ID: 1091882814

View in Genome Browser
Species Human (GRCh38)
Location 12:3993171-3993193
Sequence GCCTGCATTCCACTAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091882814_1091882815 1 Left 1091882814 12:3993171-3993193 CCAGGCACTAGTGGAATGCAGGC No data
Right 1091882815 12:3993195-3993217 AGTGAATGACCCCAGATAATAGG No data
1091882814_1091882819 21 Left 1091882814 12:3993171-3993193 CCAGGCACTAGTGGAATGCAGGC No data
Right 1091882819 12:3993215-3993237 AGGTTATGCTCAGAACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091882814 Original CRISPR GCCTGCATTCCACTAGTGCC TGG (reversed) Intergenic
No off target data available for this crispr