ID: 1091879804

View in Genome Browser
Species Human (GRCh38)
Location 12:3967912-3967934
Sequence CAGGCTCTACCTGGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091879796_1091879804 22 Left 1091879796 12:3967867-3967889 CCAGCATTCACCAGTGACAAGAG No data
Right 1091879804 12:3967912-3967934 CAGGCTCTACCTGGGTGTGGTGG No data
1091879793_1091879804 30 Left 1091879793 12:3967859-3967881 CCTTTGCCCCAGCATTCACCAGT No data
Right 1091879804 12:3967912-3967934 CAGGCTCTACCTGGGTGTGGTGG No data
1091879795_1091879804 23 Left 1091879795 12:3967866-3967888 CCCAGCATTCACCAGTGACAAGA No data
Right 1091879804 12:3967912-3967934 CAGGCTCTACCTGGGTGTGGTGG No data
1091879797_1091879804 12 Left 1091879797 12:3967877-3967899 CCAGTGACAAGAGAAGAATGTAC No data
Right 1091879804 12:3967912-3967934 CAGGCTCTACCTGGGTGTGGTGG No data
1091879794_1091879804 24 Left 1091879794 12:3967865-3967887 CCCCAGCATTCACCAGTGACAAG No data
Right 1091879804 12:3967912-3967934 CAGGCTCTACCTGGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091879804 Original CRISPR CAGGCTCTACCTGGGTGTGG TGG Intergenic
No off target data available for this crispr