ID: 1091864589

View in Genome Browser
Species Human (GRCh38)
Location 12:3820496-3820518
Sequence CAATGGGAACAGTTTTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091864589_1091864595 13 Left 1091864589 12:3820496-3820518 CCAGAGTAAAACTGTTCCCATTG 0: 1
1: 0
2: 0
3: 13
4: 356
Right 1091864595 12:3820532-3820554 AAAATGTTCTAGGGAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 160
1091864589_1091864593 3 Left 1091864589 12:3820496-3820518 CCAGAGTAAAACTGTTCCCATTG 0: 1
1: 0
2: 0
3: 13
4: 356
Right 1091864593 12:3820522-3820544 TTCTTAGTATAAAATGTTCTAGG 0: 1
1: 0
2: 2
3: 31
4: 415
1091864589_1091864594 4 Left 1091864589 12:3820496-3820518 CCAGAGTAAAACTGTTCCCATTG 0: 1
1: 0
2: 0
3: 13
4: 356
Right 1091864594 12:3820523-3820545 TCTTAGTATAAAATGTTCTAGGG 0: 1
1: 0
2: 4
3: 15
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091864589 Original CRISPR CAATGGGAACAGTTTTACTC TGG (reversed) Intronic
900841256 1:5050349-5050371 CAATGGGCACAGCTTTATTCTGG - Intergenic
902069840 1:13724889-13724911 TAATGTTAACAGTTGTACTCAGG + Intronic
902638753 1:17752513-17752535 CAATGGGAACAGTTGGAACCAGG + Intergenic
906785024 1:48607858-48607880 CAATGTGAGCTGTTTTACACAGG - Intronic
907435462 1:54443148-54443170 CAATGAGAACAGTTGGACACAGG - Intergenic
907926911 1:58964068-58964090 CAATGGGAACACTTGGACACAGG + Intergenic
908821153 1:68087790-68087812 CAATGAGAACACTTGTACACAGG - Intergenic
910057442 1:83049694-83049716 CAATGGGAACACTTGGACACAGG + Intergenic
910572644 1:88723051-88723073 CAGTCTGAACAGTTTTCCTCTGG - Intronic
911547885 1:99242345-99242367 AAAAGGGAACACTTTTACACTGG - Intergenic
911967432 1:104385849-104385871 TGATGGGCACAGCTTTACTCTGG - Intergenic
912019357 1:105087619-105087641 CGGTGGGAAAAGTTTTACTGCGG + Intergenic
912722851 1:112034669-112034691 CAATGGGAACAGATTTTGTGGGG + Intergenic
915681388 1:157585028-157585050 AAATGGGAACAGTTTTCCACTGG + Intronic
916698948 1:167270745-167270767 TACTGGGAACAGTTTTAATATGG + Intronic
917114528 1:171589259-171589281 GGATGGGCACAGATTTACTCTGG + Intronic
917192940 1:172437531-172437553 CAATGAGAACACTTTGACACAGG + Intronic
919064991 1:192683148-192683170 CAATGAGAACACATGTACTCAGG - Intergenic
919391070 1:196986562-196986584 CAATGGGAACACTTGGACACAGG - Intronic
922148796 1:222978138-222978160 AAATAGGAACACTTTTACACTGG - Intronic
922843302 1:228662628-228662650 CAATGAGAACAGTTGGACACAGG + Intergenic
1065414647 10:25471152-25471174 CAATGAGAACAGTTGGACACAGG - Intronic
1066583587 10:36907650-36907672 CAATGAGAACAGTTGGACACAGG - Intergenic
1068831208 10:61497346-61497368 CAAGTGGAACAGTTTTGCCCAGG + Intergenic
1069226701 10:65954002-65954024 AAATAGGAACACTTTTACACTGG - Intronic
1069353193 10:67553953-67553975 CAATGGGAACACTTGGACACAGG - Intronic
1070099996 10:73376535-73376557 AAATGGGAACACTTGTACACAGG + Intronic
1070229154 10:74545354-74545376 CAATGTGAATAGTTTTAAGCTGG + Intronic
1071066247 10:81639575-81639597 AAATAGGAACACTTTTACACTGG - Intergenic
1072017768 10:91366247-91366269 CAATGGGAACACTTGGACACAGG + Intergenic
1072380743 10:94867166-94867188 CAATGAGAACACTTGGACTCAGG - Intergenic
1074035145 10:109731251-109731273 CAATGTGAACAGTTGGACACAGG - Intergenic
1074694337 10:116035074-116035096 CAATGGGAACACTTGGACACAGG - Intergenic
1075965086 10:126604247-126604269 CCCTGGGCTCAGTTTTACTCAGG - Intronic
1076946144 10:133651760-133651782 CAATGAGAACAGATGTACACCGG - Intergenic
