ID: 1091865958

View in Genome Browser
Species Human (GRCh38)
Location 12:3837128-3837150
Sequence ATTCAGCAACACCACATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 7, 3: 29, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091865957_1091865958 -7 Left 1091865957 12:3837112-3837134 CCAAATCAGAGTGGCTATTCAGC 0: 4
1: 31
2: 76
3: 75
4: 104
Right 1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG 0: 1
1: 0
2: 7
3: 29
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091865958 Original CRISPR ATTCAGCAACACCACATTGT AGG Intronic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
908536924 1:65086808-65086830 ATTTAGTAACACCAAATTATTGG + Intergenic
909597861 1:77426714-77426736 ATTCACCAAGACTACATTCTGGG + Intronic
911220634 1:95241629-95241651 ATTCAGAAATGCCAGATTGTGGG + Intronic
911477923 1:98396719-98396741 ATTAAGAAACACAACATTGCTGG - Intergenic
914353271 1:146858631-146858653 CTTATGCAACACCACATTGGTGG - Intergenic
915090951 1:153425717-153425739 AATCAGGAACTCCACACTGTAGG + Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
917602398 1:176589695-176589717 ATTCATCAAAGCCACATTCTTGG - Intronic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
923899248 1:238307317-238307339 ATTCAGCAATGTCTCATTGTTGG - Intergenic
924810025 1:247392702-247392724 ATTCACCAAGACACCATTGTGGG - Intergenic
1067195849 10:44117280-44117302 ATTCAGGCAAAGCACATTGTAGG + Intergenic
1069914263 10:71777744-71777766 ATCCAGCAGCACCTCATAGTGGG - Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1072901378 10:99410156-99410178 ATTCAGGTAAACCACAATGTGGG - Intronic
1073595180 10:104792393-104792415 ATTCTTCAGAACCACATTGTTGG + Intronic
1074556600 10:114497021-114497043 ATTCAGCAACATCTGATTTTTGG - Intronic
1075387288 10:122064521-122064543 ATTGAACAAAACCACATTATTGG + Intronic
1076573435 10:131448333-131448355 TTTCTGCAACGCCGCATTGTGGG - Intergenic
1077071960 11:678950-678972 ATTCAGGATCACCACATTTCAGG - Intronic
1077803488 11:5566387-5566409 AATAAGCAACACCTCATTTTAGG + Intronic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081923555 11:46802715-46802737 CTTATGGAACACCACATTGTAGG - Intronic
1083661428 11:64253177-64253199 CCTCAGCCACACCCCATTGTGGG - Intronic
1086777151 11:90851842-90851864 ATTCTGCCACACTAGATTGTGGG + Intergenic
1087567276 11:99877445-99877467 ATTTACCAAAACCACATTCTTGG + Intronic
1089797090 11:120989573-120989595 TTTCAGCAACACCAGATTGGTGG + Intergenic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1095991954 12:48041062-48041084 ATTTAGAAAGACAACATTGTGGG - Intergenic
1097258083 12:57695822-57695844 ATCCAGCAATACCACATGGAAGG + Exonic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1098238741 12:68443882-68443904 TTTCAGCAACACCCCACTCTCGG + Intergenic
1098543390 12:71684771-71684793 ACACAGCTACACCACAGTGTTGG + Intronic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1099926347 12:89023017-89023039 ATTCAGGAACTTCACATTGCTGG + Intergenic
1100206960 12:92360641-92360663 ATTCAGGAAAACCACATAGGAGG - Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1105467388 13:20658637-20658659 ATTGTGCAATTCCACATTGTGGG + Intronic
1108666938 13:52642159-52642181 GATCACCAACCCCACATTGTTGG - Exonic
1110796509 13:79644821-79644843 TTTCAGAAACACCAAATTGCAGG + Intergenic
1112092575 13:96097253-96097275 ACTAAGCAAATCCACATTGTTGG - Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1115678526 14:35709946-35709968 ATTCACCAAGACCACATTCTGGG - Intronic
1124388148 15:29226868-29226890 ATTCAGCAACAATACATAATTGG + Intronic
1125184088 15:36910716-36910738 TTTCAGCCACAGCACATTTTAGG - Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1128878307 15:71220512-71220534 ATTCAACAACCCCACATGATAGG - Intronic
1130978803 15:88798472-88798494 ACTCAGGCACACCAAATTGTGGG + Intergenic
1131944103 15:97600203-97600225 ACTCAGCATCACCATATTGTGGG - Intergenic
1137947131 16:52744394-52744416 ATTCAGTGACATCACATTGGTGG - Intergenic
1138930089 16:61643295-61643317 ATCCAGCAATGCCACATTATGGG - Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139980753 16:70856886-70856908 CTTATGCAACACCACATTGGTGG + Intronic
1140433695 16:74926931-74926953 ATTTATTAACACCTCATTGTTGG - Intronic
