ID: 1091866205

View in Genome Browser
Species Human (GRCh38)
Location 12:3839232-3839254
Sequence GCGTCGAGCAGCCGGCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 0, 2: 1, 3: 2, 4: 94}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091866189_1091866205 9 Left 1091866189 12:3839200-3839222 CCAGCCCGAGCCGCCGCCTACCC 0: 1
1: 3
2: 4
3: 45
4: 358
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866187_1091866205 11 Left 1091866187 12:3839198-3839220 CCCCAGCCCGAGCCGCCGCCTAC 0: 1
1: 1
2: 2
3: 43
4: 341
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866192_1091866205 4 Left 1091866192 12:3839205-3839227 CCGAGCCGCCGCCTACCCCAGGC 0: 1
1: 1
2: 3
3: 25
4: 306
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866185_1091866205 17 Left 1091866185 12:3839192-3839214 CCCGAGCCCCAGCCCGAGCCGCC 0: 2
1: 1
2: 10
3: 123
4: 940
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866186_1091866205 16 Left 1091866186 12:3839193-3839215 CCGAGCCCCAGCCCGAGCCGCCG 0: 2
1: 0
2: 14
3: 303
4: 848
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866197_1091866205 -4 Left 1091866197 12:3839213-3839235 CCGCCTACCCCAGGCCGGGGCGT 0: 1
1: 1
2: 0
3: 19
4: 210
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866188_1091866205 10 Left 1091866188 12:3839199-3839221 CCCAGCCCGAGCCGCCGCCTACC 0: 1
1: 3
2: 0
3: 31
4: 221
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866184_1091866205 29 Left 1091866184 12:3839180-3839202 CCGCTCGCGGAGCCCGAGCCCCA 0: 2
1: 0
2: 0
3: 10
4: 127
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866198_1091866205 -7 Left 1091866198 12:3839216-3839238 CCTACCCCAGGCCGGGGCGTCGA 0: 1
1: 1
2: 1
3: 5
4: 92
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866190_1091866205 5 Left 1091866190 12:3839204-3839226 CCCGAGCCGCCGCCTACCCCAGG 0: 1
1: 1
2: 2
3: 22
4: 460
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94
1091866195_1091866205 -1 Left 1091866195 12:3839210-3839232 CCGCCGCCTACCCCAGGCCGGGG 0: 1
1: 1
2: 7
3: 36
4: 385
Right 1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG 0: 2
1: 0
2: 1
3: 2
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091866205 Original CRISPR GCGTCGAGCAGCCGGCGGCC TGG Intronic
901491176 1:9597100-9597122 GCTTAGAGCAGCCGGGGGACAGG + Intronic
901703912 1:11059713-11059735 GAGGCGGGCAGCAGGCGGCCCGG + Intronic
902296790 1:15473015-15473037 GCATCTAGCAGCCTGGGGCCAGG + Intronic
905867123 1:41382418-41382440 GCGTCCAGCAGGAGGCCGCCGGG - Exonic
908473860 1:64470314-64470336 GCAGCGAGCAGGCGGCGGCGAGG - Intergenic
916179145 1:162069540-162069562 GCGTCGCGCGGCCGGGGGCGCGG + Intergenic
1069158092 10:65054054-65054076 GCGGGTAGCAGCCGGCGGCCAGG - Intergenic
1074865683 10:117543242-117543264 GCGCCGAGGAGCGGGCGCCCTGG - Exonic
1075492089 10:122880014-122880036 GCGCCGGGCCGCCGGCGACCGGG + Intergenic
1076291748 10:129350770-129350792 GCGGCAAGCAGACGGCGGGCTGG + Intergenic
1076515715 10:131043401-131043423 GCAAGGAGCAGCCGGCTGCCTGG - Intergenic
