ID: 1091878758

View in Genome Browser
Species Human (GRCh38)
Location 12:3959638-3959660
Sequence TCTGCCAGACAGTGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091878753_1091878758 28 Left 1091878753 12:3959587-3959609 CCATTTATTTGTTCATCTATTTA No data
Right 1091878758 12:3959638-3959660 TCTGCCAGACAGTGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091878758 Original CRISPR TCTGCCAGACAGTGGGAGGC AGG Intergenic
No off target data available for this crispr