1141455454 16:84138411-84138433 AGTGAGCAATACCAAATTGTAGG + Intronic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149011396 17:51860440-51860462 ATTCAGAAACATCACATATTTGG - Intronic
1149947391 17:60945445-60945467 ATTCACTAATACCACATTCTTGG - Intronic
1153578524 18:6547779-6547801 AATTAGCAAATCCACATTGTGGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156827978 18:41455944-41455966 ATGCAGGAAGACCACATAGTGGG + Intergenic
1157413452 18:47482810-47482832 ATTCTTAAACACCACATTTTTGG + Intergenic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
925774001 2:7314421-7314443 CTACAGCAACCCCACATAGTTGG - Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
934330858 2:92066843-92066865 ATTCAGCAGCACCACATCTCAGG - Intergenic
937029770 2:118728983-118729005 ATCCAGCAAGCCCAAATTGTAGG + Intergenic
939603321 2:144221255-144221277 ATTCAGCAATACCACTTTTAAGG + Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
940790882 2:158028622-158028644 TTTCAGCAACACCCCATTTCTGG + Intronic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
942011733 2:171769979-171770001 ATTCACAAAGACCACATTCTGGG + Intergenic
942284068 2:174396121-174396143 TTTCAGAAACATCATATTGTTGG - Intronic
946263562 2:218518837-218518859 ATGCAGCATCATCACACTGTGGG - Intronic
946476260 2:220009472-220009494 ATTCAGAAATAGCTCATTGTGGG + Intergenic
946898400 2:224348452-224348474 ATTTAGGACAACCACATTGTTGG - Intergenic
1168729953 20:67556-67578 ATTCAGCAAAAGCACAGTCTAGG + Intergenic
1169676517 20:8160355-8160377 TTTCAGCAACACCACACTACTGG + Intronic
1170432993 20:16294416-16294438 GCTCAGCAACACCCCTTTGTTGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1177147689 21:17424235-17424257 ATTCTGTAACAACACATTTTAGG - Intergenic
1181904864 22:26186377-26186399 ATTCAGGACCACCACATTGATGG + Intronic
950245109 3:11408470-11408492 TTTCAGCAACACCCCATTCCTGG + Intronic
951036315 3:17936524-17936546 ATTCAGCAACGAGACATTGTTGG + Intronic
951952006 3:28210165-28210187 AATCACCAACACCAGTTTGTGGG - Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954457809 3:50609467-50609489 GTTCAGTAACACCATATTCTTGG + Intronic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
956266795 3:67405497-67405519 ATTCACAAACACAACATTTTTGG + Intronic
959257680 3:104035630-104035652 ATTCAGCAACACTTCTATGTAGG + Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964480641 3:157135059-157135081 ATTCAGCAACTCCACTCTGTGGG - Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
966456075 3:180117837-180117859 ATGCAGCCACACCATGTTGTTGG - Intergenic
966672289 3:182540630-182540652 ATTCTTCAACACTCCATTGTTGG - Intergenic
967462395 3:189761682-189761704 TTTCAGCAACACCACACTTCTGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
969430767 4:7152775-7152797 ATTCAGCACCACAAAAGTGTGGG - Intergenic
970329917 4:14970194-14970216 ATTCAGCAATTCCACTTTGAGGG - Intergenic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
972212335 4:36854193-36854215 TTTCAAAAACACCACATTCTTGG + Intergenic
974626221 4:64431429-64431451 AGTCAGCCACACCTCATAGTCGG - Intergenic
974983707 4:68993303-68993325 ATTTAGCATCACCACAATTTTGG - Intergenic
976046387 4:80953215-80953237 AATCACCAACACCACTTTTTTGG + Intronic
976957741 4:90923334-90923356 AAACAGCAACAACACATTGTTGG - Intronic
978889316 4:113804225-113804247 TTGCACCAATACCACATTGTAGG - Intergenic
979376008 4:119947613-119947635 ATTCAGCAACATCAAATCATGGG - Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982612382 4:157592108-157592130 ATTTTGCAAGACTACATTGTAGG + Intergenic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984130668 4:175871637-175871659 ATTCACCAACACAACATTTTTGG + Intronic
986081211 5:4395932-4395954 TTTCAGCAACACCCCACTCTTGG + Intergenic
986671683 5:10148110-10148132 ATTCAGCAAGATCACATCCTAGG + Intergenic
988162720 5:27542782-27542804 ATACAGCAAAACCATATCGTGGG - Intergenic
988299999 5:29410918-29410940 ATTCAGCAATACCACTTACTGGG + Intergenic
988388355 5:30595849-30595871 ATTTAGAAACTCCACATTTTGGG + Intergenic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
989709733 5:44383497-44383519 ATTCAGAGACACCAAATTCTAGG - Intronic
990570877 5:57077440-57077462 ATTCACTAAGACCACATTCTGGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