1078122206 11:8522421-8522443 CAATGAGAACAGTTGGACACAGG + Intronic
1080200896 11:29668590-29668612 CAATGAGAACACTTGTACACAGG + Intergenic
1081490862 11:43567550-43567572 AAGAGAGAACAGTTTTACTCTGG + Intronic
1082579043 11:54844217-54844239 CAATGGGAACACTTGGACGCAGG + Intergenic
1083494259 11:63036511-63036533 CAATGAGAACACTTGTACACAGG - Intergenic
1084413021 11:69014872-69014894 CAATGGGGCCTCTTTTACTCGGG + Intergenic
1086108866 11:83176633-83176655 CAATGGGAACACTTGGACACAGG + Intronic
1087311614 11:96550537-96550559 AAATAGGAACACTTTTACACTGG + Intergenic
1088577830 11:111288650-111288672 CAATGGGAACACTTGGACACAGG - Intergenic
1088936481 11:114405844-114405866 CAATGCGAACATTTTAACTAAGG - Intronic
1091605826 12:1950577-1950599 AAATGAGAACACTTTGACTCAGG + Intronic
1091864589 12:3820496-3820518 CAATGGGAACAGTTTTACTCTGG - Intronic
1092896759 12:13019455-13019477 CATTGGGAACAGATTTTATCTGG - Intergenic
1093358969 12:18200900-18200922 CAATGGACACAGCTTTATTCTGG - Intronic
1093832978 12:23788387-23788409 CCATGGGAAAATTTTCACTCAGG - Intronic
1094481755 12:30888872-30888894 CAATGGGAACACTTGGACACAGG - Intergenic
1094826259 12:34271433-34271455 CAATGGACACAGCTTTATTCTGG - Intergenic
1095799015 12:46252284-46252306 CAATGAGAACAGTTGGACACAGG + Intronic
1095902556 12:47343167-47343189 CAATGAGAACAGTTGGACACAGG + Intergenic
1097385435 12:58945200-58945222 CAATGGGAACACTTGGACGCAGG - Intergenic
1097952453 12:65447063-65447085 CAATGGGGAATGGTTTACTCTGG - Intronic
1098480362 12:70950761-70950783 CAAAGGGAACACTTATACACTGG - Intergenic
1098699980 12:73611632-73611654 CAATGAGAACAGTTGGACACAGG + Intergenic
1099261809 12:80391738-80391760 CAATGAGAACACTTGTACACAGG + Intergenic
1099740909 12:86632704-86632726 CAATGAGAACAGTTGGACACAGG + Intronic
1100099377 12:91084284-91084306 CAATGAGAACAGTTGGACACAGG - Intergenic
1100953517 12:99879872-99879894 TAATGGGTAGAGTTTTGCTCTGG - Intronic
1101118934 12:101559044-101559066 CAATGAGAACACTTGGACTCAGG + Intergenic
1103123506 12:118400543-118400565 CAATCAGAACTGTTTTACTGGGG - Intronic
1106119906 13:26851548-26851570 CAATGAGAACACTTGGACTCAGG - Intergenic
1106516488 13:30459320-30459342 GAATGGGAACAGTTTTTTTAGGG - Exonic
1108084400 13:46769986-46770008 CAATGGGAACACTTGGACACAGG - Intergenic
1108806037 13:54157693-54157715 CAATGGGAACACTTGGACACAGG - Intergenic
1109044969 13:57399000-57399022 AAATGGGAACATTTATACACTGG - Intergenic
1109321044 13:60810225-60810247 CAATGGGAACAGTATCCCTTGGG + Intergenic
1109630956 13:65045547-65045569 CAATGAGAACAGTTGGACACAGG + Intergenic
1109828388 13:67753980-67754002 CAATGAGAACAGTGTTATTGAGG + Intergenic
1110457761 13:75709414-75709436 AAATAGGAACACTTTTACACTGG - Intronic
1110479457 13:75957428-75957450 AAATAGGAACACTTTTACACTGG + Intergenic
1111279341 13:85998697-85998719 AAATAGGAACACTTTTACACTGG - Intergenic
1111566440 13:90023073-90023095 CAATGAGAACACTTGTACACAGG - Intergenic
1111787116 13:92802745-92802767 CAATGGGAACACTTGGACACAGG + Intronic
1112155518 13:96812684-96812706 TAATGGGAACAGTTTCACTTAGG - Intronic
1112296019 13:98187980-98188002 AAATGTGAACACTTTTCCTCAGG - Intronic
1113287119 13:108862469-108862491 ATGTGGGAACAGTTTTAATCTGG - Intronic
1114011494 14:18373971-18373993 CAATGGGAACACTTGGACACAGG + Intergenic
1115048102 14:29023026-29023048 CAATGAGAACACTTGTACACAGG - Intergenic
