCCACTTCCCACTTCCCTGGGG + Intergenic
1037023955 8:14008994-14009016 CCCCAGTTTTGAGTTGCCTTAGG + Intergenic
1037052875 8:14398571-14398593 ACACACTTCCAAGTTGCCTTGGG + Intronic
1037577223 8:20218812-20218834 CCACAATCTCCAGCTGCCTTAGG + Intronic
1037924013 8:22830558-22830580 ACCCACTTTCCATCTTCCTTTGG + Intronic
1037985651 8:23289030-23289052 CCCCACTCTCCAGTCGCCTCCGG + Exonic
1038828870 8:31034696-31034718 ACTCATTTCCCAGTTGCCTTGGG + Intronic
1039962669 8:42261690-42261712 ACACACTTCCAAGTTGCCTTGGG - Intergenic
1040585184 8:48734485-48734507 TCCCACTTTCCAGTGGCCCCTGG - Intronic
1040836459 8:51736615-51736637 ACACACTTTCAGGTTGCCTTGGG - Intronic
1045288182 8:100809980-100810002 CCCCTCTCTCCAGTTCCCTCTGG - Intergenic
1047398549 8:124526233-124526255 ACACACTTCCAAGTTGCCTTGGG - Intronic
1047409830 8:124615262-124615284 CACCGCTCTCCATTTGCCTTGGG - Intronic
1048800919 8:138193193-138193215 CACCACTTACCAGATGACTTTGG + Intronic
1049361723 8:142215264-142215286 CCCCACTTCCTAGCTGCCTGGGG + Intronic
1049496170 8:142934721-142934743 CCCCAGTTTCCTGTGGACTTGGG - Intergenic
1050638673 9:7641744-7641766 CTGCACTTTCCAGTTCACTTCGG - Intergenic
1053277707 9:36795819-36795841 CACCACTTTCCAGCTGTCTTTGG + Intergenic
1054769195 9:69068464-69068486 CTCCACTTGCCAGTGGCCTGTGG - Intronic
1056049931 9:82757593-82757615 CCCGATTTTCCAGGTGCCATCGG + Intergenic
1056309035 9:85321231-85321253 CTCCACTTGCCAGTGGCCTGTGG - Intergenic
1056764589 9:89436897-89436919 CCCCATTGTCCCGTGGCCTTAGG - Intronic
1056951546 9:91044233-91044255 ACACACTTCCAAGTTGCCTTGGG - Intergenic
1056973700 9:91231308-91231330 CCCGATTTTCCAGGTGCCGTCGG + Intronic
1057136036 9:92688579-92688601 CCCCACTTTCCACTTCTTTTGGG - Intergenic
1057250264 9:93495148-93495170 CGCCACTTGCCAGTGGCCTGTGG + Intronic
1057494077 9:95546257-95546279 CCCCAATTTCCCGTTGATTTGGG + Intergenic
1057550293 9:96047290-96047312 CCCCACTTTTTACTTGTCTTTGG + Intergenic
1059080940 9:111249347-111249369 ACACACTTCCAAGTTGCCTTGGG + Intergenic
1059647510 9:116281865-116281887 CCCTACCTTCCCGTAGCCTTGGG - Intronic
1059755703 9:117291370-117291392 CCCCACTCTCCAGGAGCCCTCGG - Exonic
1060010673 9:120040616-120040638 CCTCACTTTCCTTATGCCTTAGG + Intergenic
1060541635 9:124434599-124434621 CCCCTCTTACCTGTTGCCATGGG + Intergenic
1062046371 9:134426336-134426358 ACCCACTTTACAGTAACCTTTGG - Intronic
1189124437 X:38431233-38431255 ACACACTTCCAAGTTGCCTTGGG - Intronic
1192118640 X:68434154-68434176 CCCCTCTTTCCAGCCTCCTTCGG + Intergenic
1193124582 X:77857629-77857651 CACCACTTACCACTTTCCTTGGG - Intronic
1193506540 X:82350398-82350420 AACTACTTTCCAGTTGCCTGAGG + Intergenic
1193600702 X:83505982-83506004 CCCCACCTTGCAGCTGCCTTTGG - Intergenic
1194213121 X:91092918-91092940 CCACATTTTACAGGTGCCTTTGG - Intergenic
1195677184 X:107515625-107515647 CCCCATTTTCCTGGTCCCTTGGG - Intergenic
1195884307 X:109624117-109624139 CTCCAGCTTCCAGTTGCCTTAGG - Exonic
1197388771 X:125833880-125833902 CACCACTTTACGGTGGCCTTTGG + Intergenic
1199541661 X:148964630-148964652 CCCCATTTACCCTTTGCCTTAGG - Intronic