1077374509 11:2199257-2199279 GCCTGGAGCAGGAGGCGGCCTGG + Intergenic
1081743274 11:45455686-45455708 GTTTACAGCAGCCGGCGGCCAGG - Intergenic
1081863492 11:46347407-46347429 GCGGCGGGCAGGCAGCGGCCCGG + Intronic
1084334089 11:68446819-68446841 GCGTCGAGGGGCCGGGGGCTTGG + Intronic
1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG + Intronic
1100830948 12:98516125-98516147 GAGCCGAGCAGCCGTCGGCAGGG + Exonic
1101603834 12:106233108-106233130 ACTCGGAGCAGCCGGCGGCCTGG + Intergenic
1105725708 13:23160320-23160342 GCGTCCAGCCGGCGGCGCCCTGG + Intergenic
1113914724 13:113863555-113863577 ACGGTGAGCAGCCGGCGGGCGGG - Exonic
1118767005 14:68916611-68916633 ACGTTGAGAAGCCGGAGGCCCGG - Intronic
1118932380 14:70254940-70254962 GCGGCGGGCGGCGGGCGGCCAGG - Intergenic
1119290579 14:73491849-73491871 GCGGCGGGCAGCGCGCGGCCGGG - Exonic
1121308685 14:92923326-92923348 GCGCCGAGCAGCTGGCGGTGTGG - Exonic
1122697406 14:103562753-103562775 GCGTGGCGCTGCCGGCGGCTAGG - Intronic
1125664335 15:41417717-41417739 GCGTCGAGCAGTTGGGGGCGAGG + Intronic
1128264308 15:66253700-66253722 GCCGCGAGCAGCCGGGAGCCGGG + Exonic
1131510004 15:93044610-93044632 TCGGCGAGCAGCAGTCGGCCGGG + Intronic
1133156709 16:3880908-3880930 GCGTAGGGAAGCTGGCGGCCCGG + Intergenic
1134042284 16:11077747-11077769 GCGTGGTGCTGCAGGCGGCCTGG + Intronic
1136540596 16:30925758-30925780 TCGTCGAGCAGCCGGGGGCCGGG + Exonic
1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG + Intronic
1142239868 16:88940312-88940334 ACGTGGAGCAGAAGGCGGCCAGG - Exonic
1142300961 16:89257536-89257558 CCGCCGAGCAGCCCGCGTCCAGG - Intergenic
1142388674 16:89783704-89783726 GCATGGAGCTGCAGGCGGCCGGG - Intronic
1144496572 17:15749695-15749717 GCGACTAGTAGCGGGCGGCCAGG + Intergenic
1144606155 17:16667092-16667114 GCGGGTAGCAGCCGGCGGCCAGG + Intergenic
1147995519 17:44358204-44358226 GCGTGGGGCAGAGGGCGGCCCGG + Intronic
1150217149 17:63477104-63477126 GCCTCGGGCCGCCGGGGGCCGGG + Intergenic
1157095095 18:44680187-44680209 GCGGCGAGCGGCGGGCGCCCCGG - Intronic
1157545163 18:48541231-48541253 GCGCCGGGCGGGCGGCGGCCTGG - Intronic
1161053928 19:2180458-2180480 GCAGCGAGCAGGCAGCGGCCTGG - Intronic
1161130976 19:2588533-2588555 GCGTCCAGCTGCCGCCGCCCTGG - Intronic
1164980671 19:32611382-32611404 GCATCCAGCAGCAGGGGGCCAGG + Intronic
1166567514 19:43774243-43774265 AGGCCGAGCAGCAGGCGGCCAGG + Exonic
1166834534 19:45659244-45659266 GCGGGGAGCAGGCGGGGGCCTGG - Intergenic
1168154013 19:54463353-54463375 GCGAGGCGCAGCCGGAGGCCGGG - Exonic
927852206 2:26506471-26506493 GCCTGGAGAAGCCGGCTGCCCGG + Intronic
931348871 2:61470930-61470952 GCGCCGAGGCGCCGGCGGCGGGG + Intergenic
932496700 2:72149086-72149108 GCGGCGGGCGGCGGGCGGCCGGG - Intergenic
941111706 2:161423942-161423964 GCGGCGAGCGCTCGGCGGCCAGG - Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
1172421996 20:34825595-34825617 GGGTCGGGCTGCGGGCGGCCGGG - Intronic
1172764908 20:37346164-37346186 GGGACGGGCAGACGGCGGCCTGG - Exonic
1174317432 20:49713638-49713660 GCGGCGAGCAGCGAGCGGCGCGG + Exonic