1115955017 14:38768209-38768231 AAATAGGAACACTTTTACACTGG + Intergenic
1116322557 14:43489339-43489361 CAATGAGAACACTTTGACACAGG + Intergenic
1118936807 14:70296186-70296208 CAATGGACACAGCTTTATTCTGG + Intergenic
1120833723 14:89021683-89021705 CAATGGGAACACTTGGACACAGG + Intergenic
1121192777 14:92044777-92044799 CGATGGGCACAGCTTTATTCTGG + Exonic
1121389494 14:93562126-93562148 CAATGGACACAGCTTTATTCTGG + Intronic
1121478917 14:94244105-94244127 CAAGGGGAACTGTATTATTCTGG + Intronic
1122485150 14:102074379-102074401 TAATGGGAACAGTTTTCATTTGG - Intergenic
1123486612 15:20746025-20746047 AAATAGGAACACTTTTACACTGG + Intergenic
1123543102 15:21315075-21315097 AAATAGGAACACTTTTACACTGG + Intergenic
1127814139 15:62591817-62591839 CAATGGGATCAGGTGTGCTCAGG + Intronic
1130954609 15:88618718-88618740 AAATGGGAAGGGTTTTAGTCTGG + Intergenic
1133802907 16:9098461-9098483 GATTGGGAACAGTTTTATTTTGG + Intronic
1134016355 16:10891221-10891243 CATTGGGAACATTTTGACTGGGG + Intronic
1134812962 16:17182828-17182850 CAATGGGAACAGGATTACAAAGG + Intronic
1134900180 16:17931198-17931220 TAATGGGAACACTTTGACTTTGG + Intergenic
1135948055 16:26882914-26882936 CAATGAGAACACATTGACTCAGG + Intergenic
1136127692 16:28196436-28196458 TAATGGGTACAGGTTTCCTCTGG + Intronic
1136901261 16:34040737-34040759 CAATGAGAACAGTTGGACACAGG + Intergenic
1137233442 16:46591114-46591136 CAATGAGAACACTTGTACACAGG + Intronic
1137318503 16:47353006-47353028 CAATGAGAACAGTTGGACACAGG + Intronic
1139031158 16:62882538-62882560 CTATGGGATCAATTATACTCAGG + Intergenic
1139053431 16:63153077-63153099 CAATGGGAACAGATGGACACAGG + Intergenic
1140713792 16:77703358-77703380 CAGAGGGAACAGTTGGACTCTGG + Intergenic
1140799852 16:78476403-78476425 CAATGAGAACAGTTGGACACAGG + Intronic
1143310792 17:5987338-5987360 CAATGGGAACACTTGGACACAGG + Intronic
1143823633 17:9586205-9586227 CAATGGAAACAGCTTTAAGCGGG - Intronic
1146171206 17:30635049-30635071 CAATGGGGACAGTGTGACTGGGG - Intergenic
1155409252 18:25524208-25524230 CAATGGGAACACTTGGACACAGG - Intergenic
1156675899 18:39527163-39527185 CAATCGGAATATTTTTACACTGG + Intergenic
1156923635 18:42553128-42553150 CAATGGACACAGCTTTATTCTGG + Intergenic
1158099132 18:53809709-53809731 AAATAGGAACACTTTTACACTGG + Intergenic
1158383023 18:56956406-56956428 CAAGGGGGACAGTTTTGTTCAGG - Intronic
1160938099 19:1606937-1606959 CAATGGGAAGAGTCTTATTCAGG - Intergenic
1163940504 19:20488360-20488382 CAATGAGAACAGTTAGACACAGG + Intergenic
1164132480 19:22377714-22377736 AAATAGGAACACTTTTACACTGG - Intergenic
1164655197 19:29915915-29915937 CAATGGGAACACTTGGACACAGG - Intergenic
1165001367 19:32765685-32765707 CAATGGGAACACTTGGACACAGG + Intronic
927235399 2:20869247-20869269 CAATGGGTACAGTTTTTGTTTGG - Intergenic
928707213 2:33963039-33963061 CAATATTAATAGTTTTACTCTGG - Intergenic
929812824 2:45206163-45206185 CACTGGGATCAGTGTTACTGCGG - Intergenic
931108725 2:59086941-59086963 CAATGAGAACAGTTGGACACAGG - Intergenic
932008429 2:67951281-67951303 GAATGAGAAGAGCTTTACTCTGG + Intergenic
934141818 2:89054209-89054231 CAATGGACACAGCTTTATTCTGG - Intergenic
936807289 2:116350551-116350573 CATTGGGGTCAGTTTTACACTGG + Intergenic
936900621 2:117478134-117478156 AAATAGGAACACTTTTACACTGG + Intergenic
938932760 2:136101083-136101105 CAATGGGAAGTGTTTTAAGCAGG - Intergenic
939295852 2:140263339-140263361 AAATGGCAGCAGTTATACTCAGG + Intronic
