ID: 1091865958

View in Genome Browser
Species Human (GRCh38)
Location 12:3837128-3837150
Sequence ATTCAGCAACACCACATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 7, 3: 29, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091865957_1091865958 -7 Left 1091865957 12:3837112-3837134 CCAAATCAGAGTGGCTATTCAGC 0: 4
1: 31
2: 76
3: 75
4: 104
Right 1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG 0: 1
1: 0
2: 7
3: 29
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091865958 Original CRISPR ATTCAGCAACACCACATTGT AGG Intronic