1180073259 21:45449248-45449270 GCTTCCAGCTGCCGCCGGCCAGG + Intronic
1180951829 22:19723906-19723928 GCGCCGGGCAACCTGCGGCCGGG - Exonic
1182308572 22:29388514-29388536 GCTCCGAGCCGCCGGCAGCCCGG - Exonic
1183055157 22:35300481-35300503 GCGCCGGACAGCCCGCGGCCAGG + Intronic
1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG + Exonic
1185330739 22:50251107-50251129 GCCGGGAGCAGCCGGAGGCCTGG + Exonic
952383491 3:32821869-32821891 GAGAAGAGCAGCCGCCGGCCAGG - Intronic
952451760 3:33440054-33440076 GGGTGGCGCTGCCGGCGGCCCGG - Exonic
953705270 3:45225982-45226004 GCAGCGGGCAGGCGGCGGCCAGG + Exonic
953989900 3:47475924-47475946 GGGGCGGGCACCCGGCGGCCAGG - Exonic
954613030 3:51956202-51956224 GCGCCGAGCAGCAGGAGGGCGGG - Exonic
954763975 3:52897564-52897586 GCGGCGCGGAGTCGGCGGCCGGG - Exonic
957446684 3:80321065-80321087 GCGTCGAGCCGCGCCCGGCCTGG + Intergenic
961473906 3:127135356-127135378 GCGTCGGGCTGACGGCTGCCTGG + Intergenic
968756424 4:2418467-2418489 GCGCCGAGCGGGCGGCGGGCAGG + Exonic
968980909 4:3848899-3848921 GCGTGGAGCTGGCGGGGGCCAGG - Intergenic
971457882 4:26861094-26861116 CCGGCGAGCTGCAGGCGGCCGGG + Exonic
981475075 4:145180024-145180046 GCGTCGAGCAGCCGGCGGCCTGG - Intronic
985692131 5:1319360-1319382 GGGGGGGGCAGCCGGCGGCCAGG + Intronic
998192990 5:140042760-140042782 GCATGGAGAAGCCGGGGGCCGGG + Exonic
1001470224 5:172006626-172006648 GGGCGGAGCTGCCGGCGGCCCGG - Exonic
1002091816 5:176810601-176810623 GCGCCCGGCAGCCGGCCGCCCGG + Exonic
1002289029 5:178187271-178187293 TCGTCGAGCAGCCGGGTGCTGGG - Intergenic
1003545013 6:7051855-7051877 GCGCCGCGCAGCCCCCGGCCCGG + Intergenic
1007390219 6:41546449-41546471 GCGGCCGGCGGCCGGCGGCCGGG + Exonic
1012548781 6:100449224-100449246 GCGTCGAAGAGCCGCAGGCCAGG - Intronic
1017253036 6:152302227-152302249 GCGCCGCGCAGCCTGCGGTCTGG - Intronic
1019409124 7:899004-899026 GGGGCGGGCGGCCGGCGGCCTGG - Intronic
1020383111 7:7567203-7567225 GCGCCGGGCGGCCGGCCGCCTGG + Intronic
1027829737 7:83162641-83162663 CAGTCGAGAAGCCCGCGGCCAGG + Exonic
1032093386 7:128923289-128923311 GCGTTGAGCAGCCTGGGGGCTGG + Intergenic
1034227970 7:149497606-149497628 GCGGAGAGCACCGGGCGGCCGGG - Exonic
1034979806 7:155468326-155468348 GGGTCGAGCGGCTGGCCGCCCGG - Intergenic
1036910582 8:12754709-12754731 GCGCCTCGCAGGCGGCGGCCAGG + Exonic
1037589986 8:20304051-20304073 GCAGCGAGCTGCCGGCAGCCTGG + Intergenic
1038266095 8:26040887-26040909 GCGCCTAGCAGCCGGCTTCCGGG - Intronic
1051780561 9:20684349-20684371 GGGTCGCGCCGCCTGCGGCCCGG + Intronic
1052824766 9:33166903-33166925 GCCTAGAGGAGGCGGCGGCCGGG + Exonic
1056588469 9:87944751-87944773 CCGTGGGGCAGGCGGCGGCCTGG + Intergenic
1057266884 9:93623055-93623077 GCCTGGAGCAGCCAGGGGCCAGG + Intronic
1057314351 9:93959034-93959056 GCGGCCAGCAGCCAGCGGCAGGG + Intergenic
1058467520 9:105244503-105244525 GCGCTGAGGAGGCGGCGGCCCGG + Intergenic
1061666102 9:132161856-132161878 GCGCCGGGCAGCCCCCGGCCCGG - Intronic
1196085781 X:111681310-111681332 GAGGCGAGCAGGCGGCGGCTTGG + Intronic