939975340 2:148710793-148710815 CAATGGGAACACTTGGACACAGG + Intronic
941246863 2:163109350-163109372 CAAAGGGAAAAGTTTTAGTGAGG - Intergenic
941970906 2:171350156-171350178 CAATGGGAACACTTGGACACAGG - Intronic
942609691 2:177730270-177730292 CAATGAGAACAGTTGAACACAGG - Intronic
942830598 2:180234465-180234487 CAATGGGAACACTTGGACACAGG + Intergenic
943284248 2:185976908-185976930 AAATAGGAACACTTTTACACTGG + Intergenic
943528640 2:189050711-189050733 CCTTGGGTACAGTTTTACCCTGG - Intronic
944150463 2:196552954-196552976 TAATGGAAACATTTTTCCTCGGG - Intronic
944984074 2:205154843-205154865 CAATGAGAACAGTTGGACACAGG + Intronic
946719598 2:222590312-222590334 CAATGAGAACAGTTGGACACAGG + Intronic
946781776 2:223198873-223198895 CAATGAGAACAGTTGGACACAGG + Intergenic
947044609 2:225967307-225967329 CAGGGTGAATAGTTTTACTCTGG + Intergenic
947463149 2:230320448-230320470 CAATGGGAACATTTGGACACAGG - Intergenic
1168925090 20:1572584-1572606 CAATGGAAGCAGTTTTGCTCTGG + Intronic
1168928967 20:1605612-1605634 CAATGGAAGCAGTTTTGCTCTGG + Intronic
1169423330 20:5476937-5476959 CAATGGGAACACTTGGACACAGG + Intergenic
1169648025 20:7835531-7835553 TAAGGGGAACAGTTTATCTCTGG - Intergenic
1171082325 20:22199644-22199666 AAATAGGAACACTTTTACACTGG + Intergenic
1171786127 20:29466342-29466364 CAATGAGAACACTTGTACACAGG - Intergenic
1171882015 20:30624623-30624645 CAATGGGAACACATGGACTCAGG + Intergenic
1174695088 20:52549218-52549240 CAATGAGAACAGTTGGACACAGG + Intergenic
1177667483 21:24180021-24180043 AAATAGGAACACTTTTACACTGG + Intergenic
1177942821 21:27432099-27432121 CAATGGGAACACTTGGACACAGG - Intergenic
1180435988 22:15304775-15304797 CAATGGGAACACTTGGACACAGG + Intergenic
1180583803 22:16867624-16867646 CAATGAGAACACTTGGACTCAGG - Intergenic
1182715119 22:32352215-32352237 CAATGAGAACACTTGTACACAGG + Intergenic
1183660595 22:39218753-39218775 CAATGAGAACACTTTGACACAGG + Intergenic
1183847209 22:40552199-40552221 CATTGGCAACAGCTTCACTCTGG + Exonic
950253324 3:11485160-11485182 AAATAGGAACACTTTTACACTGG - Intronic
950260381 3:11539005-11539027 CAATGTGAAAAGCTTTAATCTGG + Intronic
950308112 3:11932031-11932053 AAATAGGAACAATTTTACACTGG + Intergenic
950309791 3:11947104-11947126 AAATAGGAACACTTTTACACTGG - Intergenic
950769337 3:15298826-15298848 GAATGGGTACAGTTTCAGTCTGG + Intronic
951039024 3:17967647-17967669 CAATGGGAACATTTTTTTACAGG + Intronic
952146642 3:30540347-30540369 CAATGAGAACAGTTGGACACAGG - Intergenic
952939311 3:38429750-38429772 CAATGGGAACACTTGGACACAGG - Intergenic
953550908 3:43901881-43901903 CAATGGAAGCAGTTTTAGACAGG + Intergenic
953708539 3:45249679-45249701 AAATAGGAACAGTACTACTCTGG - Intergenic
954475004 3:50736094-50736116 CAATGGGAACACTTGGACACAGG - Intronic
955401251 3:58593121-58593143 CAATGGACACAGCTTTATTCTGG - Intronic
955822260 3:62908730-62908752 CAATGAGAACACTTGGACTCAGG + Intergenic
956044988 3:65186198-65186220 CAATGGGTACAGGTTTTTTCGGG - Intergenic
956048082 3:65217868-65217890 CAATGGGAACACTTGGACACGGG - Intergenic
956570276 3:70686909-70686931 CAATGAGAACAGTTGAACCCAGG - Intergenic
957121608 3:76101750-76101772 CAATGGGAACACTTGGACACAGG - Intronic
957121647 3:76101894-76101916 CAATGGGAACACTTGGACACAGG - Intronic
957306341 3:78462974-78462996 CAATGGGAACACTTGGACACAGG - Intergenic
958184077 3:90097050-90097072 CAATGAGAACACTTGGACTCAGG - Intergenic