991942713 5:71868120-71868142 ATTCAGCAACTACACTTTGGGGG - Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
996042564 5:118832286-118832308 ATTCAGTTACAGCACAGTGTAGG + Intergenic
996582788 5:125049899-125049921 TCTCAGCAACACCACATTCATGG + Intergenic
996600278 5:125254452-125254474 TTTCAGCAACACCCCACTCTTGG + Intergenic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999856353 5:155598967-155598989 TTTCAACAAATCCACATTGTTGG - Intergenic
999969765 5:156847612-156847634 ATTCAGCAGCAGTACATTGTAGG + Intergenic
1000842321 5:166235284-166235306 AGTGAACAACATCACATTGTAGG + Intergenic
1001913389 5:175539816-175539838 ATTCAGCAACCCCTTATTGAGGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1008313837 6:50014083-50014105 ATTCAGAGACAACACATTGGAGG + Intronic
1010939381 6:81897689-81897711 ATTCAGCAAGACCAAATTAAAGG + Intergenic
1012206639 6:96469068-96469090 ATTCAGAAACACCTCGTTTTTGG + Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1014327703 6:120019211-120019233 TTTCAGCAGCACCACATTTCTGG + Intergenic
1014502378 6:122207438-122207460 ATTCAGCAATAGCACATTTGTGG + Intergenic
1014776862 6:125521020-125521042 ATTCACCAACAAAACATTTTGGG + Intergenic
1014970588 6:127810383-127810405 AATCACCAACACAACATTGTTGG + Intronic
1015073770 6:129130020-129130042 TTTCAGCTACAGCACATTATTGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1016859946 6:148707535-148707557 ATTCAGTGACACCATATTGGTGG - Intergenic
1016870950 6:148816060-148816082 ATTCTGCAACACGGGATTGTTGG + Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018751927 6:166814025-166814047 ATTGATCAACCCCATATTGTTGG + Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022657474 7:32332924-32332946 ATTAAGAAACAGAACATTGTTGG - Intergenic
1023287959 7:38638365-38638387 CTTCAGAAACACCTCAGTGTAGG - Intergenic
1023713964 7:43023771-43023793 CTTCAGGAACACCACACTCTTGG - Intergenic
1024601174 7:50982863-50982885 ATTCAGCATCTCCACACTGAGGG - Intergenic
1024682052 7:51701086-51701108 ATTCAGATAGACCACATTCTGGG + Intergenic
1025900798 7:65743074-65743096 ATTAAGAAAAACAACATTGTTGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1030478281 7:110067060-110067082 ATTCATCAACTCCACAGAGTGGG - Intergenic
1031365365 7:120894799-120894821 TTTCAGCAGCACCCCATTCTCGG - Intergenic
1034681757 7:152934168-152934190 TTTCGGCAGCACCACAATGTCGG - Intergenic
1036110529 8:5895773-5895795 TTTCAGAAACACCACATTCCAGG + Intergenic
1037033982 8:14143547-14143569 ATTCTGAAACACCATATTGGAGG + Intronic
1037282772 8:17261814-17261836 ATTCAGCAGCTCCATGTTGTAGG - Intronic
1043124479 8:76372898-76372920 ACTCAGCAATAACAGATTGTTGG - Intergenic
1047064526 8:121265637-121265659 CAGCAGCAACACCACACTGTGGG + Intergenic
1047641197 8:126823581-126823603 ATTCAGCACCATCACATTTCAGG - Intergenic
1048254336 8:132894279-132894301 ATTCAGGAACACCACACAGCAGG + Intronic
1049076194 8:140398262-140398284 TTTCAGCAACACTCCATTCTGGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052259892 9:26502322-26502344 ATTCATGAACATCATATTGTGGG - Intergenic
1055774556 9:79753433-79753455 TTACAGCAACACCCCATTGCTGG + Intergenic
1056034029 9:82584904-82584926 GTGCAGCAACCCCACAATGTAGG + Intergenic
1059126698 9:111694930-111694952 ATACACAAACACCACATTTTTGG - Intronic
1059219301 9:112597708-112597730 ATTCAGCATCTCAACATGGTAGG - Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060806540 9:126581173-126581195 ATTCACCAACTCCACACTGTGGG + Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1193082287 X:77417654-77417676 ATTTAGTAACCCCAGATTGTGGG - Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194579001 X:95648099-95648121 CTTCAGAGACAGCACATTGTTGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1196657489 X:118233953-118233975 AATCAACAAAACCACATAGTTGG + Intergenic
1196770257 X:119286455-119286477 ATTCAGCATCTCAAAATTGTTGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1197359783 X:125486209-125486231 ATGCAACAAAACCACATGGTTGG - Intergenic
1197551103 X:127893815-127893837 ATTTAGCAACACCACACAGTAGG - Intergenic
1198150943 X:133908742-133908764 AATAAGCTACACCACATTGTTGG + Intronic
1199413019 X:147547629-147547651 CATCAGCAACACCACAGTTTAGG - Intergenic
1199448400 X:147953249-147953271 ATTCAGCTTCACTACTTTGTAGG - Intergenic