ID: 1091877846

View in Genome Browser
Species Human (GRCh38)
Location 12:3951420-3951442
Sequence CAAGCTCCTCTCTCATTAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091877846_1091877850 -2 Left 1091877846 12:3951420-3951442 CCCGTTAATGAGAGAGGAGCTTG No data
Right 1091877850 12:3951441-3951463 TGCTGCGGGATTTCTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091877846 Original CRISPR CAAGCTCCTCTCTCATTAAC GGG (reversed) Intergenic
No off target data available for this crispr