958423575 3:93955523-93955545 CAATGAGAACAGTTGGACACGGG + Intronic
958811561 3:98865903-98865925 CAATGAGAACAGTTGGACACAGG - Intronic
959246846 3:103881462-103881484 CAATGAGAACAGTTGGACACAGG - Intergenic
960450400 3:117799651-117799673 CATGGGGAACATTTTTAATCAGG + Intergenic
960835555 3:121902970-121902992 AAATAGGAACACTTTTACACTGG - Intronic
963032581 3:140993464-140993486 CAATGGGAACACTTGGACACAGG + Intergenic
963588665 3:147228026-147228048 CAATGGGAACACTTGGACACAGG - Intergenic
964182374 3:153904021-153904043 CAATGGGAACACTTGGACACAGG - Intergenic
964189312 3:153983592-153983614 CAATGGGAACACTTGGACACAGG - Intergenic
964273731 3:154986672-154986694 CAATGGGAACACTTGGACACAGG + Intergenic
964914140 3:161818757-161818779 CAGTGGGCACAGCTTTCCTCTGG + Intergenic
965120482 3:164548419-164548441 CAATGGGAACACTTGGACCCAGG + Intergenic
965335627 3:167428465-167428487 CAATGGACACAGCTTTATTCTGG - Intergenic
965739512 3:171859097-171859119 CAATGGGAACACTTGGACACAGG + Exonic
965999022 3:174924255-174924277 CAATGAGAACAGTTGGACACAGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970000826 4:11364460-11364482 CAATGGGAACAGTCTTCCTGGGG - Intergenic
970245436 4:14056892-14056914 CAATGAGAACATTTTCACACAGG - Intergenic
970414188 4:15840193-15840215 CACTGGGAACAAATTGACTCAGG + Intronic
970504509 4:16713821-16713843 CAATGTGAACATTTTCTCTCAGG - Intronic
970833877 4:20376820-20376842 CAATGAGAACAGTTGGACACAGG + Intronic
972905830 4:43745918-43745940 CAATGAGAACAGTTGGACACAGG + Intergenic
972991295 4:44824836-44824858 CAATGAGAACACTTTGACACAGG + Intergenic
973269163 4:48243764-48243786 CAATGAGAACAGTTGGACACAGG + Intronic
974666069 4:64963255-64963277 CAATATCAATAGTTTTACTCAGG + Intergenic
975402796 4:73956860-73956882 CAATGAGAACAGTTGGACACAGG - Intergenic
977008337 4:91601864-91601886 AAATGGGAACAGTTTATTTCAGG - Exonic
977117125 4:93043710-93043732 CAATGAGAACAGTTGGACACAGG + Intronic
977137351 4:93322240-93322262 CAATGAGAACAGTTGGACACAGG - Intronic
977503088 4:97865648-97865670 CAATGAGAACACTTGGACTCAGG + Intronic
977680486 4:99793268-99793290 AAATAGGAACACTTTTACACTGG - Intergenic
977726698 4:100304345-100304367 CAGTAGGAAGAGTTTTATTCAGG + Intergenic
978464070 4:108988806-108988828 CACTGGCAACACTTTTCCTCTGG + Intronic
978596731 4:110385916-110385938 CAATGAGAACAGTTGGACTCAGG - Intronic
978948082 4:114523167-114523189 AAATAGGAACACTTTTACACTGG - Intergenic
979031599 4:115655275-115655297 CAATGAGAACACTTTGACACAGG + Intergenic
980329671 4:131393958-131393980 CAATGGGAACACTTGGACACAGG - Intergenic
982449234 4:155532335-155532357 CAATGGAAACAATAATACTCAGG + Intergenic
982457573 4:155628551-155628573 CTTTTGGAACAGTTTGACTCTGG + Intergenic
982620915 4:157703817-157703839 CAATGAGAACACTTGGACTCAGG + Intergenic
982632838 4:157853927-157853949 CAAGGGGTCCAGTTTTAGTCTGG + Intergenic
982880167 4:160704176-160704198 CAATGAGAACAGTTGGACACAGG - Intergenic
983216908 4:165010524-165010546 CAATGGGAACGGGATTGCTCAGG - Intergenic
983746626 4:171208536-171208558 CAATGAGAACAGATGGACTCAGG - Intergenic
983892313 4:173042641-173042663 AAATAGGAACAATTTTACACTGG - Intergenic
984308338 4:178023810-178023832 CAATGAGAACAGTTGGACACAGG + Intergenic
985063349 4:186099168-186099190 CAATAAGAACAGTTTTAGGCTGG - Intergenic
985449554 4:190052414-190052436 CAATGAGAACAGATGTACACCGG - Intergenic
985977911 5:3436000-3436022 AAAAGGGAACACTTTTACACTGG - Intergenic
988170200 5:27643345-27643367 CAATGGGAACACTTGGACACAGG + Intergenic
988843893 5:35110164-35110186 CAATGAGAACAGTTGGACACAGG + Intronic
990686491 5:58308728-58308750 CAATGAGAACAGTTGGACACAGG + Intergenic
992032254 5:72733537-72733559 CAATGAGAACAGTTGGACACAGG + Intergenic
993023323 5:82618125-82618147 CAATGAGAACAGTTGGACACAGG + Intergenic
993627575 5:90244156-90244178 CAATGGGAACACTTGGACACAGG + Intergenic
993781841 5:92075891-92075913 CAATGAGAACACTTGTACACAGG - Intergenic
994706470 5:103212769-103212791 AAATGAAAACAGTTTTACTTGGG - Intronic
995599414 5:113779441-113779463 CAATGGGGAAATTTTTTCTCTGG + Intergenic
996725292 5:126668993-126669015 TGATGGGCACAGCTTTACTCTGG + Intergenic
996952125 5:129139832-129139854 CAATGGGAACACTTGGACACAGG - Intergenic
997981461 5:138470143-138470165 CAATGGGAACAGATTTGGCCCGG - Intergenic
998181717 5:139950655-139950677 CAATGGGATTAGTTTAATTCTGG - Intronic
998931213 5:147183394-147183416 CAATGAGAACACTTTGACACAGG - Intergenic
1001853456 5:174989917-174989939 CAATGAGAACACTTGGACTCAGG - Intergenic
1202774677 5_GL000208v1_random:58060-58082 AAATAGGAACACTTTTACACTGG - Intergenic
1005365691 6:25074426-25074448 AAATAGGAACACTTTTACACTGG - Intergenic
1005525635 6:26645008-26645030 CAATGTGAACAGTTAGACACAGG - Intronic
1007082918 6:39121375-39121397 CAATGGACACAGTTTTATTCTGG - Intergenic
1007823971 6:44584358-44584380 CAATGAGAACAGTTGGACACAGG - Intergenic
1008025093 6:46627158-46627180 TAATGGGGACAGTTTTCCCCAGG - Intronic
1008095286 6:47333776-47333798 CAATGGGAACACTTGGACACAGG + Intergenic
1008195664 6:48516960-48516982 CAATGAGAACAGTTGGACACAGG - Intergenic
1008995532 6:57654053-57654075 CAATGAGAACACTTTGACACAGG + Intergenic
1009343724 6:62589004-62589026 CAATGGACACAGCTTTATTCTGG - Intergenic
1009355411 6:62738871-62738893 AAATAGGAACACTTTTACACTGG - Intergenic
1010121448 6:72380194-72380216 CAATGGGAACACTTGGACACAGG + Intronic
1011332310 6:86223879-86223901 CAATGGGAACACATTGACACAGG - Intergenic
1011394250 6:86889791-86889813 CAAAAGGAACACCTTTACTCTGG + Intergenic
1012067980 6:94574872-94574894 CAATGGGAACACTTGGACACAGG + Intergenic
1012115956 6:95298927-95298949 CAATGAGAACAGTTGGACACAGG - Intergenic
1012324857 6:97904303-97904325 CAATGGGAACACTTGGACACAGG - Intergenic
1014277737 6:119405471-119405493 AAATAGGAACACTTTTACACTGG + Intergenic
1015892658 6:137983985-137984007 CAATGAGAACACTTTGACACAGG - Intergenic
1016020017 6:139227449-139227471 CAATGGGAACACTCATACACTGG + Intergenic
1016992589 6:149940330-149940352 GATTGGGAACTGTGTTACTCAGG - Intergenic
1017099573 6:150835926-150835948 TAATGGGAACAGTTTATCTTTGG - Intronic
1017207887 6:151823665-151823687 CAATGAGAACAGTTGGACACAGG - Intronic
1017754300 6:157516856-157516878 CCATGGGAACAGGTTTCATCTGG - Intronic
1018011637 6:159676121-159676143 AAATAGGAACACTTTTACACTGG + Exonic
1018114442 6:160570009-160570031 AAATAGGAACATTTTTACACTGG + Intronic
1018325623 6:162664510-162664532 AAATAGGAACACTTTTACACTGG - Intronic
1019257978 7:63794-63816 CATTGAGAACAGTTTAACACAGG + Intergenic
1019856307 7:3611850-3611872 AAAAGGGAACACTTTTACACTGG + Intronic
1021748797 7:23773975-23773997 CAATGGGAACACTTGAACACAGG - Intronic
1023062755 7:36343917-36343939 CCATCTGATCAGTTTTACTCAGG - Intronic
1023747024 7:43331179-43331201 CAATGGGAACACTTGGACACAGG - Intronic
1023879608 7:44310812-44310834 TAATGGGGACAGTTTCACTTAGG + Intronic
1024753240 7:52495101-52495123 CAATGGGAACACTTGGACACAGG - Intergenic
1026924753 7:74182939-74182961 CAATGAGAACAGTTTCACCAGGG - Intronic
1027739857 7:81987704-81987726 CAATGGAAATAGATTTAATCTGG + Intronic
1027871300 7:83711614-83711636 CAATGAGAACAGTTGGACACAGG - Intergenic
1027895694 7:84041061-84041083 AAATGTGAACAATTTTATTCAGG + Intronic
1030178315 7:106677963-106677985 AAATAGGAACACTTTTACACTGG + Intergenic
1030194042 7:106835768-106835790 CAATGGACACAGCTTTATTCTGG - Intergenic
1030709315 7:112731376-112731398 CAATGAGAACAGTTGGACACAGG - Intergenic
1031006231 7:116475721-116475743 CAATGAGAACACTTGGACTCAGG + Intronic
1031170297 7:118285077-118285099 CAATGAGAACACTTGTACACAGG + Intergenic
1031247992 7:119341496-119341518 CAATGAGAACACTTGTACCCAGG + Intergenic
1031467804 7:122135071-122135093 CAATGGGAACACTTGGACACAGG + Intronic
1034388295 7:150760149-150760171 CAATGAGAACAGTTGGACACAGG - Intergenic
1034404143 7:150890898-150890920 CAATGGGTACAGGGTTACTTTGG + Intergenic
1035603905 8:916473-916495 CAATGAGAACAGTTGGACACAGG + Intergenic
1037162019 8:15784789-15784811 CAAAGGGGACAGTTTTAGTTAGG + Intergenic
1037625943 8:20607243-20607265 AAAAGGGAACACTTTTACACTGG - Intergenic
1037995304 8:23348203-23348225 CAATGAGAACAGTTGGACACAGG + Intronic
1038855950 8:31333799-31333821 CAATGAGAACACTTGTACACAGG + Intergenic
1038879988 8:31598882-31598904 CAATGAGAACACTTTGACACAGG - Intergenic
1039140993 8:34388030-34388052 CAATGGGAACACTTGGACACAGG - Intergenic
1039755239 8:40515780-40515802 CAATGGGAACACTTGGACACAGG - Intergenic
1040085156 8:43332393-43332415 CAATGAGAACAGTTGGACACAGG + Intergenic
1040738804 8:50546576-50546598 CAATGAGAACACATTTACACAGG - Intronic
1040748169 8:50671568-50671590 AAATAGGAACACTTTTACACTGG + Intronic
1041106618 8:54450586-54450608 GAATGTGAGCATTTTTACTCTGG - Intergenic
1041692931 8:60707013-60707035 CAATGGGAACACTTGGACACAGG - Intronic
1041998247 8:64089589-64089611 CAATGAGAACAGTTGGACACAGG + Intergenic
1042116981 8:65443010-65443032 CAATGTGGACAGTATTACTCTGG - Intergenic
1043274054 8:78371276-78371298 CCATGGGAAAATTTTTACTTGGG + Intergenic
1043339272 8:79218010-79218032 CAAGGGGAAAGGCTTTACTCTGG + Intergenic
1043827918 8:84951621-84951643 CAATGAGAACAGTTGGACACAGG - Intergenic
1043828826 8:84963199-84963221 CAATGAGAACAGTTGGACACAGG + Intergenic
1045106576 8:98898417-98898439 CAATAGGGTCAGTTTCACTCAGG + Intronic
1045645185 8:104290875-104290897 CAATGGACACAGCTTTATTCTGG - Intergenic
1045708747 8:104958823-104958845 CAATGAGAACACTTGTACACAGG - Intronic
1047558302 8:125958200-125958222 CAACTGGAACAGTTTGAGTCAGG + Intergenic
1047746473 8:127848788-127848810 CTGTGGGAACAGTTGTGCTCAGG + Intergenic
1048373673 8:133803049-133803071 CAATGAGAACACTTGTACCCAGG + Intergenic
1048594071 8:135847952-135847974 AAATAGGAACACTTTTACACTGG - Intergenic
1048696249 8:137031484-137031506 CAATGGGAGCAGTTTTTATGGGG + Intergenic
1050073793 9:1843134-1843156 CATTGTGAACAGTTTTAGTAAGG + Intergenic
1050281050 9:4050394-4050416 CAATGAGAACACTTGTACACAGG + Intronic
1051223019 9:14870367-14870389 GTGTGAGAACAGTTTTACTCTGG - Intronic
1052499960 9:29276134-29276156 CAATGGGAACACTTGGACACAGG + Intergenic
1055922324 9:81473988-81474010 GAATGGGCACATTTTTCCTCTGG - Intergenic
1056205926 9:84319287-84319309 CATTTGGAACAATTTAACTCAGG - Intronic
1056393720 9:86162474-86162496 AAATAGGAACACTTTTACACTGG + Intergenic
1056405522 9:86270467-86270489 AAATAGGAACACTTTTACACTGG + Intronic
1058136110 9:101309356-101309378 CAATGGGAACATTTGTACTGGGG + Exonic
1058563640 9:106257508-106257530 CAATGAGAACACTTGGACTCAGG - Intergenic
1059524363 9:114976740-114976762 CAATGAGAACAGTTGGACACAGG + Intergenic
1059960708 9:119561730-119561752 CAATGAGAACAGTTGGACACAGG + Intergenic
1061960421 9:133985800-133985822 CAGTGGGAACTGTGTTACACCGG - Intronic
1186042782 X:5499876-5499898 CAATGGGAACACTTGGACACAGG + Intergenic
1186968586 X:14815117-14815139 CAATGGGAACAGTTGGACACAGG + Intergenic
1187195844 X:17082790-17082812 CAAGGGGAACAGTATGACTGAGG + Intronic
1187459138 X:19469925-19469947 AAATAGGAACACTTTTACACTGG + Intronic
1187589670 X:20703621-20703643 AAATAGGAACACTTTTACACTGG - Intergenic
1187596403 X:20777500-20777522 CAATGGGAACACTTGGACACAGG + Intergenic
1187813259 X:23203847-23203869 AAATAGGAACACTTTTACACTGG + Intergenic
1188336913 X:28947500-28947522 CAATGAGAACAGTTGGACACAGG + Intronic
1189584765 X:42447516-42447538 AAATAGGAACACTTTTACACTGG - Intergenic
1189598474 X:42595173-42595195 AAATAGGAACACTTTTACACTGG + Intergenic
1190551556 X:51587179-51587201 CAATGGGAACACTTGGACACAGG - Intergenic
1191177594 X:57521710-57521732 AAATAGGAACACTTTTACACTGG - Intergenic
1191203016 X:57804846-57804868 CAATGGGAACACTTGGACACAGG - Intergenic
1191710433 X:64144461-64144483 CAATGAGAACACTTTGACACAGG + Intergenic
1191756782 X:64601642-64601664 CAATGGGAACACTTGGACACGGG - Intergenic
1191761818 X:64654838-64654860 CAATGGACACAGCTTTATTCTGG - Intergenic
1191782535 X:64884471-64884493 CAATGAGAACACTTTGACACAGG + Intergenic
1191828390 X:65390204-65390226 CAATGAGAACACTTGGACTCAGG + Intronic
1192612824 X:72584945-72584967 CAATGGGAACACTTGGACACAGG - Intronic
1192731041 X:73802967-73802989 CAATGGACACAGCTTTATTCTGG + Intergenic
1193065652 X:77256599-77256621 CAATGGGAACACTTGAACACAGG - Intergenic
1193259885 X:79392877-79392899 CAATGGGAACACTTGGACACAGG + Intergenic
1193261898 X:79417649-79417671 CAATGGGAACACTTGGACACAGG - Intergenic
1193728794 X:85077301-85077323 CAATGAGAACACTTGTACACAGG - Intronic
1195249484 X:103029257-103029279 CAATGAGAACAGTTGGACACAGG + Intergenic
1195282827 X:103353428-103353450 CAATGAGAACAGTTGGACACAGG - Intergenic
1195632816 X:107077112-107077134 CAAAGGGAACAGTCTTAGTATGG - Intronic
1195826488 X:109006704-109006726 CAATGGGAACACTTGGACACAGG + Intergenic
1196307574 X:114122451-114122473 AAATAGGAACATTTTTACACTGG - Intergenic
1196527820 X:116747922-116747944 AAATAGGAACACTTTTACACTGG + Intergenic
1196994141 X:121362371-121362393 AAATAGGAACACTTTTACACTGG - Intergenic
1197269394 X:124409286-124409308 AAATAGGAACACTTTTACACTGG - Intronic
1199007773 X:142722525-142722547 AAATAGGAACACTTTTACACTGG + Intergenic
1199300892 X:146212600-146212622 CAATGAGAACAGTTGGACACAGG + Intergenic
1199684172 X:150251417-150251439 CAATGAGAACAGTTGGACCCAGG + Intergenic
1199825337 X:151493097-151493119 TAAAGGGAAGAGTTTTCCTCTGG + Intergenic
1201061234 Y:10048694-10048716 TGATGGGCACAGGTTTACTCTGG + Intergenic
1202167023 Y:22000491-22000513 CAACGAGAACAGTTTGACACAGG + Intergenic
1202224337 Y:22585882-22585904 CAACGAGAACAGTTTGACACAGG - Intergenic
1202318777 Y:23609778-23609800 CAACGAGAACAGTTTGACACAGG + Intergenic
1202551991 Y:26060280-26060302 CAATGAGAACAGTTTGACACAGG - Intergenic